Reality goes online - Guernsey Grammar School
-
Upload
khangminh22 -
Category
Documents
-
view
5 -
download
0
Transcript of Reality goes online - Guernsey Grammar School
2 MediaMagazine | December 2009 | english and media centre
MediaMagazine is published by
the English and Media Centre, a
non-profit making organisation.
The Centre publishes a wide range
of classroom materials and runs
courses for teachers. If you’re
studying English at A Level, look out
for emagazine, also published by
the Centre.
The English and Media Centre
18 Compton Terrace
London N1 2UN
Telephone: 020 7359 8080
Fax: 020 7354 0133
We had such a huge response to our Reality theme for
MediaMag that we couldn’t fit in all the interesting ideas
and issues. So for this issue we’ve produced a special extra
bundle of MoreMediaMag articles as a downloadable
PDF.
Reality goes onlinea MediaMag special supplement!
Email for subscription enquiries:
Managing Editor: Michael Simons
Editor: Jenny Grahame
Editorial assistant/admin:
Rebecca Scambler
Cover image: from Desperate Romantics © BBC, 2009
A Special MediaMag Christmas Present for Teachers: On 18th December we’ll be launching Part One of our new online
resource Doing Reality TV – ideal preparation for the AQA GCSE Unit 1
external assessment on Reality TV, or for classroom study whichever
spec you’re following. It includes a Teachers’ Guide, classroom
activities, embedded clips and articles, a quiz, a useful Powerpoint
timeline, and all the ingredients to get started. Parts Two, Three and
Four will be arriving in January. And it’s all there free for the taking on
the MediaMag website. Happy New Year!
english and media centre | December 2009 | MediaMagazine Reality Online Special 3
MediaMag meets Marcus
Bentley – the voice of Big Brother
Before it bites the dust, read our
exclusive interview with the owner of
that laconic Geordie voiceover about BB
and its future, the role of a voiceover
artist, and why he prefers to
remain low profile.
Jean Rouch –
father of Cinema Verité
Kevin Dunk introduces you to
the work of this great, but little-
known documentarist and his
impact on French New Wave
cinema and beyond.
The Boo Radley paradigm
How healthy is reality TV’s
focus on extreme or marginalised
behaviour? Tony Gears argues that
hyper-real shows increasingly rely on
the exploitation and humiliation of
vulnerable people.
I don’t need a man (or do I?)
How ‘real’ is the Pussycat Dolls version of empowerment?
Emma Clarke deconstructs a
music video to suggest that lyrics of
empowerment and feminism are
often undermined by the imagery
and reality of a sexist music
industry.
Playing with personas
Heath Ledger, Joaquin Phoenix and ‘real Life’
Sean Richardson deconstructs
the epic narratives created around
the lives of two very different
but equally talented young
actors.
Being normal
When it comes to realism,
the uncool sixth formers of
Rudge Park Comprehensive enact
some of the typical failures and
embarassments of teenage life so
you don’t have to, says Robin
Makey.
The top five
best-ever not-yet-made reality TV
show of all time!Owen Davey looks to the future
and proposes some un-made
shows which just might make
your fortune...
Hyper-reality
a Rough GuideDavid Bell introduces the
complex and evoloving debates
around hyper-reality and the effect
of digital media forms on our real
and virtual experiences of the
world.
The surveillance
societyWhat’s the relationship between
reality television, new media, and
government policy – and how far are
we becoming a surveillance society as
George Orwell predicted back in the
1940s? Bev Fenner offers some
background. Me, me, mewhy we’re all
celebrities nowChandana Hall explores the
impact of Facebook on our ideas
about celebrity, and the factors that
have made it one of the most
popular social networking
sites in the world.
The work of Adam Curtis
He who controls the present
controls the past. He who controls the
past controls the future (Orwell)
AQA examiner Steph Hendry introduces
you to the stimulating and provocative work of
documentarist Adam Curtis, and walks you
through his imaginative and controversial
installation event ‘It Felt Like a Kiss’.
What’s
in the mix
online?
Steph Hendry on the work of Adam Curtis.
Adam Curtis
4 MediaMagazine | December 2009 | english and media centre
An important part of A Level Media Studies is
the need to consider media texts in context. This
idea means that, rather than look at television
programmes, films, magazines etc as simple
individual artefacts, they need to be viewed as
products of a culture. Whether the text is old
or new it is the way it is, not simply because a
director or editor made personal choices, but
because those choices were influenced by the
culture the text/producer came from. All media
texts in some way reflect their own contemporary
issues and ideas and media students need to
consider texts in this way. Some would argue
that when looking at texts this way there is a
danger of attributing meaning and ideas to
a text that were not intentional. However, all
media producers are themselves products of
their own cultural environment and have a
relationship to the dominant values of the time
which will inevitably influence production. This
fact leads us toward an approach to media
texts which necessitates considering them as
cultural artefacts which reflect, respond to and
(sometimes) challenge the ideas, attitudes and
values of the culture that surrounded them.
Some commentators argue that in the modern
age, the notion of history has been lost and
that the culture is losing the ability to make
connections between the past and the present.
One contemporary film-maker who consistently
tries to show connections between the past
and the present and the influence of politics
and economics on society is the award-winning
Adam Curtis.
For those unfamiliar with his work, Curtis has
made a number of documentary films and series
(most of which can be accessed via yahoo video
searches) which can be exceptionally useful for
Media Students who want to scratch beneath
the surface of the mediated world we live in.
The documentaries consider how politics and
economics have impacted on society in the 20th
and 21st Century; and they also deal with the role
of the media.
Style and presentationCurtis has created a unique audio and visual
style within his documentaries. He uses a mixture
of ‘talking head’ interviews and archive montages
which are accompanied by carefully selected
music and sound effects and, in most of his work,
a voiceover provided by Curtis himself. The sound
of Curtis’ voice is ‘typical BBC’ as he delivers the
stories he is telling in an RP accent that hold
connotations of tradition and authority. He tells
his stories in a calm and reasonable tone and they
are often presented more as spoken essays rather
than conventional narrations. Each documentary
has its own hypothesis and the films develop
their respective arguments by setting a historical
context and drawing in selected evidence to
support the ideas presented.
The music and sound choices are often
carefully selected to lead the viewer to a
particular emotional response (although his
ready use of clichéd music suggests he expects
his audience to recognise exactly what he is
doing). For example, in The Century of the Self,
an ominous drone accompanies discussions
about the rise in dominance of free market
economic values in the West. This is a classic
technique of montage and the visuals use this
method of story-telling too. Curtis uses archive
news and documentary footage to illustrate
his work but many of the images used are clips
from a huge variety of sources which lead the
audience into making connections between the
ideas in the narration and the images. He often
uses advertising images and in a recent work, It
Felt Like a Kiss, media images are supplemented
by ‘home video’ footage and recordings of
psychological treatments/group therapy sessions.
At times the images are unrelated to the story
being told within the documentary but, like
the music chosen, they add to the emotional
responses felt by the audience. Even though the
subject matter of the documentaries is always
serious, sometimes the juxtaposition of sound
and images creates a deliberately satirical effect.
The textsSince 2000 Curtis has written and directed the
following: The Century of the Self (2002). A four
hour journey through the 20th Century which
looks at the influence of Sigmund Freud and
other members of his family on US (and western)
culture. The documentary looks at, amongst
other things, the influence of psychoanalytical
ideas and their use in politics and advertising;
the cultural moves from a ‘citizen’ to a ‘consumer’
culture and from a culture of conformity
to individualism. The documentary takes a
english and media centre | December 2009 | MediaMagazine 5
may be the first PR stunt held in 1922) and the
development of lifestyle marketing. It shows
how ideas that proved to be very successful
for businesses when employed in marketing
have been adopted in modern politics and
consequently changed the nature of politics
itself.
The Power of Nightmares (2004)
Quite a controversial documentary as it
has as its basic argument the idea that Al
Qaeda, as an efficient and cohesive terrorist
group, does not exist. Instead Curtis offers the
hypothesis that the notion of this ‘organisation’
can be seen to be part of the construction of
a culture of fear which has benefited some
political groups since 9-11. The documentary
looks at the culture of the West and identifies
how its dominant values can be perceived as
threatening to other cultures and uses this
to identify why the terrorist attacks of the
turn of this century may have occurred. The
documentary also examines how the events of
9-11 were used to usher in what some see as
an erosion of human rights in the West. They
have helped place more power in the hands of
already powerful groups in the name of the ‘war
on terrorism’ via changes in the laws regarding
detention and arrest, freedom of speech and
privacy. Whilst these ideas may sound similar
to those framed within conspiracy theories
which have developed since the 9-11 attack,
Curtis does not subscribe to them but attempts
to show how recent political decisions have a
relationship to the way power and control is
generated and maintained.
The Trap (2007)Again Curtis presents a complex multilayered
analysis of consumerism’s promise to
create happiness. But in an argument that
links mathematical and scientific thinking,
psychology and economics he shows how
these ways of thinking have led to a target led
culture and one where clinical psychiatry has
been used to normalise certain attitudes and
and act in self serving ways; and that natural
human emotions such as sadness and anger or
personality traits such as introversion or certain
types of unruly behaviour have been identified
within abnormal psychology and medications
prescribed in attempts to level out emotions and
behaviour.
Adam Curtis has contributed short films
to two of Charlie Brooker’s programmes
Screenwipe (2007) and Newswipe (2009).
Both programmes focus on modern news. The
Screenwipe contribution deals with the changing
face of journalism and how news reports use
citizen journalism (http://www.youtube.com/
watch?v=O9FaIyc4vpU). In Newswipe Curtis
considers the audience’s responses to the news
and the way reports of major events have been
simplified, creating the audience response he
calls ‘oh-dearism’ (http://www.youtube.com/
watch?v=xW3XeT7qavo).
It Felt Like a Kiss (2009)Curtis’s most recent work has been his most
‘experimental’ so far. Like his other work there is
a clear hypothesis within the documentary which
focuses on the construction of the US notions of
the ‘American Dream’ in the 1950s. It deals with
US international politics and the stark realities
of life in the States where homosexuality was
seen as an illness, and beating a woman was
an acceptable part of a relationship. Again his
work is about connections; he draws together
stories which deal with Rock Hudson, Doris Day,
Lee Harvey Oswald, Lou Reed, The Beach Boys
and the first chimps in space. The documentary
brings us up to date by considering how all
these things relate to the destruction of the twin
towers and the post 9/11 culture that followed.
The film uses visual and audio montage to tell
this story, but the voiceover has been replaced
by intertitles so the audience is encouraged to
make connections for themselves. The most
unusual thing about this documentary however,
was (and is) its presentation. Currently the video
within what is probably best described as an art
installation project/theatrical event that was part
of the Manchester International Festival in July
2009. A version of the video was screened in a US
high school gym decked out like prom night and
was situated in the middle of an interactive walk
through theatrical presentation.
It is difficult to describe the experience of It
Felt Like a Kiss without giving up its secrets and
this would ruin the experience for anyone who
may be lucky to see it in its original context as it
is possible the film/installation may well be being
presented in London before too long (see Curtis’
blog for more details). Where the film itself gives
a visual/audio demonstration of the falsehood
of the ideological notion of the ‘American
Dream’, the ‘experience’ allows the participant
to experience this themselves with areas which
show the construction of the dream, from the
white picket fences of 1950s American suburbia,
through to the erosion of that dream. It allows
the audience to experience the undercurrent
of fear and paranoia in 1950s/60s culture until
the exhibitions plunges you into a nightmare...
complete with psychological torture and slasher-
movie monsters.
Curtis’s hypotheses are controversial; his
material is selected very carefully to elicit
specific responses in his audience and his work
has definite political and ideological agendas.
The audience may or may not agree with the
conclusions he draws, but his work illuminates
how history, society, politics and economics
impact on ideological positions which are often
seen as being ‘normal’ or ‘natural’. His work
intends to provoke thought and debate and as
such can be very useful for Media Students, not
least because he shows how history is not just a
collection of facts, dates and events but is, in fact,
the reason our culture is the way it is today.
6 MediaMagazine | December 2009 | english and media centre
are anesthetized in their respective beds at night,
with the consent of their heavily compensated
family and friends, to be awoken by a sensation
of actual falling, strapped in tandem as they
are to a parachute and plummeting towards
uninhabitable jungle from the plane of the
show’s generous sponsor, Air Brazilia!
Unlike the embarrassingly humane dating
shows of yesteryear, XD will allow for no such
anti-climactic ending as ‘He just wasn’t really
my type’, as the situation that the instantly
traumatised couple find themselves in forces
them to either pull together or fall apart.
What could break down the barriers between
themselves and the audience more effectively
than utter desperation? What could be more
definitive than cannibalism or more unifying
than drinking each other’s urine when the clean
water runs out? As the show’s slick tagline says,
participants will either Fall In Love And/Or Die
Trying (to escape the Amazon rainforest).
3. Last Man Standing: Nature’s Great Events
That’s right, take six tough-but-vain men
from BBC3 – perhaps winners of previous LMS
series – and pitch them against BBC1’s Nature’s
Great Events, making an Attenborough narrated
exploitation show that’s simply perfect for BBC2!
Which of the six will be trampled to death, eaten
by lions or drowned by crocodile as they attempt
to participate in the wildebeest migration
through the Mara River and across the face of
Africa? And who will withstand, from the Pacific
coast to the spawning pools of the Alaskan
foothills, the Grizzly Bears and ice-cold waters of
the North American salmon run?
