Reality goes online - Guernsey Grammar School

Reality goes onlinea MediaMag special supplement!

2 MediaMagazine | December 2009 | english and media centre

MediaMagazine is published by

the English and Media Centre, a

non-profit making organisation.

The Centre publishes a wide range

of classroom materials and runs

courses for teachers. If you’re

studying English at A Level, look out

for emagazine, also published by

the Centre.

The English and Media Centre

18 Compton Terrace

London N1 2UN

Telephone: 020 7359 8080

Fax: 020 7354 0133

We had such a huge response to our Reality theme for

MediaMag that we couldn’t fit in all the interesting ideas

and issues. So for this issue we’ve produced a special extra

bundle of MoreMediaMag articles as a downloadable

PDF.

Reality goes onlinea MediaMag special supplement!

Email for subscription enquiries:

[email protected]

Managing Editor: Michael Simons

Editor: Jenny Grahame

Editorial assistant/admin:

Rebecca Scambler

Cover image: from Desperate Romantics © BBC, 2009

A Special MediaMag Christmas Present for Teachers: On 18th December we’ll be launching Part One of our new online

resource Doing Reality TV – ideal preparation for the AQA GCSE Unit 1

external assessment on Reality TV, or for classroom study whichever

spec you’re following. It includes a Teachers’ Guide, classroom

activities, embedded clips and articles, a quiz, a useful Powerpoint

timeline, and all the ingredients to get started. Parts Two, Three and

Four will be arriving in January. And it’s all there free for the taking on

the MediaMag website. Happy New Year!

english and media centre | December 2009 | MediaMagazine Reality Online Special 3

MediaMag meets Marcus

Bentley – the voice of Big Brother

Before it bites the dust, read our

exclusive interview with the owner of

that laconic Geordie voiceover about BB

and its future, the role of a voiceover

artist, and why he prefers to

remain low profile.

Jean Rouch –

father of Cinema Verité

Kevin Dunk introduces you to

the work of this great, but little-

known documentarist and his

impact on French New Wave

cinema and beyond.

The Boo Radley paradigm

How healthy is reality TV’s

focus on extreme or marginalised

behaviour? Tony Gears argues that

hyper-real shows increasingly rely on

the exploitation and humiliation of

vulnerable people.

I don’t need a man (or do I?)

How ‘real’ is the Pussycat Dolls version of empowerment?

Emma Clarke deconstructs a

music video to suggest that lyrics of

empowerment and feminism are

often undermined by the imagery

and reality of a sexist music

industry.

Playing with personas

Heath Ledger, Joaquin Phoenix and ‘real Life’

Sean Richardson deconstructs

the epic narratives created around

the lives of two very different

but equally talented young

actors.

Being normal

When it comes to realism,

the uncool sixth formers of

Rudge Park Comprehensive enact

some of the typical failures and

embarassments of teenage life so

you don’t have to, says Robin

Makey.

The top five

best-ever not-yet-made reality TV

show of all time!Owen Davey looks to the future

and proposes some un-made

shows which just might make

your fortune...

Hyper-reality

a Rough GuideDavid Bell introduces the

complex and evoloving debates

around hyper-reality and the effect

of digital media forms on our real

and virtual experiences of the

world.

The surveillance

societyWhat’s the relationship between

reality television, new media, and

government policy – and how far are

we becoming a surveillance society as

George Orwell predicted back in the

1940s? Bev Fenner offers some

background. Me, me, mewhy we’re all

celebrities nowChandana Hall explores the

impact of Facebook on our ideas

about celebrity, and the factors that

have made it one of the most

popular social networking

sites in the world.

The work of Adam Curtis

He who controls the present

controls the past. He who controls the

past controls the future (Orwell)

AQA examiner Steph Hendry introduces

you to the stimulating and provocative work of

documentarist Adam Curtis, and walks you

through his imaginative and controversial

installation event ‘It Felt Like a Kiss’.

What’s

in the mix

online?

Steph Hendry on the work of Adam Curtis.

Adam Curtis


An important part of A Level Media Studies is

the need to consider media texts in context. This

idea means that, rather than look at television

programmes, films, magazines etc as simple

individual artefacts, they need to be viewed as

products of a culture. Whether the text is old

or new it is the way it is, not simply because a

director or editor made personal choices, but

because those choices were influenced by the

culture the text/producer came from. All media

texts in some way reflect their own contemporary

issues and ideas and media students need to

consider texts in this way. Some would argue

that when looking at texts this way there is a

danger of attributing meaning and ideas to

a text that were not intentional. However, all

media producers are themselves products of

their own cultural environment and have a

relationship to the dominant values of the time

which will inevitably influence production. This

fact leads us toward an approach to media

texts which necessitates considering them as

cultural artefacts which reflect, respond to and

(sometimes) challenge the ideas, attitudes and

values of the culture that surrounded them.

Some commentators argue that in the modern

age, the notion of history has been lost and

that the culture is losing the ability to make

connections between the past and the present.

One contemporary film-maker who consistently

tries to show connections between the past

and the present and the influence of politics

and economics on society is the award-winning

Adam Curtis.

For those unfamiliar with his work, Curtis has

made a number of documentary films and series

(most of which can be accessed via yahoo video

searches) which can be exceptionally useful for

Media Students who want to scratch beneath

the surface of the mediated world we live in.

The documentaries consider how politics and

economics have impacted on society in the 20th

and 21st Century; and they also deal with the role

of the media.

Style and presentationCurtis has created a unique audio and visual

style within his documentaries. He uses a mixture

of ‘talking head’ interviews and archive montages

which are accompanied by carefully selected

music and sound effects and, in most of his work,

a voiceover provided by Curtis himself. The sound

of Curtis’ voice is ‘typical BBC’ as he delivers the

stories he is telling in an RP accent that hold

connotations of tradition and authority. He tells

his stories in a calm and reasonable tone and they

are often presented more as spoken essays rather

than conventional narrations. Each documentary

has its own hypothesis and the films develop

their respective arguments by setting a historical

context and drawing in selected evidence to

support the ideas presented.

The music and sound choices are often

carefully selected to lead the viewer to a

particular emotional response (although his

ready use of clichéd music suggests he expects

his audience to recognise exactly what he is

doing). For example, in The Century of the Self,

an ominous drone accompanies discussions

about the rise in dominance of free market

economic values in the West. This is a classic

technique of montage and the visuals use this

method of story-telling too. Curtis uses archive

news and documentary footage to illustrate

his work but many of the images used are clips

from a huge variety of sources which lead the

audience into making connections between the

ideas in the narration and the images. He often

uses advertising images and in a recent work, It

Felt Like a Kiss, media images are supplemented

by ‘home video’ footage and recordings of

psychological treatments/group therapy sessions.

At times the images are unrelated to the story

being told within the documentary but, like

the music chosen, they add to the emotional

responses felt by the audience. Even though the

subject matter of the documentaries is always

serious, sometimes the juxtaposition of sound

and images creates a deliberately satirical effect.

The textsSince 2000 Curtis has written and directed the

following: The Century of the Self (2002). A four

hour journey through the 20th Century which

looks at the influence of Sigmund Freud and

other members of his family on US (and western)

culture. The documentary looks at, amongst

other things, the influence of psychoanalytical

ideas and their use in politics and advertising;

the cultural moves from a ‘citizen’ to a ‘consumer’

culture and from a culture of conformity

to individualism. The documentary takes a

english and media centre | December 2009 | MediaMagazine 5

may be the first PR stunt held in 1922) and the

development of lifestyle marketing. It shows

how ideas that proved to be very successful

for businesses when employed in marketing

have been adopted in modern politics and

consequently changed the nature of politics

itself.

The Power of Nightmares (2004)

Quite a controversial documentary as it

has as its basic argument the idea that Al

Qaeda, as an efficient and cohesive terrorist

group, does not exist. Instead Curtis offers the

hypothesis that the notion of this ‘organisation’

can be seen to be part of the construction of

a culture of fear which has benefited some

political groups since 9-11. The documentary

looks at the culture of the West and identifies

how its dominant values can be perceived as

threatening to other cultures and uses this

to identify why the terrorist attacks of the

turn of this century may have occurred. The

documentary also examines how the events of

9-11 were used to usher in what some see as

an erosion of human rights in the West. They

have helped place more power in the hands of

already powerful groups in the name of the ‘war

on terrorism’ via changes in the laws regarding

detention and arrest, freedom of speech and

privacy. Whilst these ideas may sound similar

to those framed within conspiracy theories

which have developed since the 9-11 attack,

Curtis does not subscribe to them but attempts

to show how recent political decisions have a

relationship to the way power and control is

generated and maintained.

The Trap (2007)Again Curtis presents a complex multilayered

analysis of consumerism’s promise to

create happiness. But in an argument that

links mathematical and scientific thinking,

psychology and economics he shows how

these ways of thinking have led to a target led

culture and one where clinical psychiatry has

been used to normalise certain attitudes and

and act in self serving ways; and that natural

human emotions such as sadness and anger or

personality traits such as introversion or certain

types of unruly behaviour have been identified

within abnormal psychology and medications

prescribed in attempts to level out emotions and

behaviour.