Could William Robinson, aka Jujitsu specialist
Iron Will from Northampton, be amongst the last
surviving shoals of the shark, dolphin, sealion
and humpback whale attended feeding frenzy of
the south-east African sardine run? If his ego has
anything to do with it…
4. Elizabeth It’s high time our ceremonial head-of-state
threw off the Victorian shackles of privacy and
opened her life to the comforting whir of hidden
cameras. Twenty-four-hour coverage of such
a globally respected subject, edited into neat
one-hour episodes of all the most undignified
occurrences would make a fine replacement
for Channel 4’s folding Big Brother. With the
spoilt heirs to her fortune throwing tantrums,
rampant Corgis littering the Palace with this
waste, and a shaking, mumbling and eternally
confused husband as the fall guy, this could
become a highly manipulated fly-on-the-wall
representation of celebrity family life as we’ve
never seen it before. You could even call it The
Windsors and give it, say, an ironic swing version
of the national anthem as its title theme!
Just think of the spin-offs…Elizabeth: Crazy
In Love, Harry Windsor: Adrenalin Junkie,
Charles could release an album…
5. Reality TV Show Think The Apprentice but, instead of
despicable idiots vying for the attention of a
washed up business tycoon, despicable idiots
vie for the attention of a reality TV production
company executive, pitching, brainstorming,
focus-grouping, youtube-robbing, talent-
wasting and soul-selling their way to the
ultimate title of Producer, where they’ll receive
an annual wage ample for quashing those
feelings of guilt and unfulfillment at having
bent to the wills of the television establishment
and abandoned the very creativity that had
spurred them towards such a medium in the
first place.
Depressed and now a C-rate celebrity, the
winner, having provided executives with a host
of new reality TV show ideas during his or her
apprenticeship – and, of course, the show that
they themselves now produce – could even
become the subject of their own reality TV
show, revealing such a post-success comedown
and personal disillusionment with spellbinding
candidness and revelatory insight into the
industry that they have become a key player
in. Perhaps a subsequent spin-off could follow
the winner’s attempts to relinquish the format
altogether and get back to their creative roots
producing narrative drama by cutting edge
writers or prize-winning documentaries about
Britain’s celebrity-reared children and their
rejection of previous generations’ work-ethics.
The possibilities are endless!
So, if you’re interested in making REAL
television, then DROP whatever subjects you’re
studying and DROP whatever qualifications
you’re working hard to achieve, because all
you need to WORK IN TELEVISION is a good
handshake and a bad idea!
Just go to www.pleasedontgrowupto
makebadtelevision.co.uk
and let’s jump-start that career, together.
Owen Davies os a graduate in Digital Media Arts.
Are YOU a team player? Could YOU lead the way to a brighter future? Do YOU want a career in television? Then DROP those cameras, DROP those cups of tea and DROP those notions of artistic integrity and social responsibility. TAKE NOTE! Owen Davies introduces: The Top Five Best-Ever Not-Yet-Made Reality TV Shows Of All Time! FREE!
1. Star Tickling Remember in the Nineties when Dennis
Pennis asked Steve Martin why he wasn’t funny
anymore? Well, no matter. As members of the
Invasive Generation, you can go one step further.
Simply find yourself an unemployed comedian
(i.e. any comedian) or the instigator of a comedy
YouTube prank-video of 100,000 hits or more,
and assign them a camera crew as they chase
celebrities off their jogging circuits or away from
their crying children until they run out of will
power and succumb in the damp, urine-smelling
corner of some gloomy alleyway to the squealing,
writhing and hilarious indignity of being tickled
in the ribcage by a man who could, for all they
know, be trying to kill them.
2. Xtreme Dating You’ve seen Blind Date and you’ve seen Born
Survivor: Bear Grylls, well now imagine that,
instead of a couple meeting for the first time in
the florescent surroundings of the tongue-in-
cheek gameshow format and spending a sunny
weekend away together in Costa Blanca only
to discover that they don’t like the same kind
of human being, the couple in question don’t
appear in front of a live studio audience at all, but
Coming soon...
Elizabeth
Coming soon...
Last man Standing
Chandana Hall analyses the social networking phenomenon.
Since its inception in February 2004, Facebook
has become one of the most popular networking
sites in the world with 250 million current users.
Its popularity, I believe, can be ascribed to three
key factors:
• the growth and proliferation of reality based
celebrity culture in our society
• our own belief that we are ‘important’
• our increasing dependence on a range of
e-media platforms to form and develop
relationships.
CelebrityLet’s examine the cult of celebrity first.
Following the genesis of Big Brother (ten years
ago now), ours has become a society obsessed
with what ‘real’ people do in a variety of common
and constructed situations (stranded on a desert
island in Shipwrecked, at home with the kids
in Supernanny, living the American Dream in
The Hills). The result of this fascination with
the actions and behaviour of people who the
programme makers would have us believe are
just like us, has led to the popular belief that we
are all entitled to our ‘15 minutes of fame’.
In their book The Narcissism Epidemic: Living
in the Age of Entitlement, Jean M. Twenge and
W. Keith Campbell relate that: ‘ 2006 poll asked
children in Britain to name ‘the very best thing in
the world.’ The most popular answer was ‘being
a celebrity’. ‘Good looks’ and ‘being rich’ rounded
out the top three.’
They also comment that the ‘me, me, me’
ideology is further reinforced through the
consumption of similarly themed broadcast texts:
The family sitcoms of the 1980s and 90s,
like Family Ties, The Cosby Show, and Home
Improvement, have given way to shows about
single people in New York; rich, bed-hopping
teens; narcissistic doctors; and reality TV
with celebrities trying to find love with other
TV celebrities. The closest TV has gotten to
a top-ten-rated family show in the last few
years is Desperate Housewives – not exactly a
showcase of caring.
From a sociological perspective, reality shows
can be all very interesting. They allow us, the
viewers, to empathise and identify with the
participants, and also to socially interact with
our peers, inasmuch as these
texts become the subject of
discussion between members
of the audience. As a means of
entertainment, reality shows
are certainly fit for purpose: their dominance
of TV schedules and the revenue they yield for
production companies confirms this.
The cult of self-importancePerhaps the most important consequences of
reality shows is how participants have become
celebrities in their own right after the shows
have ended. This is significant, as essentially
they have carved out media roles on the back
of being ‘normal’ and ‘themselves’, without
having to display any particular talents or merit
other than a reasonable sense of humour or
a well-developed chest. Indeed for some, a
complete lack of talent has been the key to their
success- Jade Goody forged an entire career
from mispronouncing East Anglia and then not
knowing where it is.
Their fame or notoriety is further fuelled
by scores of vacuous interviews with said
participants in the tabloid press, usually
focussing on their love life, diet, and feuds with
other members of the show. This leads to the
assumption, I believe, on the part of the viewer,
that in fact everybody’s opinion (but especially
their own) is valid, interesting, and should be
given a viewing platform. This is where Facebook
comes in. It is that platform.
Digital relationshipsWith status updates, the facility to post
photos, video and audio, and the opportunity
to accumulate hundreds of ‘friends’ Facebook
fulfils our need to belong (we are part of a bigger
network), can boost our self-esteem (comments
are usually positive as they originate from people
we know), and can even allow us to represent
ourselves as our ‘ideal selves’.
The concept is strengthened by the findings
of The Sunday Times, who have reported on the
growing number of people having their holiday
photos airbrushed in order to improve their
appearance, before posting the images on sites
like Facebook. The paper reports that:
Sociologists believe the advent of social
networking sites such as Facebook and
MySpace has raised people’s expectations of
how they ought to appear in their holiday
photos... having photographs visually
enhanced [makes] them look more attractive
and their holiday more fun.’
In some respects this not really
groundbreaking news; who doesn’t want to
look good in a photo? What is surprising, rather,
are the lengths that people will go do in order
to represent their ideal selves on their pages.
This also stimulates debate as to how ‘real’ our
accounts of our lives are on social networking
sites. Facebook allows us to subject every facet
of our lives to mediation before scrutiny by
others – as mentioned, we have the ability to
select and edit images before we post them. We
also have the power to make our lives sound
more interesting/enjoyable/successful than
they actually are, again fulfilling our need for
the approbation of others and increasing our
status. The gap between reality and subjective
representation is therefore ever widening- the
potency and appeal of Facebook is in its ability
to accommodate our desire to rewrite and revise
what happens in real life, in order to bring our
experiences closer to what would occur in our
version of an ideal world.
It also reinforces our belief that we are
important and that people will be fascinated
by what we have to say, which leads to status
updates that generally lean towards inanity (a
random sample taken from my husband’s page
include ‘I’m hungover and off to work’, ‘Just had a
lovely walk’ and ‘Really tired and going to bed’).
I’m sorry, but even if you’re my best friend, I’m
still not that interested in what you had for your
tea. This is why ellipses are so essential to the
narratives of novels and films – to engage and
maintain the interest of their readers/audience
there is no need to detail the minutiae of the
characters’ everyday lives – the assumption that
the characters are eating, sleeping and having
a shower somewhere off the page or off-screen
is enough. So why this obsessive need to record
our every action and thought through Twitter or
Facebook?
Possibly the key to explaining the true
success of Facebook et al is that they are
e-media phenomena that can fill a logistical
and psychological gap. As our society becomes
ever more swayed by a series of moral panics
(too dangerous or poor to go out because of
terrorism/swine flu/paedophiles/the credit
crunch), and lives become too busy to engage in
quality ‘face time’ with our friends, so Facebook
becomes the ideal platform for staying in touch
with others. However, if its intellectual stimulation
and thought provoking discussion you’re after,
even the Jeremy Kyle Show might be a better bet.
Chandana Hall is a media teacher in Hull.
Me, Me, Me Why Weʼre All Celebrities Now
8 MediaMagazine | December 2009 | english and media centre
David Bell introduces the strange virtual world of simulcra.
With this month’s Reality issue comes the
opportunity to explore new territory, in the
same way that the technological developments
altering our experience of reality are allowing
us to inhabit alternative spaces, places, physical
and metaphysical worlds. I thought that there
was no better way to do this than to look closely
at the notion of Hyper-reality – we live it, we
breathe it, and we exist within it, one way or
another. So, in an attempt to explain what it is,
why it’s important, and where it will take us next,
I present you with an area of Media Studies that
forms part of one of the set topics for the new
AQA specification this year – The Impact of
Digital and New Media – something for all A2
students to get their teeth into.
What? Jean Baudrillard, a cultural theorist known
for his work on postmodernism and post-
structuralism, said that hyper-reality is ‘The
simulation of something which never really
existed’. This ‘something’ he refers to as a
simulacrum or many simualcra.
In one sense, a simulacrum is something that
has been created out of nothing. In another
sense, it is a recipe of many different things:
blend a hearty portion of physical reality with a
pinch of virtual reality and artificial intelligence;
garnish with human intelligence, and serve
hot in a technological vessel. The technological
revolution of the late 20th and early 21st Century
has enabled this blend of elements to mutate, or
to use a less biologically-centred and more media
savvy term, to converge. It is important in Media
Studies that we consider how this could impact
on our lives in the digital era.
Italian Semiotician Umberto Eco once called
hyper-reality (oxymoronically) ‘the authentic fake’
– a type of reality but one that acts as a surrogate,
a replacement that means that many of our
experiences are becoming pseudo-experiences
characterised by the absence of the ‘real thing’.
Let’s see if we can clarify these definitions with
references to some well known examples.
Firstly, to put to you a potentially mundane but
straightforward question: when was the last time
you used a map? Not a Googlemap or
other online street map, but a physical,
tea-stained, roughed up at the edges
paper document? My guess is that
you probably haven’t since late 2004
or early 2005, when the first TomTom
Global Positioning System (GPS) became
available on the mass market. Satellite navigation
took hyper-reality to a whole new level in the
way that we could use a simulation of a close-up
of our own planet to navigate our way through
physical reality. If we think of hyper-reality as a
simulation, and a simulation as an imitation of
a real thing, then we could argue that the maps
we’ve been using since civilised man began
tracking the landscape are also examples of
hyper reality – and indeed they are. But – and
this is a big but – hyper-reality is an evolving
phenomenon, and what it does for us today is
bring things to life. In the 21st century, hyper-
reality ‘animates’.
Secondly, to return to hyper-reality as
something that describes the way in which we
are cut off from reality, take celebrity culture as
an example of a hyper-real world. Celebrities no
longer live the lives they may have once lived as
a child, pre-fame, and therefore find themselves
out of touch with normality. They are trapped in
a world where everything is done for them and
at the same time, exposes their every waking
moment to the public. Technology of course,
plays its part. The media we consume exposes
celebrities; their lives are simulacra of ‘normal’
living. The technological representation of their
existence is therefore hyper-real.
Hyper-reality, then, is problematic in the
sense that its meanings are by no means limited
to one of the key elements mentioned earlier.
It is ever-evolving. Furthermore, a common
theme emerges when we clarify its meaning
and purpose in more depth: falsity. Yet hyper-
reality is at the same time feasible, credible and
significant. We are all attached to it, like nodes
– or end communication points – connected to
a systematic web of finite possibilities. In short,
increasing interconnectivity means that we
cannot ignore hyper-reality, and as a key area of
Media Studies.
Significance? In Capitalist cultures, many of the experiences
we’d like to indulge in are in fact further from
our grasp than Pluto is from the Sun. How
inviting then, that Cyberspace – the virtual world
of technological communications that exists
without the need for geographical references and
lies within hyper-reality – offers us an ‘as-near-
as-we’re-going-to-get’ option to be able to, say,
walk on the moon, fly an X-43 aircraft at 110,000
feet, or shake hands with an Aztec Warrior
having just defeated the Spaniards on July 1st,
1520 – the closest we’ve come to time travel. As
Donna Harraway (1991) argues, the freedom
of Cyberspace is the freedom to construct
new experiences and identities without being
restricted by our physical reality.
Similarly, Marshall McLuhan, in
Understanding Media (1964) talked about
technology as ‘extensions of mankind’ that
modify the body and hence change reality –
that of the individual and that of the culture
in which the individual grows and develops.
Since McLuhan’s pioneering work in the sixties,
technology has not only extended mankind, but
has redefined what it means to exist in reality.
This transcendental shift could also be termed
hyper-real in that we can experience a form of
non-reality within the real world.
Why is this important? We are now
approaching a stage where a ‘get involved or get
left behind’ attitude is becoming the norm. In
other words, embrace the hyper-real world or risk
the possibility of becoming evermore remote. To
reject any involvement in the hyper-real world
in the 21st Century would be nothing less than
virtual suicide.
Creating a ‘hyper-world’ In as far as many technological theorists have
attempted to define hyper-reality, it still remains
a subject with close connections to Media Studies
that is difficult to conceptualise. It is already
evident, particularly with the development of
interactive technologies, that we are becoming
more and more involved in the hyper-real
world than the real world itself. Hyper-reality
represents a reality shift where a ‘hyper-world’ is
now available for us to enjoy new experiences,
to experiment with alternative ways of living.
As futurist Richard Buckminster once said,
until the 20th century, reality was everything
humans could touch, smell, see and hear. The
electromagnetic spectrum proved that this
amounted to less than one millionth of reality. In
the 21st century, the hyper-real world will force
us to rethink Buckminster’s assertions once again.
David Bell teaches English and Media Studies at Morley High
School in Leeds.
ntre
Hyper-r�ality….A Rough Guide
english and media centre | December 2009 | MediaMagazine 9
Jean Rouch: the Father of Cinéma Vérité
A discussion on issues of realism, reality
and documentary is not complete without a
footnote to the legacy of Jean Rouch: visual
anthropologist and documentary filmmaker.
In the 1950s Jean Rouch embarked on a
journey to study and film the lives of the Songhay
people of West Africa; it was a journey that would
have a profound effect not only on the people
he was filming, but also: visual anthropology,
documentary filmmaking, the French New Wave,
and the future Reality TV.
Very little acknowledgement is given to this
charismatic French man, indeed across the course
of my entire Film Studies degree as a student, his
name was never mentioned! However any Film
Studies course that includes Documentary or
the French New Wave (WJEC A2 Film Studies
specification) should make room for such an
important figure; the father of Cinéma vérité and
adopted son of West African cinema.
As a documentary style Cinéma vérité is often
confused with Direct Cinema, which came to
prominence around the same time in America
through the work of Richard Leacock. This
latter movement’s style concerned itself with
immersion in a situation with the filmmakers
going ‘unnoticed’; a movement that has,
broadly speaking, evolved into ‘fly-on-the-wall’
documentaries. Rouch contested the very notion
that filmmakers could go ‘unnoticed’, instead he
considered the filmmaker (he always used the
term ‘filmmaker’ not ‘director’) as the catalyst in
a filmed situation, the agent provocateur. Rouch
talked about the camera as a tool to record
selves when being filmed.
Cinéma vérité was a new
language of documentary
cinema created through the
advancements of portable
equipment, most importantly
sync sound and (relatively)
lightweight cameras. Rouch
has often been credited with
inventing sync sound (this
is a debateable claim but
he certainly pioneered it’s
use and possibilities). These
technological advancements
allowed Rouch the freedom to
spend time with the people
he was filming without the
presence of a large film
crew. This style of filmmaking
directly influenced the work of French New Wave
directors in particular Jean Luc Godard.
Chronique d’un été (1960)Although the bulk of Rouch’s work was
filmed in West Africa where he lived and worked
for much of his life as an anthropologist and
filmmaker, in 1960 Rouch teamed up with
sociologist Edgar Morin to make Chronique
d’un été (Chronicle of a Summer). Set in Paris the
film pioneered the use of the
camera to document public
opinion, in much the same
way film and media students
hit their local town centers to
document the word-on-the-
street, still to this day! The
participants in Chronique
d’un été were able to speak
candidly and truthfully
through the presence of
the camera; cinematic
truth in action! Rouch is
present in many scenes
involved in philosophical
debate, acting as the agent
provocateur. Chronique d’un
été was an innovative and
influential Cinema Verite film,
pioneering the many forms
of reality TV we have since
become accustomed to.
Rouch’s later films took
on an interesting development by playing with
the notion of the ‘real’; in Jaguar (1967) Rouch
used non-actors and set them an agenda to act
out. This hybrid form of documentary has been
termed ‘docudrama’ or ‘ethnofiction’. What makes
this form even more remarkable is that Rouch
shows the viewer the set-up; that it’s ‘just’ acting,
in turn rendering the work highly self-reflective.
By acknowledging that ‘this is a film’, the sense
of audience investment is heightened; these
are real people improvising and acting for the
camera. This self-reflective style was also used
by the French New Wave directors, Godard in
particular. By giving his ‘actors’ the choice of
how to be represented Rouch is giving them an
unprecedented amount of agency. It is known
that Rouch often screened his films (often in the
African villages in which he filmed) to receive
feedback, thus giving the people in his films a
chance to communicate if they were happy with
the way they had been represented. Rouch recalls
the moment he screened his early film Chasse
à l’hippopotame (1950) to the village chief and
how the chief had pointed out to him that the
music Rouch had edited into the film would scare
the hippopotamus away! Rouch took on the
feedback and rarely used music again in his films.
Rouch’s career was industrious both behind
the moving camera (102 films over a 60 year
career), behind a still camera (in 1998 he donated
20,000 photographs from his work in Africa to
the Musée de l’Homme), and away from the lens.
Rouch was also heavily involved in championing
communication between anthropologists, visual
ethnologists and documentary filmmakers;
establishing many film festivals, workshops
and cineclubs over the years to support such
filmmaking.
Much can be learned from Jean Rouch through
the films he produced, his championing of
African culture, and enthusiasm for the visual
medium we all study/teach and love. Budding
documentary filmmakers can learn from Rouch
the importance of establishing good relationships
with their subjects; Rouch was an anthropologist
and spent an unprecedented amount of time
within communities while filming. However from
Rouch we can learn to understand and respect
our subjects before representing them to an
audience.
Jean Rouch tragically died in 2004 in a car
accident in Niger. Shockingly not one of his films
is available in the UK.
Kevin Dunk teaches Film and Media at The Ravensbourne
School in Bromley.
is a film, the
heightened; thes
g and acting for th
e style was also use
e directors, Godard i
actors’ the choice of
ouch is giving them
d itself with
filmmakers
at has,
y-on-the-wall’
he very notion
ed’, instead he
ays used the
he catalyst in
ocateur. Rouch
By
of
a
p
ho
g,
e.
n
a
w
R
o
a
ac
is
g
dience investme
real people improvi
mera. This self-reflec
the French New Wa
ticular. By giving hi
to be represented
o an nting them
n 2004 in a car
ot one of his film
s w
earn to
efore repre
ragicall
er. Shoc
he UK.
subject
ience.
ean Rou
dent in
vailable
spent
hin com
h
o
a
Kevin Dunk teaches Film and Media at The Ravensbourn
Godard’s Breathless (1960)
Jean Rouch on the set of Jaguar (1967)
10 MediaMagazine | December 2009 | english and media centre110 di gaazinzi eMediaMaggaazinzi e | Dec ber 0909 |cemmber 200 | english and media centreenglish and media centre
As the doors close on the Big Brother house for he final time, Stephen Hill catches up with Marcus Bentley, the voice of Big Brother to find out about his views on reality television, the future of the show and to get some insider info on being a voice over artist.
MM Hi Marcus, thanks for agreeing to be
interviewed for MediaMagazine – can you tell us
a bit about what you watched on TV when you
were a teenager?
MB I was very frustrated with the lack of
access to kids programmes. In the 70’s and
80’s kids programmes in the school holidays
finished at midday and on week nights ran
from four until six and were boring. Blue
Peter is awful and God knows why it is still
here. Jackannory – terrible! ‘Why Don’t You’
pretentious crap, with only the cartoons and
great British animation such as Rhubarb +
Custard, The Clangers and The Wombles as
a saving grace. Kids’ programmes today are
brilliant. Broadcasters care these days! And
as for teenager programmes, Grange Hill was
great! Tucker is a legend!
MM What about your career before you
started working for Big Brother – could you tell
us a bit about that?
MB I’m an actor I left drama school in 1992
went straight into theatre, where I worked
solidly for about three years. Then for about two
years I seemed to star in about 10 TV adverts. At
one point I was the face of MacLean’s Tootpaste,
BT and Blockbuster! I even had a small role in an
Elizabeth Hurley movie, which was a big flop!
Then all of a sudden from being very busy I had
no good acting work for two years, which was
very frustrating. Then I started doing voiceovers
and got Big Brother.
MM What do you think it is about your voice
that makes it perfect for voiceover?
MB I’d like to think it was perfect! But I think
I’ve developed a style that is unique. There is
an argument that a voice shouldn’t be noticed
just understood, but I didn’t want to be boring. I
wanted to be noticed! I’m a punk at heart!
MM Do people recognise your voice when
you’re out and about?
MB Yes I live in the South East so I don’t blend
in so well. If I get talking in a shop say I usually
get asked and I always get a pleasant response!
MM You’re the narrative voice of Big Brother
but who writes the script? Can you tell us a bit
about the process?
MB The script is written by the Big Brother
producers, in a certain style, which has been
developed over the years and it is dictated by
the ‘Houser-action’. It is then ‘tweaked’ by me!
MediaMag meets….
Marcus Bentley Voice of Big Brother
english and media centre | December 2009 | MediaMagazine 11
memorable voice!
MB Yes. Sometimes they like me to say
irreverent things to shock… ‘booze’, ‘boobs’ and
this year I even used the ‘F’ word !
MM You’ve only appeared in front of the
camera once on Big Brother – why do you
choose to keep such a low profile?
MB I have appeared on Little Brother about
five times over the years… but I want to
return to TV drama one day and not be facially
recognised!
MM Do your kids enjoy hearing you on Big
Brother?
MB My Kids have grown up with Big Brother
and get a big thrill in hearing their dad’s voice
coming out of the T.V. They also get a bit of
attention at school…which they think is ‘cool!
MM Big Brother is referred to as ‘reality
television’ but of course it’s also ‘created’ – how
‘real’ do you feel Big Brotheris?
MB Big Brother is unique and should be in its
own bracket. There is only one Big Brother. It is
not another talent show it’s about real people,
however outlandish and how they interact
with each other and their surroundings. And
because the producers put together the right
combination it usually is highly entertaining!
MM What do you think are the essential
ingredients for a good episode of Big Brother?
MB Put into the House individuals from
whatever walk of life then see what happens!
MB The show is fundamentally about the
housemates and as long as they get that
right…each series is only as good as who
they put in! Big Brother 10 was probably the
best yet – Noireen the love siren, Siarvash the
fashionista, Marcus The Ego, Freddy the weird
posh bloke, Bea ‘The Bxxxx’. David + Lisa almost
a straight gay couple, Shree from India and very
different… Sophie the girl next door page three
girl etc etc etc.
MM What’s been the most difficult time for
you on the show?
MB I always have a ball!
MM Do you think people will look back in
twenty years time and view Big Brother with the
same affection they have for Coronation Street
or EastEnders?
MB If these soaps can last for decades so can
Big Brother… until people get tired of watching
people and hearing their stories!
MM Which housemate(s) made the best Big
Brother ‘character’ and why?
MB The list is enless…but I loved Brian
Dowling for his humour, Jade Goody for being
‘Jade’, Nadia for being a woman, Siavash for
being an individual and Bea for being horrible.
MM What is the future of reality television? Is
there a future?
MB Big Brother is expected to be taken onto
another Channel from 2011. There’s plenty
of life in the show as Big Brother 10 has just
MM What are you career plans for the future
– any ambitions you’ve yet to fulfil?
MB I’m going to get back into acting over the
next 3 years and do some good stuff!
MM How did you feel about the way in which
the media covered the death of Jade Goody?
MB The media are unpredictable at times.
Who would have thought Jade’s Big Brother
story was so interesting but it was and not
because the media told us that it was, people
wanted to know all about her and fed her every
success and failure. God Bless Jade!
MM How do you feel about Middlesborough
leaving the Premier League?
MB Gutted! But ever since we got to the
UEFFA Cup Final the club have shown an
appalling lack of ambition!
MM Any tips for the media students out there
who would like to get into voiceover work?
MB I’m thinking of putting together a course,
passing on my tips and helping with demos etc.
Watch this space!
MM And for media teachers – any tips for
when we lose our voice?
MB Never raise your voice and stress your
vocal cords! I once cheered Middlesbrough
on at a play-off match and couldn’t sing at an
audition the next day!
Stephen Hill
12 MediaMagazine | December 2009 | english and media centre
In this article Bev Fenner explores the relationship between 18th-century philosophy, government policy, reality television and new media.
Is Britain becoming a surveillance society?
In recent years there has been a growing
debate about whether or not the United
Kingdom is becoming a surveillance
society. Closed Circuit Television was first
introduced in the UK in the ’70s and ’80s after
initially being developed for use in banks.
Bournemouth was the first town to introduce
outdoor CCTV in 1985, leading to trials in
many town and city centres throughout the
country. A home office report in 1994 deeming
the trials to have been successful lead to the
proliferation of CCTV in the UK. Since then the
number of cameras in this country has grown
to an estimated 4.2 million, confirming the
Information Commissioner Richard Thomas’
fear that Britain would ‘sleepwalk into a
surveillance society’.