Adam Curtis has contributed short films

to two of Charlie Brooker’s programmes

Screenwipe (2007) and Newswipe (2009).

Both programmes focus on modern news. The

Screenwipe contribution deals with the changing

face of journalism and how news reports use

citizen journalism (http://www.youtube.com/

watch?v=O9FaIyc4vpU). In Newswipe Curtis

considers the audience’s responses to the news

and the way reports of major events have been

simplified, creating the audience response he

calls ‘oh-dearism’ (http://www.youtube.com/

watch?v=xW3XeT7qavo).

It Felt Like a Kiss (2009)Curtis’s most recent work has been his most

‘experimental’ so far. Like his other work there is

a clear hypothesis within the documentary which

focuses on the construction of the US notions of

the ‘American Dream’ in the 1950s. It deals with

US international politics and the stark realities

of life in the States where homosexuality was

seen as an illness, and beating a woman was

an acceptable part of a relationship. Again his

work is about connections; he draws together

stories which deal with Rock Hudson, Doris Day,

Lee Harvey Oswald, Lou Reed, The Beach Boys

and the first chimps in space. The documentary

brings us up to date by considering how all

these things relate to the destruction of the twin

towers and the post 9/11 culture that followed.

The film uses visual and audio montage to tell

this story, but the voiceover has been replaced

by intertitles so the audience is encouraged to

make connections for themselves. The most

unusual thing about this documentary however,

was (and is) its presentation. Currently the video

within what is probably best described as an art

installation project/theatrical event that was part

of the Manchester International Festival in July

2009. A version of the video was screened in a US

high school gym decked out like prom night and

was situated in the middle of an interactive walk

through theatrical presentation.

It is difficult to describe the experience of It

Felt Like a Kiss without giving up its secrets and

this would ruin the experience for anyone who

may be lucky to see it in its original context as it

is possible the film/installation may well be being

presented in London before too long (see Curtis’

blog for more details). Where the film itself gives

a visual/audio demonstration of the falsehood

of the ideological notion of the ‘American

Dream’, the ‘experience’ allows the participant

to experience this themselves with areas which

show the construction of the dream, from the

white picket fences of 1950s American suburbia,

through to the erosion of that dream. It allows

the audience to experience the undercurrent

of fear and paranoia in 1950s/60s culture until

the exhibitions plunges you into a nightmare...

complete with psychological torture and slasher-

movie monsters.

Curtis’s hypotheses are controversial; his

material is selected very carefully to elicit

specific responses in his audience and his work

has definite political and ideological agendas.

The audience may or may not agree with the

conclusions he draws, but his work illuminates

how history, society, politics and economics

impact on ideological positions which are often

seen as being ‘normal’ or ‘natural’. His work

intends to provoke thought and debate and as

such can be very useful for Media Students, not

least because he shows how history is not just a

collection of facts, dates and events but is, in fact,

the reason our culture is the way it is today.


are anesthetized in their respective beds at night,

with the consent of their heavily compensated

family and friends, to be awoken by a sensation

of actual falling, strapped in tandem as they

are to a parachute and plummeting towards

uninhabitable jungle from the plane of the

show’s generous sponsor, Air Brazilia!

Unlike the embarrassingly humane dating

shows of yesteryear, XD will allow for no such

anti-climactic ending as ‘He just wasn’t really

my type’, as the situation that the instantly

traumatised couple find themselves in forces

them to either pull together or fall apart.

What could break down the barriers between

themselves and the audience more effectively

than utter desperation? What could be more

definitive than cannibalism or more unifying

than drinking each other’s urine when the clean

water runs out? As the show’s slick tagline says,

participants will either Fall In Love And/Or Die

Trying (to escape the Amazon rainforest).

3. Last Man Standing: Nature’s Great Events

That’s right, take six tough-but-vain men

from BBC3 – perhaps winners of previous LMS

series – and pitch them against BBC1’s Nature’s

Great Events, making an Attenborough narrated

exploitation show that’s simply perfect for BBC2!

Which of the six will be trampled to death, eaten

by lions or drowned by crocodile as they attempt

to participate in the wildebeest migration

through the Mara River and across the face of

Africa? And who will withstand, from the Pacific

coast to the spawning pools of the Alaskan

foothills, the Grizzly Bears and ice-cold waters of

the North American salmon run?