Big Brother is watching youAlarmingly CCTV is now less of a tool
for crime prevention – with only one crime
being solved per thousand cameras – and
has instead become emblematic of the wider
trend of increasingly pervasive security and
surveillance measures post 9/11; culminating
in the controversial shooting of suspected
terrorist Jean Charles de Menezes in July
2005 and the Identity Cards Act the following
year. It therefore seems ironic that concurrent
with these rapid changes in public security
policy that has placed public life under the
scrutiny of private eyes, there has been a
boom in Reality television; a phenomenon
that puts individuals’ private lives in the
public eye. Likewise, whilst the culture of
surveillance has arguably promoted a climate
of paranoia and the Orwellian fear that Big
Brother is watching our every move, this has
also coincided with new media technologies
which are propagating increasingly open,
unguarded and communal attitudes to private
life. Is the danger then, that such openness
exposes us to the risk of being snooped upon?
The recent increase in cases of identity theft
and the trend for ‘data mining’; the use of
data extracted from ‘private’ sources such as
credit card accounts and social networking
sites such as MySpace, Facebook and Bebo,
for marketing, surveillance or fraud, seem
to suggest that this is indeed the case.
Recently, Facebook has come under scrutiny
for not deleting the profiles of those who
had deactivated their accounts. Likewise,
in January 2008, over 567,000 private
photographs were downloaded from MySpace
by using a bug available on the Internet.
Utilitarianism and the MediaMany forms of surveillance are justified
under the political ideology of social
utilitarianism. The 18th-Century philosopher
Jeremy Bentham is attributed to the devising
the principles of social utilitarianism. In his
doctrine on legal jurisdiction The Principles
of Morals and Legislation (1786), Bentham
introduces the concept of social utility: a
measure of the overall happiness of a society.
The utility principle is expressed as ‘the
greatest happiness of the greatest number’;
a phase Bentham borrowed from theologian
Joseph Priestly’s First Principles of Government
(1768). At a most basic level, it is possible
to see Bentham’s concept of utilitarianism
as the premise on which broadcast media is
based. For example, the Royal Charter, which
governs the role of the BBC as a public service
broadcaster stipulates that the corporation
must sustain citizenship, promote education
and learning, stimulate creativity and cultural
excellence. In effect, the remit of the BBC is
to bring the greatest good to the greatest
number. Likewise, Bentham’s original concept
of utilitarianism also has much in common
with the principles of the Conservative
Party under Margaret Thatcher in the
1980s a time when surveillance was
still in its infancy.
Public Sector ReformDuring the 1980s the Conservative
government in the UK embraced a series
of reforms to the public sector
that reflected the rise of
electoral engagement
with the role of the
individual as consumer
as opposed to
producer. As a feature
of the generalisable
proliferation of post-
modern culture, the decline of heavy industry
and domination of society by information
technology, Tory reforms pertained to be at
the vanguard of social utilitarianism. Indeed,
central to Margaret Thatcher’s policy of
governance was financial expedience in the
public sector. By appropriating the principals
of free-market capitalism Thatcher’s reforms
encouraged the electorate to engage as
consumers of public sector services. This was
a time during which forms of governance
and social monitoring became increasingly
transparent. Public sector services adopted
consumer models of quality assurance
including audits, opinion poles and the
national curriculum and OFSTED in schools.
Other examples of utilarian reforms which
supposedly catered for both public and
private interests include the publication
of school league tables, the privatisation
of nationalised transport systems and the
sub-contraction of auxiliary services in the
NHS. The short-term effect of this was that
the Conservative government was able to
lower taxes creating considerable ‘happiness’
for middle-income earners. The long-term
corollary, however, was that public sector
services suffered not only from chronic under
investment but that the selfish interests
of consumers undermined the premise
of egalitarianism in the provision of state
services.
Theories of surveillanceIt is perhaps no coincidence then, that
Bentham is not only seen as the founder of
modern conservitism but is also attributed
with the invention of surveillance. Key to
this is Bentham’s panopticon: a
re-design of the prison
building
mucmucmuccm h ih ihh n cn ccommommmmommmon onon on
e e e ConConConnserserse vatvatvatvativeiveivee
aatchtchtchcc er erer ee in in n thethethethth
iillallallaaancencencecce wa wawwas s s
eformConCConnserseserrvatvatvativeiveive
mbmbmbracracceded ed ed a sa sa serierieries es es
sesesectoctocc r r r
thithithith s is is iis Bs Bs Bs BBentententententtnn hamhamhamhamhamhamm’s ’s ’ss panpanpannoptoptoptticoicoicoicon: n: a a aa
re-re-e-e-e desdesdesdesignignigngnn ofofof off tht thhe pe prisrisrison on
buibuibuib ildildildiing ngng
Surveillance Society
Utilitarianism and the Media
english and media centre | December 2009 | MediaMagazine 13
with the primary aim of improving its cost
and efficiency. The design consisted of a
circular building allowing for a single layer
of tiered prison cells built around a central
tower from which a single observer could
view all of the cells. The cells were to be
backlit and the central void surrounding the
tower unlit so that observer could remain
hidden whilst those in the cells would be
constantly visible. The observation room
would be darkened and it’s windows obscured
to disguise its occupant. The main function
of the design was to reduce the number of
employed guards by handing the task over
to the prisoners themselves. The anonymity
of those guarding, effectively meant that the
prisoners could guard themselves, whilst the
impossibility of telling whether or not the
tower was occupied eliminated the need for
continuous observation. This situation would
also serve to induce discipline in the form
of self-surveillance in which the observed
would internalise the gaze of the observer.
It is this notion of self-observation – the
watched doing the watching – that inspired
French theorist Michel Foucault’s notion of
the panopticon gaze. Foucault argues that
as with the panopticon, discipline and the
mechanisms of power and social control are
embedded within institutions like schools,
hospitals, and factories and, on a generalised
level, within public consciousness. He
suggests that the disciplinary model of power
has ‘infiltrated’ other forms ‘serving as an
intermediary between them, linking them
all together, extending them and above
all making it possible to bring the effects
of power to the most minute and distant
elements’ (Foucault, 1977). Here is the idea
that discipline is so embedded at every level
of society that we have all become compliant
with and complicit in the power systems and
happy to sing from the same song sheet, so
to speak. Key to the complicity of individuals
is their internalisation of the ‘apparatus’ of
power: We can argue that our reliance on
knowledge systems of institutions of power
(including the media) or what sociologist
Anthony Giddens (1990) refers to as ‘expert
systems’, the self-reflexivity (self-scrutinising)
that enables us to express who we think we
are, and the self-consciousness required in
observing social norms and conventions
in what Goffman (1959) calls ‘front-stage’
performances, – those for the benefit of others
– are all internalised forms of external power.
You are watching Big BrotherTaking these ideas into account, their seems
to be a strong theoretical argument for the
relationship between the performance of
social transparency – from online feedback
forums for media organisations to restaurants
with ‘theatre’ kitchens, to the unguarded
openess of reality television – and the notion
of a surveillance society. The very notion of
Big Brother has its origins in George Orwell’s
dystopian vision of the future in Nineteen
Eighty Four (1948): CCTV in this instance
predicted by the two-way telescreen. And,
indeed, the popularisation of this concept in
the reality television programme Big Brother
(Channel 4) offers an ironic commentary on
this ugly aspect of contemporary society.
Its stars are able to subvert the subjecting
function of surveillance by objectifying
themselves for the cameras. Most recently,
however, it is the proliferation of social
networking sites that have lured us into a
more intimate panopotican in which our
correspondences are haunted by a vague
feeling of paranoia that MySpace is fast
becoming ‘their’ space! In theory, these sites
serve the very utilitarian function of allowing
us to communicate more effectively with
loved ones and friends. Increasingly, however,
the awareness that other people are sifting
though our photos and ‘status updates’
induces a self-conscious panoptican gaze
of its own. As the ubiquitous mobile phone
camera is testimony: in the 21st Century,
increasingly our social existence is but a prop
to support the version of our life we project
into cyberspace. Conversely, we can argue
that seeing and being seen has always been
a primary focus of youth culture. As Dick
Hebdige (1988) suggests subculture ‘forms
up the space between surveillance and the
invasion of surveillance, it translates the fact
of being under scrutiny into the pleasure of
being watched. It is hiding in the light’.
Future fears However, as our private lives become
increasingly open, are we blurring the
distinction between public and private to
the point where we are in danger of loosing
a fundamental human right; the right to
privacy? Indeed, the primary opposition for
the introduction of National Identity Cards in
2005 came from Parliament’s Joint Committee
for Human Rights whose main argument
against the scheme was that it contravened
Article 8 of the European Convention on
Human Rights: the right to respect for one’s
‘private and family life, his home and his
correspondence’. In August 2006 an article
in The Observer, Gaby Hinsliff highlighted a
relationship between National ID cards and a
wider project which would ‘widen surveillance
of everyday life by allowing high-street
businesses to share confidential information
with police databases’. By integrating the
biometric technologies developed for the
National Identity Cards scheme with consumer
technologies like store loyalty cards and cash
machines, police would then be able to track
the everyday activities of criminals, suspected
terrorists and others that they wish to monitor
by instantly identifying them from ‘unique
markers such as fingerprints and iris patterns’.
This sounds like the stuff of science fiction
but unless it is opposed will become science
fact. More recently, a report by The House of
Lords Constitution Committee argues that
as mass surveillance far from upholding
utilitarian democratic principles, negates
them by eroding privacy; undermining
‘the constitutional foundations on which
democracy and good governance have
traditionally been based in this country.’ If the
right to privacy is denied, then not only will
this confirm the Information Commissioner’s
suspicion that Britain has become a
surveillance society but also give prophetic
credence to Orwell’s vision, by paving the way
for a totalitarian police state.
Bevis Fenner
lli hi hi hh ddd dididd ttttt | D bb 2009 | Medied aMaMagazinazine 13131313133
atiatationsonsonnsnsshiphiphiphiphhiipp be be bebeetwetwetwetwetwetttween en en en en en thethethethethehe pe pepe pepepeepepp rforforforforforforformarmarmammamarmarmmancencencecencen e ofofofofofofofoff
ccialialiaialiala tr tr trtransansansansnsparparparparencencenene y –y –yy –y –– fr fr fr from om omomm onlonllonlonlonono ineinenninn fe feffefeedbdbedbedbedbedbdbedbedbedbdbdd acacacackackackacackaa
umsumsmsums fo fofofofoor mr mr mr mr mediediedededd a oa oa rgargaag nisnisisnnn atiatiatiatiationsoonsonsnsonsonsonsonsonsononso t to tot to rere rer stastastaaaaaurauuraraurauraurau ntsntsntsntsntsntssn sntn
h ‘h ‘h ‘h ‘h ‘thethetheh atratre’ e’ e’ kitkitk checheeeeeeensnsnsns,ns,sns,sns,ns,ns,ns t to tottooo th ththht e ue uue ue uuungungngungungungunng ardardrded ed
eeenesnesnesss os os oof rf rrf rf rf rrf rf rf rf rrealealeaealealeaealealealaeale le ityityityitytyitity tete tetetelevlevlevlevlevevvvevisiisisisiisiisiisision on o – a– aaand nd ndd thethethhh no notiotiotiotiottioonnn nn
aaa saa sa sa sa sa sa sa saaa urvurvurvurvurvvveileieileileileeileileie lanlanlananllalalalalllalal ceceee e eeceee ee socsocsocsocietietiiety. y. y.yyyy TheThehTheThe ve vevv ry ryyry ry yy nonotnotnonotnononono ionionioioionionioniooio of ofofoffoofffff
Brother hhhashashhhhhashah s it itittttttttts os os os os s s oooooorigrigrigrigrigriggginsinsinsinsnsinsinsins in inin ininin in ininnn ininn Ge Ge GeGe Ge Ge GeGeeGeGeGeGeGeeGG oorgorgorgorgorgororgorgrggo ggee Oe Oe Oe Oe Oe Oe Oe OOOrwerwewwwell’ll’ll s s s
sssssstoptoptopopopoptopoptt ianiananianianiaia vivivi vivivi vivivivviissssisioiosissisisiiosisiss n on ooooon of tf tf tf tf tf ttf he hehe he hehehehe hee futfutufututututfutututuuuurureureuuur in in NinNi eteeen en
htyht Four (1(1(1(1(1(1(1(1(1(1(1(19948948994899999948999 8))):: :: )):)::: :: : CCTCCTCCTCCCTCCTCCCTCCTCCTCCTC V iVV iV iV iV iV iV iV iV iVV iV iiiV iV in tn tn tn tnnnnn thishishishississs in in ini inin inininininstastastastastaststaststastastaataaancencencencen enncenncee r