Could William Robinson, aka Jujitsu specialist

Iron Will from Northampton, be amongst the last

surviving shoals of the shark, dolphin, sealion

and humpback whale attended feeding frenzy of

the south-east African sardine run? If his ego has

anything to do with it…

4. Elizabeth It’s high time our ceremonial head-of-state

threw off the Victorian shackles of privacy and

opened her life to the comforting whir of hidden

cameras. Twenty-four-hour coverage of such

a globally respected subject, edited into neat

one-hour episodes of all the most undignified

occurrences would make a fine replacement

for Channel 4’s folding Big Brother. With the

spoilt heirs to her fortune throwing tantrums,

rampant Corgis littering the Palace with this

waste, and a shaking, mumbling and eternally

confused husband as the fall guy, this could

become a highly manipulated fly-on-the-wall

representation of celebrity family life as we’ve

never seen it before. You could even call it The

Windsors and give it, say, an ironic swing version

of the national anthem as its title theme!

Just think of the spin-offs…Elizabeth: Crazy

In Love, Harry Windsor: Adrenalin Junkie,

Charles could release an album…

5. Reality TV Show Think The Apprentice but, instead of

despicable idiots vying for the attention of a

washed up business tycoon, despicable idiots

vie for the attention of a reality TV production

company executive, pitching, brainstorming,

focus-grouping, youtube-robbing, talent-

wasting and soul-selling their way to the

ultimate title of Producer, where they’ll receive

an annual wage ample for quashing those

feelings of guilt and unfulfillment at having

bent to the wills of the television establishment

and abandoned the very creativity that had

spurred them towards such a medium in the

first place.

Depressed and now a C-rate celebrity, the

winner, having provided executives with a host

of new reality TV show ideas during his or her

apprenticeship – and, of course, the show that

they themselves now produce – could even

become the subject of their own reality TV

show, revealing such a post-success comedown

and personal disillusionment with spellbinding

candidness and revelatory insight into the

industry that they have become a key player

in. Perhaps a subsequent spin-off could follow

the winner’s attempts to relinquish the format

altogether and get back to their creative roots

producing narrative drama by cutting edge

writers or prize-winning documentaries about

Britain’s celebrity-reared children and their

rejection of previous generations’ work-ethics.

The possibilities are endless!

So, if you’re interested in making REAL

television, then DROP whatever subjects you’re

studying and DROP whatever qualifications

you’re working hard to achieve, because all

you need to WORK IN TELEVISION is a good

handshake and a bad idea!

Just go to www.pleasedontgrowupto

makebadtelevision.co.uk

and let’s jump-start that career, together.

Owen Davies os a graduate in Digital Media Arts.

Are YOU a team player? Could YOU lead the way to a brighter future? Do YOU want a career in television? Then DROP those cameras, DROP those cups of tea and DROP those notions of artistic integrity and social responsibility. TAKE NOTE! Owen Davies introduces: The Top Five Best-Ever Not-Yet-Made Reality TV Shows Of All Time! FREE!

1. Star Tickling Remember in the Nineties when Dennis

Pennis asked Steve Martin why he wasn’t funny

anymore? Well, no matter. As members of the

Invasive Generation, you can go one step further.

Simply find yourself an unemployed comedian

(i.e. any comedian) or the instigator of a comedy

YouTube prank-video of 100,000 hits or more,

and assign them a camera crew as they chase

celebrities off their jogging circuits or away from

their crying children until they run out of will

power and succumb in the damp, urine-smelling

corner of some gloomy alleyway to the squealing,

writhing and hilarious indignity of being tickled

in the ribcage by a man who could, for all they

know, be trying to kill them.

2. Xtreme Dating You’ve seen Blind Date and you’ve seen Born

Survivor: Bear Grylls, well now imagine that,

instead of a couple meeting for the first time in

the florescent surroundings of the tongue-in-

cheek gameshow format and spending a sunny

weekend away together in Costa Blanca only

to discover that they don’t like the same kind

of human being, the couple in question don’t

appear in front of a live studio audience at all, but

Coming soon...

Elizabeth

Coming soon...

Last man Standing

Chandana Hall analyses the social networking phenomenon.

Since its inception in February 2004, Facebook

has become one of the most popular networking

sites in the world with 250 million current users.

Its popularity, I believe, can be ascribed to three

key factors:

• the growth and proliferation of reality based

celebrity culture in our society

• our own belief that we are ‘important’

• our increasing dependence on a range of

e-media platforms to form and develop

relationships.

CelebrityLet’s examine the cult of celebrity first.

Following the genesis of Big Brother (ten years

ago now), ours has become a society obsessed

with what ‘real’ people do in a variety of common

and constructed situations (stranded on a desert

island in Shipwrecked, at home with the kids

in Supernanny, living the American Dream in

The Hills). The result of this fascination with

the actions and behaviour of people who the

programme makers would have us believe are

just like us, has led to the popular belief that we

are all entitled to our ‘15 minutes of fame’.

In their book The Narcissism Epidemic: Living

in the Age of Entitlement, Jean M. Twenge and

W. Keith Campbell relate that: ‘ 2006 poll asked

children in Britain to name ‘the very best thing in

the world.’ The most popular answer was ‘being

a celebrity’. ‘Good looks’ and ‘being rich’ rounded

out the top three.’

They also comment that the ‘me, me, me’

ideology is further reinforced through the

consumption of similarly themed broadcast texts:

The family sitcoms of the 1980s and 90s,

like Family Ties, The Cosby Show, and Home

Improvement, have given way to shows about

single people in New York; rich, bed-hopping

teens; narcissistic doctors; and reality TV

with celebrities trying to find love with other

TV celebrities. The closest TV has gotten to

a top-ten-rated family show in the last few

years is Desperate Housewives – not exactly a

showcase of caring.

From a sociological perspective, reality shows

can be all very interesting. They allow us, the

viewers, to empathise and identify with the

participants, and also to socially interact with

our peers, inasmuch as these

texts become the subject of

discussion between members

of the audience. As a means of

entertainment, reality shows

are certainly fit for purpose: their dominance

of TV schedules and the revenue they yield for

production companies confirms this.

The cult of self-importancePerhaps the most important consequences of

reality shows is how participants have become

celebrities in their own right after the shows

have ended. This is significant, as essentially

they have carved out media roles on the back

of being ‘normal’ and ‘themselves’, without

having to display any particular talents or merit

other than a reasonable sense of humour or

a well-developed chest. Indeed for some, a

complete lack of talent has been the key to their

success- Jade Goody forged an entire career

from mispronouncing East Anglia and then not

knowing where it is.

Their fame or notoriety is further fuelled

by scores of vacuous interviews with said

participants in the tabloid press, usually

focussing on their love life, diet, and feuds with

other members of the show. This leads to the

assumption, I believe, on the part of the viewer,

that in fact everybody’s opinion (but especially

their own) is valid, interesting, and should be

given a viewing platform. This is where Facebook

comes in. It is that platform.

Digital relationshipsWith status updates, the facility to post

photos, video and audio, and the opportunity

to accumulate hundreds of ‘friends’ Facebook

fulfils our need to belong (we are part of a bigger

network), can boost our self-esteem (comments

are usually positive as they originate from people

we know), and can even allow us to represent

ourselves as our ‘ideal selves’.

The concept is strengthened by the findings

of The Sunday Times, who have reported on the

growing number of people having their holiday

photos airbrushed in order to improve their

appearance, before posting the images on sites

like Facebook. The paper reports that:

Sociologists believe the advent of social

networking sites such as Facebook and

MySpace has raised people’s expectations of

how they ought to appear in their holiday

photos... having photographs visually

enhanced [makes] them look more attractive

and their holiday more fun.’

In some respects this not really

groundbreaking news; who doesn’t want to

look good in a photo? What is surprising, rather,

are the lengths that people will go do in order

to represent their ideal selves on their pages.

This also stimulates debate as to how ‘real’ our

accounts of our lives are on social networking

sites. Facebook allows us to subject every facet

of our lives to mediation before scrutiny by

others – as mentioned, we have the ability to

select and edit images before we post them. We

also have the power to make our lives sound

more interesting/enjoyable/successful than

they actually are, again fulfilling our need for

the approbation of others and increasing our

status. The gap between reality and subjective

representation is therefore ever widening- the

potency and appeal of Facebook is in its ability

to accommodate our desire to rewrite and revise

what happens in real life, in order to bring our

experiences closer to what would occur in our

version of an ideal world.

It also reinforces our belief that we are

important and that people will be fascinated

by what we have to say, which leads to status

updates that generally lean towards inanity (a

random sample taken from my husband’s page

include ‘I’m hungover and off to work’, ‘Just had a

lovely walk’ and ‘Really tired and going to bed’).