eeedicdicdicdididiiiicccddidiiciiccciccicdictttetedteddtetedttedeedt by bybyby by byyyyy ttthhtht t tttht t e te te te te wwwo-wo-wo-wo-wwo-wo-owowo-w waywaywaywaywayywaywaywayaya te tett te te telesleleslescrecrecrereen.en.en.en. An AnAA d, d, dd,
eedeedeededeedd, t, t, t, t, thehe he hhe hh popopopoooopopopopp ulaulalaaaaau arrrisrisrisrrisrisrrr atiatiatiatiat on on ooon on ooon of of ofoo thithithithis cs cs cs cs conconconconceptepteptep in in in
ee re reerereealialialialilial ty ty ty ty yy teltelteltellelellelelellee evevievievievisiosiooooosisiooosion pn pn pn pnnn progrogrogogooo ramramrammamra me memme Bigg Br Brothother r
annannnnnaa elel el l 4)4)4)4) 4) 4)4) 4) 4) 4) )44) offoffoffoofferseersersersssssssss an a a ananan ir ir irirroniooooniooniono c cc cc ccommommommommo mmmmentenenentententententententne teee aryaryaryaryry on on on onono
s us uuuuus us us us uus uuuglyglyglyglyglyglylyglyglyglyyglyglyg asas aspecpecpecpecpect tt t t oo ot o oot t oof cff cf ccontontontoonontempemempempempempempmpempempempmm ooorooraoraorary ry ryy socsocsocsocietieteietiety. y. y. yy
stststttttttsstttaararsarsaaraaaaraaraaaaa ar arare ae ae aae aaaaaablebleblebleblebleblebleblebleblelbb tototototototo toto to to su susuubvebvebveb rt rt thethehethe su su suus bjebjebjectictictictictic ng ng ng ng nggn
nnnctictictitictiction onon nnooon of of of ofofoffffoff sursursurveiveive llallancencencen by by bby ob oboobjecjecjectiftifttiffyinyinyinyi g g g g
eeemsemsemsmseselvelvelves fs fs or or or or thethehe ca caamermermerm as.as.as. Mo Mo MoMosst st st recrecrecrecentententententtly,ly,ly,ly,lyy
wwweveeveevev r, r, it it t is is is thetheththe pr prpprolioliferferferfere atiatiatiatiation oon oo of of socsocsocsocss ialialial wwweveeveevevever,r,r, itititi isiss thethethe prprp oliolil ferferferf atiatiationonno ofofoff socsocococialialiallial
tttworworworwwo kinkinkinking sg sg ssg siteiteiteites ts ts ts ts hathathathattt ha haha ve ve vee lurlurlurlurlured ed ededdede us us ss intintintintnto ao ao aa
rrre ie ie iintintintintimatmatmamatate pe pe pe anoanoanononopotpotpototpop icaicacacai n in in iin wn wn wn wwhichichichicich oh oh our ur urr r
resresresresrr ponponnponp dendendenndencescescess ar ara a e he hhhhaunaunaunaununauntedtedtedtedtedtede by by by by by bb a a a a vagvagvaggggggue ue ueueu
linlinlinnlii g og og og of pf ppf pf paraaraaraaraararanoinoinoinoia ta ta ta thathatatatthatat My MyMy MyyySpaSpapaSpaS ce ce ce ce is is is fasfasfasaa t t tt
ccccccomiomiomiomiomommm ng ng ngg gggg ‘th‘th‘th‘th‘theireireireirei ’ s’ s’ sspacpacaaace! e! e! e!e! !e! In In InInII thethethethehtt oryoryryryoryr , t, tttheshesheshesh e se se se siteiteitetetet s s s ssss
ve ve ve thethetheheheh ve ve veveeeevery ry ry ry ry utiutiututiuuu litlittti ariariariariariiarir an an an anan aa funfunfufunfuufuf ctictictt on on ono of of offf allallalllallll owiowiowiowiow ng ngng nn
to to to oo comcomcomcomoooo mumunmunmununmunmunnmmmmm icaicaicaicate te te e te e mormormormorormorore ee ee ee effeffefefeff ctictictcctc vevelvelvelvely wy wy wwy wy wy withithithhthtith
ed ed ed ded d oneoneonenenonennes as a aas and nd nd nd nd nn frifrifrifrif iendendendendenden s. s. s. s. s.s. IncIncIncIncI rearreaare sinsinsinisinisinglyglyglyglyg yg , h, h, hh, , oweoweoweoweowooo eeverververvevervv , , ,
eeeee aw awaw aw aw aw aw awareareareeareaaaaa nesnesnesnesnessess ts ts ts ts ts thathahahathah ot ototottherherhehherherher pe pepepepeeoploploploplplo e ae ae aee ae aae aare re re rere reee sifsifsifsifsifsifssi tintintintiniing g gg
oooooooughughughughghugugugu ou ou ouu ouour pr pr pr pr pr pr pphothothothothohothhhhh os os osos ss andandandanddandanddd ‘s‘s ‘s‘s tattattattatt us us us ussu updupdupdupdupdupdddpdupdpdateateateateatetes’ s’ ss’ ss
uceuceuceuceucu es as as as aaas aa se se sese sesess lf-lf-lf-lf-lf--f concoconconconcconsciscisciscisciciousousousousousouss pa pap papaanopnopnopnonopticticticticticcict an an an aaan gazgazgazgaggg e e e e
tstststststts ow ow owow owowwn. n. n.n. n. nn. As As AsAAsAAs A thethehthethethet ub ububububiquiquiququiquuquq itoitoitoitoitoitoous us us usus uss us mobmobmomobmobmobmobmomoo ileileileileililile ph ph phoneoneneneone
mmmmmmmmmmmeraeraeeraeraeraere isisisis is is tete te te tetestististiististimonmomonmony: y: y: y in in in ininin in ththethethethetthet 21 21212121 21st st stst CenCenCenenturturturrury, y, y,y, y
reareareareareareasinsinsinnnsinsinsini glyglyglyg yg yg ou ouououu ouour sr sr sr r ssssr ociciociciocicocialalal aalal al a exiexiexieexixieexistestestestestest ncencencencenceee isis is is isi bu bu bu bu but at at at at aa pr pr prprprprprop opop op popoo
supsupupupsupsupsupus pppporporoporporpo t tt tt tt tt tthe he he hee verververererrrerv siosiosiosiosiosioon n on oon on on on on on on oon oonn f of of offf urur ur lifliflifliflifliflifffe we we weeee we pe pe projrojrojjrojectecectect
o co co cco cybeybeybeybeeeey rsprsprsprsprsprsprsprsppaceaceaceeacac . C. C. C. CC. Convonvonvonvonvnononversersrserssselyelyelyelyelyelye , w, w w, ww, we ce ce ce ccan an nannan anan argararrrargargargrggue ue ueueueee
t st st st sst st sstt st seeieeieeieeeeee ng ng ngng ng ng g anandandannd be bebebeebeingngingingiin se sese seen en enen hashashashashaha al al alwaywayways bs bs b bbeeneeneeneeeneennennenen
rimrimimmmrimrimmrimrrrriri aryaryaryaryaryryyyaryaryyyarararryyyy fo fo fofoff fo fo focuscuscuscucucuc offf ofof of yo yoyyouthuththuthuthuthhhhthuth cu cucucuucuuu cu ltultultultultulture.re.re.re.re.e.e As AsAs As A AsA Di DiDiDiD Di Dick ck ckckck ck c
bbbbbbbdigdigdigggdigdigdigigiggigdidigdigd e (e (e (((e (e e (ee e 19819819889888988198198898819 8) 8) )8) 8) 8)88)8) sugsugsugsugsugsssuggesgessssgesgesgegege tstts ts ts tst subsubsubsusubsubsubculculculcucuculcululturturtututurturuture ‘e ‘e ‘e ‘‘eee forforforforfforrms ms ms ms ms msmssss
thethetheethethetheth sp sp spsp sppspspspppaceaceaceaceacececeeacaaacaaaaa be bebebebebebebeebe be bbeb twetwetwetwewewewewewetweeenenen eneenen ennen sursururursursu veiveiveiv llallallallalal ncencencencencencecennnn an an an anannddd td ttd td td tthe he he he he he he he e
asiasiasiasiasasisiasiasiassias on on on on onononoon ofof ofof of of of ofofof sursursursursursusuusuu veveiveiveveeveee llallall ncencencecencencee, i, , i, i, i, i ,, tt tt t ttt tt tt tranranranranranranananana slaslaslaslaslaslaslaslaslaslslaslass testestestesteetesttestes thth thth thhe fe fe fe fe factactact
beibeibeibeibeibeiibeibeibe ng ng ng ng ng ngng ngn undundundundundndundundnderer eer e scrscrscrrutiutiututiiny nynyny nynyy intintntntintntntnnntintin o to too tto to to to thehe he heheheheheeehe he e pleplepleplelepleplpleppp asuasuasuas re re re of ofofof ofof
ng ng ng ngng ngggg watwatwatwawawatwa chechechechehhhecheh d. d. d. ddd It It It Itt is is is hidhidhidhidhidingingngingngngingng in in in in ininin th thththhhe le le le le le lighighighigg t’.t’.t’.
dddidisdisdddisdistintintinintinnnctctictictctctiiitctiiiiictc ooon on on on ooonoon betbetbettbetweeweewew n pn ppppublublublubllu icic icicii andandandandandand pr pprprpprprprprp prpr pr prrprppp ivivivaivaivaivaivavaivaivaivaivaivaiiv te te tete te to to totto to to too too
theththeeththehththet p popo popoopopointininnintintntntintnttinntnninintt wh w wh wh wh ereereereereereereeree we we weww ar ara e ie ie ie in dn dn dn dn dangangangangangererererer er er er er eerer er of of of fofoffoof of fof ofof ofooff loolooloolooloolooloolooloolool nsinsinsissinng g gg
a fa fffa fa ffunundundddundundu damaamamemmmemememeamamemaaaameama ntantantatatatal hl hl hl hl humaumauumauumam n rn righighghghight; tt; t;t; ; thethethethethetthhh ri ririr rightghtght to too
pripripripripripriprprr vvacvavacvacvav ccy? y? yy?y?y? y?y y? ? IndIndInnInndInIndInn eedeedeeed, t, t, t, t, hhehe he h pripripripp marmarmarmarmarararary oy oy oy oy ppoppoppooositsitsititioionionnnn f fo fooo foff r r
thethethethehethettheetth in ini ininini trotrorororootrorotrooddudducducdddududuucudduud tiotiotion on ooon on of Nf NNf Nf Nfff Nf NNatiatiatiaatiattta ononaonaononal Il Il Idendendentittittiti y Cy Cy Cardarardrdarddardddarrrddrdarrdardrds is is is is is is is is is is innnnnn nn n n n
202022200200000020 5 c5 c5 c5 c5 amaaaammemmmammememeeeaaamema fr fr rom omom om mmm m m m m m ParParParParPaParParParParParParPaPaPaParPaaParrPaPPa llllliaiaiiaiaalliilllial menmenmenmem t’st’sst s Jo Joooooointintintintintintintintntntntntntnn Co CoCCC Co Co Co Co CoCoCCoCoCCooommmmmmimmimimmmimittettetetetettettettet eee e
foforforfofforfoororf Hu Hu HuHuHuHHuumammmmamamanmananmaaannnmanmmmamm Ri R RiRi RiiRi Ri ghtghtghtghtghtghtghtghthtghtghtghthtghghghhg s ws ws ws ws ws ws ws ws ws ws wss wwss ww shoshoshhoshohohohohohh e me me me me mmmmmmmmmmmmme ainainainainainaininninaininain ar ar a aargumgumgumumgumgu eeententennttt
agaaagaagaagaagagaaaaa aaa ininininsinsnsinnsnn t ttt t tt tt ttt tttt ttt tttt hhhe he heheeehehehhhhehheehhhhhhe ssschschschschs hhhschsss emeemeemeemeemeemeemeemeeeememe wawawa w s ts tttts hathatatathat it it it iti co co cocoo ntrntrntrntrraveaaaveeavveaveeaveav nednednednedenedneedednednednednedeeeeeeddddd
ArtAArtArtArtArtAAAAArArttArtrttAA ticlciciciccliiciccclclliiicccliiiclllllle ee 8e 8e 8e 8e 8e 8e 8e e 8e 8eeeee 8ee 8eeeeee 8 ofofofofoooofofof ofoffofofofof oooofffoo ofooofofofofoooofofffofoffof thththtth t tttttththtthththththt e Ee Ee EEEEEe EEEe EEe Ee EEEEEEEEEe EEEEEurourourourourourourourourourourourourururouroururourourourourorururoororourorrrrurooururuu pepeapeapeapepeapeaeapeppeapp n Cn Cn Cn Cn Cn Cn Cn Cn CCn Cn CCCConvonvonvnvonvonvonvonvonvonvonvnvno vvvventenenentententenenenententenenteeeeeeentenentententntneenttttttionionoionionionioionionionononononnonnionoioooiooooiononioooooono on on on onononnoonnooonn on
HumHumumumummHummHumuuHumananananananan an an an aanan an nannanananan RigRigRigRigRigRigRiggRiRRRiggRigRiggRigR gRRRRiRR hhhtshtshhtshhhhhh : t: tttttttt: thehhe hhhhe hh rigrigriggriggghthththththt ht ht to toto to toototoooo o o rererereereeresesresrerrererr pecpecpecpecpep t ft ft ffororoor or oneoneoneoneone’’s ’s
‘pr‘prpr‘prppprprrivaivaivaivaivaivavaviivavate te tttetete tetete ete tteeeteteete ee ee andandandandandandandandanandddanandaandnaanddannd fa fa fafafa aamilmilmilmilmilmilly lyy ly ly ly ly ly ly ly ly ly ly lifefifeifeifeifeifeifefifeifeiif , h, hhhis isis sis homhomhoh e ae aandnnnd nd d hishishishh
corcorcorcorororcorcorrcoccocccc resresresresresesresponpoponononponponpoponpponp nppppppp denddeddendendendendendendendedendendendededenedeee cecece’ce’ce. I. In An Auguuguuuust st stt 220200200006 a6 a6 a6 annn an an aaarttitirtticleclecleclecle
in in in ininnnni TThe ObObsers rververr, G, G, GGabyabyaby Hi Hinslnslnsliffiffffiffiff hi hi hih ghgghlghlhlllg ighighighighightedtedededed a a aa arrrrrr
relrelrelrelelelelrele atiatiatitaaaa onsonsoononoon hiphiphippppp b b be be be b twetwetween en en NatNatNationionononal al allal al aal IDID IDD carcacarcarcarrds ds ds dds andaandanand a a aa
wiwwidwidwiddwidw er er errr proproprprrop jecjececjececjecect wt wt wt t wt hichichich h wh wh wouloulould ‘d ‘d ‘widwidwiddddden enen nnn sursursurveiveiveiveillallaal ncenncencence
of of of offooo eveeveeveeveveeeerydrydrydrydry ay ay yaay y lifliffififl ee be be be y ay ay allollollowinwinwing hg hg highighhhg -st-st-s-sststtreereeeeeet t t
busbusbusbusbussusineineineineineninessessesseses ts ts ttto so so so ssoo harharharharh e ce ce confonfonfn ideideidentintintialal al al infinfn ormormormormmatiatiit on on onon
witwitwitwitwwiw h ph phh pppoliololioolioliolice cece cce datddatddatd aabaabab sessessessses. . . By By ByBy intntinintintegregregrrrrrrratiatiatiatiing ng ng ng ngng ththethtthe witwitwittw hhh ph phh ppolioliooliol ceceee datdatatatdatatd abaabaabaabaabasessesses’.’.’.. ByByByBy intintintinntteegegregreggrrrrratiatiatiingngngn thethethe
biobiobiobiobioommetmetmetmeetmetmeetmm ricricricricricricricr c te te tete teeechchnchnchnchnolooloologiegiegieiees ds ds ds ds eveeveeveevev loplopoplopopopppped ededed ed ede forforforforfofooff th th ththtt e e eee
NatNNatNaaNatNatNNa ionioiiononioionnaal alal al al aaaa IdeIdeIdeIdeIdedeentintintintintinttn ty ty tyty CarCarCarrC ds ds ds schschschs hememeememeemeeemeeee wi wiw wi wi w th th thhh conconconconconcc sumsumsumsumuumerer er err
tetectectececttect hnhnohnohnohnonoohnon logloglogogogloggiesiesiesiesieseiesies li li liliike ke kke eke ke keeee stostostostostotstore re re rere loyloyloyloyloyyaltaltaltaltaltaltyyy cy cy cy ardardaaardaa s as as as as aaaaas and nd nnddnnn cacacascascascc h h h h h
macmmacmacmacmacmacm cccchhhihinhinhiinh es,es,es,ees,es,es,, po po po po po po pooollliclicliclilicliclice we we we we wwwwwwwoulouloulououlouououluo d td ttdd td td td hehehenhenheen be bebebebe ab ab aba le le le to toto to tratratratratratraatrack ckckckck ck
thththehehehehehehth ev eevev everyeryeryryydaydaydaydaydaydayyyayyd yyyayyy ac ac acacacacctivtivtivtivtivitiitii ii es es es eeee of of of of ofoo cricricricririic minminminminmmminalslalsalsalsals, s, s s, s, ssssuspuspuspusppspppectectectctcted ed ed ed eeed d
teteterertert rorrorrororrrorrististiisists as as as as as aaand nd ndnd nddd nddndn othooothotooo ersersersersrsers th t th th thttthhhat at at thethththetheey wy wy wy wy wwwy ishishishishshhh to totototottoo mo mo mo mommm nitnitnitnitnititi or or or
bybyy by y by byby byb insinsssinsinssstatantanntatanantatanna tlytlytlytlytlytlyytlyt id ididididid idddd id identententnteenen ifyifyfyyfyfyyyyyingingingingingginging th ththtthtt em em mmemem frofrofrofroof m ‘m ‘m m ‘m ‘‘m uniuniuniuniuniuniuniu quequequequeqqqu
mammmarmarmaraararmarrmarkerkerkerkerkererrkerrrs ss ss sss sss s s uchuchucuchuchchuchhhu hu h as asa as asa fi ffffifif ngengengengegengeengeeeerprrprrprprintintintnntntttts as as as as aaand nd nndndnd iriiririiis ps ps ps ps pppattattattaatternernernernns’.s’.s’.s’.’s’..
ThThTThiThihihhihhihis ss ss ss ss sssss oounounououno nnouounundsds ds ds ds s dsdsds lliliklikliklike te tte thehehehe he he stustussstustus uff ff f of of fffooo sciscisscisc encencnnnnnnnce fe fe fe e fficticttictcticctionionioniononio
butbuututututbubutbb un un ununnn unu leslesleseseslessl ss is is is is is is is t it it it iit it ss os os oss oppoppoppoppoppoposedsedseseese wi wiwwwwill ll becbecbecbeecomeomememe sc scsscscscs ienienieieenenencece ce e cecc
facfacacccacfaa t. t. t. t.t.t. t MorMorMororMorMMMMore re re re e e rreeeceeceecec ntlntltltllntlt y, yy, y, yy a ra rrepoepopopoee oe rt rtrt rtt by by bybbb TheThehehe Ho HoHHHoHHoouseuseuseuseeuse of ofof ofofof
LorLorLorororororLororL ds ddddds ds ddsdss s s CConCConConConConC stististstistist tutttututtuttutttutionionionionionnio Co Co C CoC mmimmimmmmimmm ttettettee ae ae ae rgurgurgurgurgurg es es sses thathathththath t tt
as as asasassas s asaass mamasmasasmasm ss ss sssssss ss ssurvurvurvuuuu eileileileileileille lanlalanlanalanl ce ce e farfarfaar fr frfrfrom om oomomommoo uphuphuphhuphupholdoldoldingingingggng
utiutiutiutiuttuuutilitlitlititlitlitlitl titarariaaariarariariaaaaaaa an an aan n n demdemdemdemeemed ocrocroc atiatitic pc pc ppc c rinrinrinrini cipcipcipcipc ppppleseseslesleel , n, nnegaegaegaagatetestestetes
ththethethethetthhehehethh m bm bm bmmmm y ey ey ey ey ey ey rodrodrodrodrroddingingingingg pr prppp ivaivavvaacy;cy;cy;cy;cy;y;;cy; un un un un un un uununu derderderderderminminmimiminm ingingggg
‘th‘thththheee ce ce ceee consonson tittittittt utiutiutiutiiutionaonaonaoonaal fl fll flll ffounounounounounouno dadaddatdatdattttionionionns os ooooooon wnnn wwn wnnn hichichicicch h hhhhh
demdemmdememdeme ocrocrcrcrcoc acyacyacyacyca an anan anaanand gd gd gd ggd gd oodoodooodoodoodo gogo goggogoooverververververeerernannanannannannnaa ce ce ce havhavhavavahh e e
tratrtratraditditditditittttionionoioo allallallallallly by by by by bbbeeneeneeneneneeen ba ba ba bba babasedsedsessedsedsed in ini in ini th th ththh ththisis iis is is coucouooountrntrntry.’y.’y.’’yy.y If IfIffIf If thth th the e e
rigrigrigright ht ht hht ht totto to to to o pripripripriprp ivacvacvacvacvacvacvvvavv y iy iy iy iy iy is ds ds ddddddenienienienienienied,ed,ed,ed,ed,e thth th then en en notnotnononnono on only ly yyyy wilwiwili l l l
thithihihithis cs cs cs cs onfoonffnfirmirmirmirmrm th tht th ththhhe Ie Ie Iee Ie Innfnfonfonformarmrrmamamam tiottiotiotiotioooon Cn Cn Cn CCommommomomomo mississssionionionooo er’er’er’s s s
sussussussuuuu picpicpicppi ionionionn th thththth thtt at atttat ata BriBriBBriBriBBBBritaitaitaitaa n hn hn hnnnnn as as asassas bbecbecbecbbecomeomemomom a a
sursurusuuu veiveiveveiveillallallallancencencencence so so sosociecieciecieci ty tyty ty ty butbutbutbutbutb al also so givgivgivgivive pe ppe proproppro hethetethhehe ic ic ic
crecreccrecrerecrecredendendendendedendencece ce ee to to tottoo OrwOrwrwOrwrwellellelleellll’s ’s ’s ss s visvissiissionionononi , b, by py py py py aviaviaviv ng ng ng thethetheheee wa wa wawawa wayy yyy y
forfororrforforofoo aa a a a tottottottottottotalialilaal tartartarttta ianiananianianianan popopppo pop pppolicliclice se sse stattattate. e.e.e. e
BevBevBevvis is is FenFenFene nernerererrer
rother Future fears
14 MediaMagazine | December 2009 | english and media centre english and media centre | December 2009 | MediaMagazine 14
Hollywood stars are the stuff that dreams are
made of. This central idea is the driving force of
the film industry. The multi-billion pound industry
is dependent on the creation of an elite ‘A’ list
of stars that somehow sparkle more brightly
than ourselves, drawing us in to the darkened
cinema space to watch their epic adventures.
They embody some central core of masculinity
or femininity that fascinates the audience. If we
examine two young male stars, such as Joaquin
Phoenix and Heath Ledger, we can see how
stars often attempt to create epic narratives with
their lives. With Heath Ledger’s tragic demise
and Joaquin Phoenix’s career meltdown, these
narratives can have a dark and deadly side.
Stars have always attempted to construct epic
dramatic narratives from their ‘real’ lives. Since
James Dean’s wild car-racing ways, some stars
have always had a fascinating ‘second life’ off
screen. The star will become embroiled in affairs
with men or women, will possibly be arrested,
may marry and divorce; the narrative unfolds
in newspapers, magazines and the web. Kiefer
Sutherland, Brad Pitt and Mel Gibson are other
classic examples.
Joaquin PhoenixOn October 27th, 2008 the established
young star Joaquin Phoenix announced he
was retiring from acting and Hollywood to
begin a new career as a Rap artist. He was a
macho star who had earned his place in the
Hollywood pantheon with several star turns
in films. His spectacular fall from ‘Stardom’
amazed us all. Phoenix started to grow a
huge beard and began to look dishevelled.
For Media students, this ‘car-crash’ spectacle
is fascinating as it deconstructs a major star
before our eyes. He continues to pursue a
rapping career and looks worse day by day.
In August 2009, Phoenix was reported to
have bought a black velvet cape and mesh
top in an L.A. store and began rapping in the
outfit before dumping his old clothes in a bin
outside. Pursuing a Rap career was a direct
challenge to the Studio and the producers
behind Phoenix’s last film Two Lovers. The
film did badly at the box-office and did some
collateral damage to the reputation of his
alteration of his facial expressions due to his
mental state. He was dysarthric, a specifically
thick tongue that again is difficult if not
impossible to mimic. And finally there was
severe motor slowing which is a yet another
feature of intoxication or a severe psychiatric
condition such as depression
If this is acting, hats off. But I have grave
concerns that we are seeing something far more
serious. If I am correct we can only hope he gets
the help he needs before it is too late. ‘
Joaquin Phoenix, brother of the late River
Phoenix, is no stranger to controversy. After a
breakthrough role as a James Dean type troubled
teen in Gus Van Sant’s To Die For (1995), he
went on to portray the cruel Roman emperor
‘Commodus’ in Ridley Scott’s Gladiator (2000). In
2005 he was nominated for the best actor Oscar
for his star turn as Johnny Cash in Walk The
Line. In the company of Heath Ledger and Phillip
Seymour Hoffman, Phoenix had the world at his
feet, or so you would think. Phoenix attempted
the unthinkable, however. He attempted to
redefine his representation and explode his
stardom.
With Ben Affleck’s brother, Casey,
documenting everything on video, the possibility
co-star, Gwyneth Paltrow.
Career suicideHis talk-show appearance on The Late Show
with David Letterman was the worst, (or most
amazing), appearance by a star on television.
Promoting the film Two Lovers, Phoenix began
the interview badly. Before continuing this
article, visit the YouTube clip of this career suicide
Letterman appearance at: http://www.youtube.
com/watch?v=HXpYk7WGN5Y. Monosyllabic
and incoherent, Phoenix’s appearance has
become so infamous as to be mocked at the 2009
Oscar Ceremony by Ben Stiller.
An American Psychologist, Dr Drew Pinsky
analysed Phoenix’s performance on Letterman
and told the website ‘RadarOnline’:
I understand that there is speculation that
he may have been fulfilling the role of a
character for a mockumentary. I maintain
an open mind and hope that this is true but
I suspect something much more serious.
It is impossible to fake flat affect. Notice
that his facial expressions are not still (as
an actor would portray in trying to recreate
this experience) but rather one can see
what we call flat suggesting a physiological
Playing with PersonasHeath Ledger, Joaquin Phoenix & ‘Real’ Life
english and media centre | December 2009 | MediaMagazine 15
prank, playing a game with the Media. In an
extraordinary web-site dedicated to finding
footage for this documentary JoaqDoc.com,
Casey Affleck has created a site that allows users
to upload their own videos of Phoenix rapping
on and off stage. The nature of the documentary
that Phoenix and Affleck might have in mind can
perhaps be interpreted by the rather extreme
legal consent that uploaders to the site have to
agree to:
By posting any content, images, photos,
video, sounds, profiles, works of authorship,
or any other materials (collectively,
‘Content’) on the Website, you hereby grant
to Flemmy [Affleck’s production company],
a non-exclusive, fully-paid and royalty-
free, worldwide license (with the right to
sublicensees) to use, copy, modify, adapt,
translate, publicly perform, publicly display,
store, reproduce, transmit, and distribute
such Content in any and all media and by any
means now known or hereafter devised that
Flemmy, in its sole discretion, shall deem
appropriate.
Whether Joaquin Phoenix is pretending or not,
film industry commentators suggest he may have
killed his career or at least killed the idea of the
‘star’ Joaquin Phoenix.
Heath Ledger Heath Ledger was a mercurial star in the
Hollywood firmament with potential to be one
of the all time greats. His drug death at the
age of 28 was shocking and brutal, ending a
career that had seen him defy categorization
and win a massive audience following. Ledger’s
performance as ‘The Joker’ in The Dark Knight,
eclipsed Jack Nicholson’s previous attempt at
the character and has become a popular cultural
phenomenon. T-shirts and memorabilia are
emblazoned with his painted face and internet
chatter on Ledger’s ‘Joker’ is unprecedented in
film history. Blurring the line between stardom
and reality, Ledger was a man of extremes,
taking his performances to heart. There were
some macabre similarities to the death of River
Phoenix, Joaquin Phoenix’s brother. On October
30th 1993, aged 23, he overdosed in ‘The Viper
Room’, a nightclub on Sunset Boulevard owned
by Johnny Depp. Joaquin phoenix made the 911
call for his brother.