I’m sorry, but even if you’re my best friend, I’m

still not that interested in what you had for your

tea. This is why ellipses are so essential to the

narratives of novels and films – to engage and

maintain the interest of their readers/audience

there is no need to detail the minutiae of the

characters’ everyday lives – the assumption that

the characters are eating, sleeping and having

a shower somewhere off the page or off-screen

is enough. So why this obsessive need to record

our every action and thought through Twitter or

Facebook?

Possibly the key to explaining the true

success of Facebook et al is that they are

e-media phenomena that can fill a logistical

and psychological gap. As our society becomes

ever more swayed by a series of moral panics

(too dangerous or poor to go out because of

terrorism/swine flu/paedophiles/the credit

crunch), and lives become too busy to engage in

quality ‘face time’ with our friends, so Facebook

becomes the ideal platform for staying in touch

with others. However, if its intellectual stimulation

and thought provoking discussion you’re after,

even the Jeremy Kyle Show might be a better bet.

Chandana Hall is a media teacher in Hull.

Me, Me, Me Why Weʼre All Celebrities Now


David Bell introduces the strange virtual world of simulcra.

With this month’s Reality issue comes the

opportunity to explore new territory, in the

same way that the technological developments

altering our experience of reality are allowing

us to inhabit alternative spaces, places, physical

and metaphysical worlds. I thought that there

was no better way to do this than to look closely

at the notion of Hyper-reality – we live it, we

breathe it, and we exist within it, one way or

another. So, in an attempt to explain what it is,

why it’s important, and where it will take us next,

I present you with an area of Media Studies that

forms part of one of the set topics for the new

AQA specification this year – The Impact of

Digital and New Media – something for all A2

students to get their teeth into.

What? Jean Baudrillard, a cultural theorist known

for his work on postmodernism and post-

structuralism, said that hyper-reality is ‘The

simulation of something which never really

existed’. This ‘something’ he refers to as a

simulacrum or many simualcra.

In one sense, a simulacrum is something that

has been created out of nothing. In another

sense, it is a recipe of many different things:

blend a hearty portion of physical reality with a

pinch of virtual reality and artificial intelligence;

garnish with human intelligence, and serve

hot in a technological vessel. The technological

revolution of the late 20th and early 21st Century

has enabled this blend of elements to mutate, or

to use a less biologically-centred and more media

savvy term, to converge. It is important in Media

Studies that we consider how this could impact

on our lives in the digital era.

Italian Semiotician Umberto Eco once called

hyper-reality (oxymoronically) ‘the authentic fake’

– a type of reality but one that acts as a surrogate,

a replacement that means that many of our

experiences are becoming pseudo-experiences

characterised by the absence of the ‘real thing’.

Let’s see if we can clarify these definitions with

references to some well known examples.

Firstly, to put to you a potentially mundane but

straightforward question: when was the last time

you used a map? Not a Googlemap or

other online street map, but a physical,

tea-stained, roughed up at the edges

paper document? My guess is that

you probably haven’t since late 2004

or early 2005, when the first TomTom

Global Positioning System (GPS) became

available on the mass market. Satellite navigation

took hyper-reality to a whole new level in the

way that we could use a simulation of a close-up

of our own planet to navigate our way through

physical reality. If we think of hyper-reality as a

simulation, and a simulation as an imitation of

a real thing, then we could argue that the maps

we’ve been using since civilised man began

tracking the landscape are also examples of

hyper reality – and indeed they are. But – and

this is a big but – hyper-reality is an evolving

phenomenon, and what it does for us today is

bring things to life. In the 21st century, hyper-

reality ‘animates’.

Secondly, to return to hyper-reality as

something that describes the way in which we

are cut off from reality, take celebrity culture as

an example of a hyper-real world. Celebrities no

longer live the lives they may have once lived as

a child, pre-fame, and therefore find themselves

out of touch with normality. They are trapped in

a world where everything is done for them and

at the same time, exposes their every waking

moment to the public. Technology of course,

plays its part. The media we consume exposes

celebrities; their lives are simulacra of ‘normal’

living. The technological representation of their

existence is therefore hyper-real.

Hyper-reality, then, is problematic in the

sense that its meanings are by no means limited

to one of the key elements mentioned earlier.

It is ever-evolving. Furthermore, a common

theme emerges when we clarify its meaning

and purpose in more depth: falsity. Yet hyper-

reality is at the same time feasible, credible and

significant. We are all attached to it, like nodes

– or end communication points – connected to

a systematic web of finite possibilities. In short,

increasing interconnectivity means that we

cannot ignore hyper-reality, and as a key area of

Media Studies.