Heath himself described the Joker as:
a psychopathic, mass-murdering,
schizophrenic clown with zero empathy
… I couldn’t stop thinking. My body was
exhausted, and my mind was still going.
He died of a drug overdose in New York on
22nd January 2008, cutting short a potentially
prolific career, with some speculation that the
role of ‘The Joker’ had pervaded his ‘real’ life.
Ledger had shown star quality in a range of
genres, in movies as varied as 10 Things I Hate
About You (1999), The Patriot (2000), Monster’s
Ball (2001) and A Knight’s Tale (2001).
His career high point arguably was Ennis Del
Mar, the emotionally terse ranch hand he played
in Ang Lee’s Brokeback Mountain (2005), for
which he earned a lead actor Oscar nomination.
With acclaim and industry kudos, Ledger had,
ideas on a fresh portrayal of the iconic Batman
villain. His total immersion in character on and off
the set is well documented, with Christian Bale,
(Batman), noting that:
He was somebody who immersed himself
completely in his role — absolutely.
For cinema lovers everywhere, the images
of the cracked white pancake makeup, black-
rimmed eyes, smeared lipstick and greasy,
greenish-tinged hair are seared into our brains.
Ledger’s manic, evil, chaotic Joker was a fatal
element to seep into Ledger’s persona. He was a
M– ethod actor who continued in character even
after filming. This type of ‘Method’ acting can be
dangerous for some fragile actors.
The curse of ‘ The Joker’Heath Ledger was always extremely ambitious
and keen to develop a unique place in the
Hollywood and acting fraternity. This attempt to
manipulate his representation echoes Joaquin
Phoenix, as Ledger was intent on avoiding being
typecast. In taking on the role of ‘The Joker’,
Ledger was well aware of the giant shadow of
Jack Nicholson on the role, but wanted to dare to
redefine himself and the iconic villain. Much has
been made of Jack Nicholson’s comments on the
death of Ledger – ‘I warned him’. This was not a
comment on the curse of the role but a reference
to his warning on prescription sleeping drugs
that killed the
young star. As art
mirrored life and
the epic narrative
of Ledger’s real
life veered off into
sinister territory,
sleeping tablet
addiction killed
the dream.
As David
Thomson noted in
The Guardian:
For good and ill,
early death can
lead to mystery
which is in turn
‘answered’ by a
cult-like legend.
We may yet
have to hear a
lot more about
Heath Ledger
than we care
to believe. He
may even be a
role for some
other promising
young actor. The
show business
devours its own
creations.’
The show-
business may well
have devoured
Joaquin Phoenix,
or maybe, he
will return to the
Affleck’s documentary is a clever expose of the
cult of celebrity and the impossibility of labelling
Hollywood artists. This is a complex and difficult
task, but one which Heath Ledger would surely
have applauded. The epic legends that film stars
attempt to construct can sometimes be their
undoing, however. The narcotic abuse in Joaquin
Phoenix’s background does not bode well and
the Letterman interview suggests problems.
From a Media Studies and Film Spectatorship
perspective, the spectacle continues to fascinate
and mesmerise us.
Sean Richardson is Head of Media Studies at Penistone
Grammar School, near Sheffield.
16 MediaMagazine | December 2009 | english and media centre
The Boo Radley ParadigmTony Gears explores the insights that a literary character – Boo Radley from Harper Lee’s 1960s classic To Kill a Mockingbird – can offer into the ways reality TV represents ‘otherness’ and vulnerable people.
In the novel To Kill a Mockingbird, Arthur ‘Boo’
Radley is described by Jem as:
six and a half feet tall, judging from his
tracks; he dined on raw squirrels and any cats
he could catch...There was a long...scar that
ran across his face...his eyes popped and he
drooled most of the time.
Not surprisingly the children are intrigued,
scared and entertained by this figure and so wish
to stare at his house in the hope he will come
out. Modern TV has made that more and more
possible! This TV version of looking out for the
weird people in society is what I have termed the
Boo Radley paradigm.
The Boo Radley paradigm is a way of
understanding the phenomenon of ‘hyper-reality’
TV where the ‘Uses and Gratification’ (Blumer &
Katz) to be gained from the programme are, (and
I apologise for the deliberate un-PC aspect of my
language here), ‘to watch the local loony’, both
for entertainment, social interaction and personal
identity reasons, making us feel better about
ourselves. We see this regularly in such shows as
The X-Factor and Britain’s Got Talent/America’s
Got Talent, Big Brother and so on. There is a clear
link to the concept of car crash TV.
The appeal of Nadia Almada who won Big
Brother in 2004 was that she was a transsexual;
that of Pete Bennett (who won two years later)
that he had Tourette syndrome. Vulnerable
people have appeared, sometimes with
distressing consequences, on virtually all the
reality TV shows because audiences like to see
And like Boo, the hyper-reality dominates, as
we both fear and yet voyeuristically want to see
these people, de-personalised and distanced
from us. How many people remember their
real names? Take the ‘Bonfire Night Man’ from
X-Factor for instance; or the ‘Chicken Man’. How
many people remember Boo is actually named
Arthur?
Marketing issuesAnushree Chandran writes in Marketing and
Media for the Wall Street Journal (Can edginess
and voyeurism continue to save reality shows?)
clearly makes the marketing issue a priority
concern since TV companies are relying on
New levels of edginess . . . seen as a way to
refresh a cluttered genre where every big
success spawns me-toos
Media agencies such as Madison
Communications cited by Chandran choose these
shows on their ‘controversy’ levels, which may
obviously colour media planning and buying
decisions:
Non-fiction is an area where one can afford to
explore and experiment because the viewer
is evolving.
The ‘Boo Radley Paradigm’ allows for such
planning, but diminishes the more negative
feedback that could come from courting too
much controversy – as in the Shilpa Shetty/Jade
Goody situation, which brought much criticism of
Channel 4.
Sharda Chhetri (Reality Voyeurism 2008)
makes the very clear point that ‘the participation
of emotionally vulnerable people holds the
potential for more entertainment for viewers.’
And the Able_Here_Team, a site for the
disabled, points out that ‘TV producers introduce
more vulnerable people to pull in jaded viewers’
A union official from the Actor’s Union, Equity
(Sep 16 2009) is reported on the ITN website as
stating that such programmes:
are based on exploitation and humiliation
of vulnerable people, which cannot be
acceptable
If we take the example of Susan Boyle, who
despite learning disabilities wowed audiences on
Britain’s Got Talent and YouTube, we can clearly
see the paradigm in practice. Susan, 48, lived
alone with her cat, ‘had never been kissed, and
was teased by children in the street.’ As one critic
writes:
modern TV talent show. It gave producers the
chance to wind-up the viewer’s expectation
that Susan Boyle was another ‘pathetically
deluded’ individual who wanted to be a
‘singer’. Cut to sneering audience, cynical
judges and Ant and Dec waiting to lead the
mocking abuse meted out to all those that
don’t share Susan Boyle’s happy ending.
(Ricky Gervais, Susan Boyle and the Victorian
Freak Show 09)
But she was sold to us, the audience, by the
TV producers and the media at large as the UK’s
next singing sensation. From her first appearance
she fitted the bill as the eccentric loner. The fact
that she could sing a little only added to the
fun. There can be little doubt that her attraction
was that she was ‘odd’ in her behaviour; but
because she has some talent, she gained national
recognition since we could both laugh, pity and
be in awe all at the same time. Other ‘odd’ people
are frequently brushed aside, despite their often
tragic back story.
Jo Hemmings , a behavioural psychologist who
has assessed psychometric testing on Big Brother
is quoted in The Guardian as saying:
People watch reality TV because it is car-
crash TV. It is unpredictable and that is why
people enjoy it. However, I don’t think people
enjoy seeing people fall apart emotionally or
psychologically...
TV producers may claim they are empowering
these participants (and audience) but I would
argue they are much more cynically using the
‘Boo Radley Paradigm’ as a marketing strategy
which re-enforces the notion ‘look how much
better you are, or better off you are, than them.
Andy Millman, played by Ricky Gervais in Extras
states:
The Victorian freak show never went away,
now it’s called Big Brother or X Factor where,
in the preliminary rounds, we wheel out
the bewildered to be sniggered at by multi-
millionaires.’ (The Extra Special Series Finale)
One critic of this year’s X-factor notes on a
website ‘What was previously a glorious exercise
in embarrassment and awkwardness is now little
more than an endless stream of show-offs and
weirdos.’
This issue is highlighted quite clearly in The
Guardian’s ‘OrganGrinder’ Blog:
The opening episode pulls out all the stops
to make sure you continue in your quest to
mock the pathetic, offering an ample fix of
the stupid, the mundane and the talentless...
In case you forget to laugh, Ant and Dec are
there to help you ‘take the mickey’.
english and media centre | December 2009 | MediaMagazine 17
Originally hilarious this show
has now degenerated into
exploitative TV at its worst.
Some of the ‘pre-screened’
contestants are clearly
mentally ill. It is like laughing
at the lunatics in Bedlam...
(But I do)
Of course the desire to watch
the lunatics is nothing new and goes
back to the 18th-Century custom for
the idle classes to visit Bedlam Lunatic
Asylum and observe the antics of
the insane patients as a novel form
of amusement – as graphically illustrated by
Hodarth and others.
The question is how far the ‘Boo Radley
paradigm’ will go. What are we to make of
Britain’s Missing Top Model in which eight
disabled women are pitched against each other
in a battle for a prize of a fashion photo-shoot to
be featured in a top women’s glossy magazine?
There is little doubt that increasingly reality
TV programmes are exploiting the disabled,
the vulnerable or the distressed to bring in
viewers. Big Brother’s clientele became more
and more eccentric over the years, as did the
tasks they were required to perform. X-Factor’s
move to present their auditions in front of a live
(baying)audience is reminiscent of the Roman
amphitheatre and the chosen ‘victims’ (who
having already been through two auditions to
get this far, and being encouraged to believe they
have a chance) are ‘thrown to the lions’ of boos
and chants of ‘off, off’, much to the delight of the
TV audiences as they enjoy the discomfort of the
‘local loony’, either through laughter or pity.
Boo Radley docsWe see the Boo Radley paradigm at work
also in documentary programming, where
mental illness and disfigurement have become
increasingly ‘freak show’ in nature. Noting
this one critic writes that these ‘exploitative
documentaries’:
…are disguised as ‘human interest’ stories
or ‘factual documentaries’. Whether it is
documentaries about the incredibly fat, or
a man who eats badgers, TV producers are
instinctively looking for the next weirdo they
can stick on TV to be stared at by millions in
the comfort and safety of their own lounges.
(Ricky Gervais, Susan Boyle and the Victorian
Freak Show)
In a survey conducted by the Voluntary Action
Media Unit the reasons for these documentaries
was seen by the clear majority as being ‘for
shock value, to increase viewer ratings and for
entertainment purposes.’ Some went a lot further;
one disabled user from the BBC’s disability site,
Ouch! noted:
They are fetishistic and parasitic. Made by
ghouls who think they can parade disabled
people for money like they used to in Bedlam.
Jo Hemmings believes that:
It is wonderful to open up these
opportunities, but if you are going to do that
there is even more of a duty of care.
Nevertheless, amongst the majority of
respondents to the survey there is still a clear
feeling, despite the huge number of negative
comments about such programmes, that they
should be shown on TV.
I would argue that it is clearly better to see
our Boo Radley in the flesh than hide them away
from view and that any kind of representation is
better than none at all. But as one writer adds, if
the vulnerable ‘are required to do things which
in anybody’s book are extraordinary, viewers will
therefore regard them as extraordinary people.’
Hegemony and the Boo Radley paradigm
The paradigm is not only extant in current
media texts like the X-Factor, but also may be
reflective and suggestive of a broader current
social malaise. One could argue that this ‘sickness’
is represented not only in reality TV, but also
in moral panic news items about society and
culture – youth, drugs, knife crime, the inner
cities etc. – wherein the imagery and texts
presented are a vicarious thrill for audiences and
are hegemonic in nature as they help reinforce
social strata and codes sublimating any real
suggestion of pro-active change. The idea here
is less simply about ‘marketing’, and more to do
with deliberate manipulation. If we are looking
at the world through the mediated ‘reality eye’ of
TV and the media, observing in a thrill-seeking
manner the ‘bad behaviour’ and so on, we are
less likely to actively pursue solutions. In terms of
theoriginal premise of To Kill a Mockingbird and
the analogy, by keeping us focussed on the ‘Boo
Radleys’ of society, we are less likely to see the
corruption of racial injustice or other social issues.
(Jan Pinsler, Power and Hegemony in Reality
Crime Programmes 2007)
Crime-appeal programmes successfully give
the impression that they defend universal rights
even though they in fact defend specific rights,
especially the right to private property, which is a
precondition for a capitalist society.
The paradigm is, of course, like hegemony
itself, not forced upon us but achieved through
consent. Programmes are designed to draw us
in through our own psychodynamic egotistical
and other weaknesses. If it is okay to laugh at the
vulnerable to make us feel better about ourselves,
then we will not look too closely at why we were
not happy with our lives, and the status quo will
be maintained.
A research team led by Professor Beverley
Skeggs (Making class and self through televised
ethical scenarios) considered the role of the
media in contemporary identity formation, and
how class is being re-made in the contemporary
culture. It concluded that:
Middle-class participants thought television
exploited uneducated vulnerable people,
yet maintained that participants were a
particular type of person – ‘desperate for
celebrity’, ‘generally trashy people’.
It is obvious that once such a majority
view takes hold, and becomes a ‘dominant
ideology’, it is accepted as the cultural viewpoint.
The minority who disagree with it then tend to
keep their objections quiet, or are simply ignored
or laughed at as ‘out of touch’ or taking it all too
seriously. Hegemony is about consent, and one of
the things it consents to is inequality.
Tony Gears is Head of Media at Bigglescliffe School.
18 MediaMagazine | December 2009 | english and media centre
‘I Don’t Need A Man’ (or do you?)
I see you looking at me
Like I got something that’s for you
And the way that you stare
Don’t you dare
‘Cause I’m not about to
Just give it all up to you
‘Cause there are some things I won’t do
And I’m not afraid to tell you
The music video is a medium that gives you
reality and fantasy in one swoop. It is a platform
where you are made to believe anything is
possible. Its aim is to capture the attention and
the imagination of the viewer, and to hold their
attention for a good three and a half minutes.
To achieve this, its subjects of music videos are
gorgeous, glossy and successful; you want to
be or be with them (depending on your gender
and/or sexual orientation). Its main storyline
usually revolves around sex because sex sells.
This means that song lyrics can contradict the
content of the actual video ie: even if the song
itself is nothing to do with sex the video will be.
In this article I will look at the portrayal of women
in music videos and will be focusing on the core
messages and values conveyed in ‘The Pussycat
Dolls ’ ‘I don’t need a man’, which on the radio
translates into a liberating female anthem, while
on screen it connotes the worst kind of sexual
objectification.
The establishing shot thrusts us in to a pink
world and introduces a blonde pussycat doll in
black bra and skirt. The exciting jump cut makes
it hard to focus on one particular subject. The
kinetic camerawork dominates the performance
and brings energy and dynamism to the stage:
we are drawn in immediately. A dolly shot (in
every sense) then introduces Nicole (the only
member most viewers can name from the group:
so much for girl power!) who begins the song
‘Now you looking at me like I got something
for you’ as the lens zooms in and out – like she’s
teasing you in and then kicking you away. The
camera intersperses Nicole’s moment with a close
up of blonde pussycat leaning down putting on
toe polish against a pink/black background with
the diegetic ‘Uh-a-woo Uh-a woo’ blasting us into
a world where hairdryers, lipstick and legs rule.
We seem to be in a beauty salon where the girls
are dressing up – the implication being they are
doing this because they are confident, strong
young women and they are not doing this for any
man, hence in comes the title. The pink and black
colours which provide the backdrop connote
femininity and sexual power.
We briefly get a close up shot of pussycat
blonde while Nicole delivers the lines ‘Just give it
all up for you/ Coz there are some things won’t
do’ A few extreme close-ups of Nicole break up
the beauty salon. More hairdryers and towels
fill the screen and more leg becomes on show.
The bras are on and showing; these girls mean
business.
We then cut to the back seats of the beauty
salon where the dance routine/lip synch number
which is flawless and smooth (like the girls’ legs
which are the focus of a number of close-ups)
and we see the group of girls simultaneously.
They form a line, they are a unit as they sing the
hook ‘I don’t need a man...I get off being free’
whilst most of the girls expose their knickers to
the camera.
We then cut to a silhouette of one of the dolls
– unmistakably Nicole who is getting undressed
to capture and excite the male gaze. ‘I’ve bought
my own life and everything that’s in it’ she sings
whilst she touches her boobs. We then cut to
blonde pussycat in the bath, shaving her legs
and reaching out. The background colours
then change to white, black, pink and blue as
the dance routine is performed, then to black.
Against the background, Nicole becomes the
subject of an extreme close-up. ‘I get off on being
free’ she sings as she strokes her body and plays
with her hair. This is interspersed with a high-
angle shot of brunette pussycat, who looks like
she could be in the shower.
Again we return to the rest of the girls putting
on make up, shaving their legs and spritzing
perfume (with the label reading ‘girl power’.) The
brunette pussycat takes of one top for another
with the words emblazoned upon it ‘I don’t need
a man’ again reinforcing the message of the song
in case as an audience we had been distracted by
a flutter of lashes, breasts and lipgloss. We come
to the crux as the drums play on the soundtrack
and purple confetti falls down over the dolls. The
dolly shot presents the girls in a row – they are a
‘unit.’ The girls again hug at the end and punch
the air, signifying their female solidarity.
The inherent fiction in this video is that women
are strong: we can wear what we like, put on our
make up whilst we sing confidently in the bath
tub. We are bombarded with so many images of
sex that you forget the original premise of the
song, but by that time the catchy tune is in your
head and the messages have become blurred.
The reality is somewhat different – these girls
can sing all they like about female empowerment
but if you break the video down you can see
that these girls are the product of a sex-driven
and highly sexist music industry. As artists these
women need the male gaze (and the offer of
female identification: I too can be these girls) to
sell the huge amount of records that they do.
Sadly, if there was no flesh on show in this video
and it fitted in with the progressive lyrics of its
own song then I doubt it would have made a top
ten hit.
You Tube comments of the video are mainly
supportive: Mirror image comments ‘They’re just
showing how strong women can be without a
man in their life. Strong, confident girls – that’s
what I’d call it.’ Many female viewers agree that
Nicole et al are feisty, feminist felines to many.
And if the video has this effect on female viewers
then the video directors have achieved their goal.
The main demographic of music video viewers
is mainly 13-24 and largely female. The Pussycat
Dolls’ videos attract both sexes to capture a
bigger portion of the music buying market. Some
of their videos could be classed as soft porn. ‘Girl
power’ has taken a backward step. Instead of
growing up it has turned in to ‘doll domination.’
What the producers of these videos do though
are very clever: these raunchy videos are bundled
up as feminist anthems, as confident assurances
of female power, of strong catchy hooks so both
sexes will be drawn into the video and therefore
hum the record and buy the single. Their market
is teenage girls and men – just look at audience
members at their concerts! They are dolls (for the
teenage girls) and dominating whores for the
male market. The Pussycat Dolls can pretend to
themselves and their audience that they are all
powerful but this so-called power has no value
in the real world: sex sells and the pussycat dolls’
success (literally) embodies this.
Emma Clarke is a recent graduate from Sussex
University who is now working in Brighton.
1118188888 MMeeddddiidiiaaaaMMagga ga azinazinnnnninninnnineeeeeeeee | D| DDD| D| D| D| D | D| DD | Deceeceeceeceeeemeececee ber r 22200200000090009220200009009900092 022 |||| || engglengengengengngenggg isish h aaand meededidiaaaaa ceaa ceaaaaa nnntttrent
g gg
a wa wa waa a a wa wwww oorlorlorld wd wwwwwwwdd wwwwd wwd wwhheerh rhererhere e hairaaiaiaiririraaira rririrrdrydrydddryryydrydrydryydrdryryrydrddryyersersersersersersersserererr , , l, l, l, l, lipsipsipipsipspsipstictictictict ccccccccckkkk ak akkkkkk ak ak ak ak anndd ndnddd nnd nd leggleglegsss s rsssssss uleulelllleleeeuleleuleeeee. .
We We WWWWeeee eWeWWWW seeeeeeeeess mmmmm tmm o bbbe iiiiiin n an a an an beaaututyyy sy sy sy syyy ssalalaalalaloalaaa n n where eeee te heee eeeeeee eh girrg lsls ls ls lssls sls s ss
areaareare drdrdrdrdrdreeeesesse iing uuupupupupup – – – – ththththhheheheheheehhthe imim im imimmmmi liliplipliiplipplippliplipliplip ccacacacaaatcacaacaa ionnnnn be be bbebeeeiiinginginginingngng thth thththttht eyeyeyyyyeyyyyeyyy yyy eyyyyyyy y are
p p
doldolllddddodddolddodooo lylyly lyly lyly hhhhshohohohohohohot pppppt ppptt t pt t t pt rereresresrrr entents ts the he girgirllssss s ssslls in in aa ra row w w ow – t– ttthhheyheeyeyeyeyyhehehh ar ar ar ar arre ae ae ae ae ae a
‘un‘unn‘unnit.’ T’ TTTTTheeeeeeehe he hh girgggg lss s agaaaaagaaaaaaaaain hugggggggg at attttttt ttthth th th ththe eeeeeeee ndnd dd dd d d aandndandandandndanda p pppupuppupupupp nchnchnchnchnchnchncn
thheeeee air,r,,, , sigsig ififnifnifyinyinggggg tg tggggg heir feeeemaemaeee le le e ssoolsso idaaaritrity. y
pp yyy
sucsucsucsucsucucssucsuccuccsusuccescescescescescescesccescceess (s (s (((s (s ss s ((ss litlitlitlitlitlitlil eraeraeraeraeraereereraeraerrerere llyllyyllyllylyyylllllylyyylyyyyyyy) e) e) e) eee) e))) mbmmmbmbbboboommmbbb ddiedieees ts ts ts thisshhih .
EmEmmmmmmmmmmmmmmma Caaaaaaaaa laaarararararkekkekkkeke kk is a ra raa reececeeee nnt nnt gggragggggggggg ddddduduad tee e te ffrrroof m m SSSSSSSusssu exxxxxx exx
Unniiiiiiiiveveveveveveerevere sityy wy wy wy y wwwwwy who iiiiiss iii nnnnonowown wwooooworkiinnnnng nn ininn n BBBBrriighhttoonoon.o
english and media centre | December 2009 | MediaMagazine 19 engenglengnglengengengengeenenengeneenengengeeeeeenngnngngngg ish ish ish aaa
If you liked this you maybe wasn’t cool when
you were younger. These guys are trying to be
great but are eventually not
Damon Beesley writer of The Inbetweeners
The ‘Inbetweeners’ are a social class of
teenagers that are not cool enough to be
popular but not geeky enough to be nerds. The
programme demonstrates this perfectly when
the main characters manage to get themselves
a car but it is a yellow Fiat with a tape deck and
when they dare to play truant from school they
end up drinking Beefeater Gin and Drambuie
in one of their parent’s houses as opposed to
hosting a cool party a teen would be proud of. In
their quest to fit in, things for the Inbetweeners
very rarely go to plan.
The lead character and narrator of the
programme is Will, who after the divorce of his
parents, is enrolled in the local comprehensive
after having to leave the private school that his
very attractive mother can no longer afford.
The contrast between Will and that of his new
classmates is clear and makes for some witty
observational insults from his fellow pupils
‘briefcase twat.’
A lot of the action takes place at the Rudge
Park comprehensive as the characters are
studying for their A Levels in various subjects. The
sixth form is suggested by the programme as a
place where you can reinvent yourself after the
trials and tribulations of 11-16 education and we
are shown the shows characters attempt to do
exactly that.
Storylines deal with the ordinary things that
people of this age stress over: fancying someone
of the opposite sex and trying to attract them,
fitting in with friends while trying to stand out
from the crowd and the ultimate of the age:
trying to get served in a pub. These are things
that all of us can identify with but are only funny
when you are looking back or they are happening
to somebody else.
This is a comedy programme that also touches
on some surprising, unusual and unexpected
events including the assault of a disabled girl
with a Frisbee; having everyone staring at your
erection in the common room; getting drunk and
declaring your love for a girl and then throwing
up on her younger brother and telling the
barman that all of your classmates in the pub are
underage: real social faux pars for this age group.
At times it makes for uncomfortable viewing,
the show has a way of making you feel the
characters embarrassment until you remember
that you didn’t actually do it, relax and then
enjoy it for making you cringe.
In terms of realism, some incidents have
happened to many of us; some incidents could
happen to some of us and certain situations are
unlikely to happen to any us but we fear them
all the same. The latter of these situations tend
to be the nightmare climaxes to the shows and
act as a catharsis for all of the nervous tension
that we have built up from being teenagers
ourselves and from watching the programme.
A target audience for The Inbetweeners could
be derived by the fact that it was specifically
produced for E4 which is aimed at the 15 – 35
audience and written by contributors from the 11
O’Clock Show and Peep Show. The programme
certainly managed to reach this audience as it
was nominated for a Bafta for Best British Sitcom
(eventually losing out to the IT crowd) and the
third series has just been announced with an
American version in the pipeline. Funnily enough,
whilst it featured a young cast set in a school the
first series carried an 18 certificate, an indication
of the sometimes shocking nature of scenarios in
which the characters find themselves.
‘The Inbetweeners production can be followed
outside of the programme also, for those of us
that are used to interacting with programmes
and features on the internet. The show’s website,
hosted through E4, allows us to get closer to
the characters and the actors playing them
along with reliving some episodes under the
title of ‘Watch Them Fail’ and listening to the
contemporary music that is played during each
of the shows, titled, ‘Soundtrack to Their Painful
Lives’.
Whether you are looking back at your college
years or looking forward to them, this show
presents us all with a normal characters that
could have made the same mistakes as you and
had the same aspirations and insecurities that
you had, which is both comforting and reassuring
to know and laugh along with.
Robin Makey
Being Being Normal
and ndd dddd dddndddddddd medimedimedimedidimedieddedidia cea cea cea cea ceea cea ceeentrentrentretretrentrentrentre | D | D| | D | D| DDDeceeceecemecemmmmececeemmmmmber ber ber erber berbereerr ber e 22002002002009090009090999090990909009099200099200090909900090090992002 09902 00909 | |||||| | | | ||| || | MediMediMediMMedMediedididiiiediMediMediMMedMMediMediMMMediMediMMedMediMeediMediMediMediMeMeMediMeMediddddMedddMeediMedMediMeddMediMedMedidMMeMediMeMeMeMeMediM diMMMM aMaaMagaMagaMagaMaMaMaaMagaMaggaMagaMaggaMagaMagaMagggggaMagggggaMagaMaggggaaMaMaMaaMaMa gaMaMa gaMaMMagaaaMaMaaaM ggazinazinaazinazinaaaa iinininazinzi eeeeeeeeee 191991999191999199911