Significance? In Capitalist cultures, many of the experiences

we’d like to indulge in are in fact further from

our grasp than Pluto is from the Sun. How

inviting then, that Cyberspace – the virtual world

of technological communications that exists

without the need for geographical references and

lies within hyper-reality – offers us an ‘as-near-

as-we’re-going-to-get’ option to be able to, say,

walk on the moon, fly an X-43 aircraft at 110,000

feet, or shake hands with an Aztec Warrior

having just defeated the Spaniards on July 1st,

1520 – the closest we’ve come to time travel. As

Donna Harraway (1991) argues, the freedom

of Cyberspace is the freedom to construct

new experiences and identities without being

restricted by our physical reality.

Similarly, Marshall McLuhan, in

Understanding Media (1964) talked about

technology as ‘extensions of mankind’ that

modify the body and hence change reality –

that of the individual and that of the culture

in which the individual grows and develops.

Since McLuhan’s pioneering work in the sixties,

technology has not only extended mankind, but

has redefined what it means to exist in reality.

This transcendental shift could also be termed

hyper-real in that we can experience a form of

non-reality within the real world.

Why is this important? We are now

approaching a stage where a ‘get involved or get

left behind’ attitude is becoming the norm. In

other words, embrace the hyper-real world or risk

the possibility of becoming evermore remote. To

reject any involvement in the hyper-real world

in the 21st Century would be nothing less than

virtual suicide.

Creating a ‘hyper-world’ In as far as many technological theorists have

attempted to define hyper-reality, it still remains

a subject with close connections to Media Studies

that is difficult to conceptualise. It is already

evident, particularly with the development of

interactive technologies, that we are becoming

more and more involved in the hyper-real

world than the real world itself. Hyper-reality

represents a reality shift where a ‘hyper-world’ is

now available for us to enjoy new experiences,

to experiment with alternative ways of living.

As futurist Richard Buckminster once said,

until the 20th century, reality was everything

humans could touch, smell, see and hear. The

electromagnetic spectrum proved that this

amounted to less than one millionth of reality. In

the 21st century, the hyper-real world will force

us to rethink Buckminster’s assertions once again.

David Bell teaches English and Media Studies at Morley High

School in Leeds.

ntre

Hyper-r�ality….A Rough Guide


Jean Rouch: the Father of Cinéma Vérité

A discussion on issues of realism, reality

and documentary is not complete without a

footnote to the legacy of Jean Rouch: visual

anthropologist and documentary filmmaker.

In the 1950s Jean Rouch embarked on a

journey to study and film the lives of the Songhay

people of West Africa; it was a journey that would

have a profound effect not only on the people

he was filming, but also: visual anthropology,

documentary filmmaking, the French New Wave,

and the future Reality TV.

Very little acknowledgement is given to this

charismatic French man, indeed across the course

of my entire Film Studies degree as a student, his

name was never mentioned! However any Film

Studies course that includes Documentary or

the French New Wave (WJEC A2 Film Studies

specification) should make room for such an

important figure; the father of Cinéma vérité and

adopted son of West African cinema.

As a documentary style Cinéma vérité is often

confused with Direct Cinema, which came to

prominence around the same time in America

through the work of Richard Leacock. This

latter movement’s style concerned itself with

immersion in a situation with the filmmakers

going ‘unnoticed’; a movement that has,

broadly speaking, evolved into ‘fly-on-the-wall’

documentaries. Rouch contested the very notion

that filmmakers could go ‘unnoticed’, instead he

considered the filmmaker (he always used the

term ‘filmmaker’ not ‘director’) as the catalyst in

a filmed situation, the agent provocateur. Rouch

talked about the camera as a tool to record

selves when being filmed.

Cinéma vérité was a new

language of documentary

cinema created through the

advancements of portable

equipment, most importantly

sync sound and (relatively)

lightweight cameras. Rouch

has often been credited with

inventing sync sound (this

is a debateable claim but

he certainly pioneered it’s

use and possibilities). These

technological advancements

allowed Rouch the freedom to

spend time with the people

he was filming without the

presence of a large film

crew. This style of filmmaking

directly influenced the work of French New Wave

directors in particular Jean Luc Godard.

Chronique d’un été (1960)Although the bulk of Rouch’s work was

filmed in West Africa where he lived and worked

for much of his life as an anthropologist and

filmmaker, in 1960 Rouch teamed up with

sociologist Edgar Morin to make Chronique

d’un été (Chronicle of a Summer). Set in Paris the

film pioneered the use of the

camera to document public

opinion, in much the same

way film and media students

hit their local town centers to

document the word-on-the-

street, still to this day! The

participants in Chronique

d’un été were able to speak

candidly and truthfully

through the presence of

the camera; cinematic

truth in action! Rouch is

present in many scenes

involved in philosophical

debate, acting as the agent

provocateur. Chronique d’un

été was an innovative and

influential Cinema Verite film,

pioneering the many forms

of reality TV we have since

become accustomed to.

Rouch’s later films took

on an interesting development by playing with

the notion of the ‘real’; in Jaguar (1967) Rouch

used non-actors and set them an agenda to act

out. This hybrid form of documentary has been

termed ‘docudrama’ or ‘ethnofiction’. What makes

this form even more remarkable is that Rouch

shows the viewer the set-up; that it’s ‘just’ acting,

in turn rendering the work highly self-reflective.

By acknowledging that ‘this is a film’, the sense

of audience investment is heightened; these

are real people improvising and acting for the

camera. This self-reflective style was also used

by the French New Wave directors, Godard in

particular. By giving his ‘actors’ the choice of

how to be represented Rouch is giving them an

unprecedented amount of agency. It is known

that Rouch often screened his films (often in the

African villages in which he filmed) to receive

feedback, thus giving the people in his films a

chance to communicate if they were happy with

the way they had been represented. Rouch recalls

the moment he screened his early film Chasse

à l’hippopotame (1950) to the village chief and

how the chief had pointed out to him that the

music Rouch had edited into the film would scare

the hippopotamus away! Rouch took on the

feedback and rarely used music again in his films.

Rouch’s career was industrious both behind

the moving camera (102 films over a 60 year

career), behind a still camera (in 1998 he donated

20,000 photographs from his work in Africa to

the Musée de l’Homme), and away from the lens.

Rouch was also heavily involved in championing

communication between anthropologists, visual

ethnologists and documentary filmmakers;

establishing many film festivals, workshops

and cineclubs over the years to support such

filmmaking.

Much can be learned from Jean Rouch through

the films he produced, his championing of

African culture, and enthusiasm for the visual

medium we all study/teach and love. Budding

documentary filmmakers can learn from Rouch

the importance of establishing good relationships

with their subjects; Rouch was an anthropologist

and spent an unprecedented amount of time

within communities while filming. However from

Rouch we can learn to understand and respect

our subjects before representing them to an

audience.

Jean Rouch tragically died in 2004 in a car

accident in Niger. Shockingly not one of his films

is available in the UK.

Kevin Dunk teaches Film and Media at The Ravensbourne

School in Bromley.

is a film, the

heightened; thes

g and acting for th

e style was also use

e directors, Godard i

actors’ the choice of

ouch is giving them

d itself with

filmmakers

at has,

y-on-the-wall’

he very notion

ed’, instead he

ays used the

he catalyst in

ocateur. Rouch

By

of

a

p

ho

g,

e.

n

a

w

R

o

a

ac

is

g

dience investme

real people improvi

mera. This self-reflec

the French New Wa

ticular. By giving hi

to be represented

o an nting them

n 2004 in a car

ot one of his film

s w

earn to

efore repre

ragicall

er. Shoc

he UK.

subject

ience.

ean Rou

dent in

vailable

spent

hin com

h

o

a

Kevin Dunk teaches Film and Media at The Ravensbourn

Godard’s Breathless (1960)

Jean Rouch on the set of Jaguar (1967)

10 MediaMagazine | December 2009 | english and media centre110 di gaazinzi eMediaMaggaazinzi e | Dec ber 0909 |cemmber 200 | english and media centreenglish and media centre

As the doors close on the Big Brother house for he final time, Stephen Hill catches up with Marcus Bentley, the voice of Big Brother to find out about his views on reality television, the future of the show and to get some insider info on being a voice over artist.

MM Hi Marcus, thanks for agreeing to be

interviewed for MediaMagazine – can you tell us

a bit about what you watched on TV when you

were a teenager?

MB I was very frustrated with the lack of

access to kids programmes. In the 70’s and

80’s kids programmes in the school holidays

finished at midday and on week nights ran

from four until six and were boring. Blue

Peter is awful and God knows why it is still

here. Jackannory – terrible! ‘Why Don’t You’

pretentious crap, with only the cartoons and

great British animation such as Rhubarb +

Custard, The Clangers and The Wombles as

a saving grace. Kids’ programmes today are

brilliant. Broadcasters care these days! And

as for teenager programmes, Grange Hill was

great! Tucker is a legend!

MM What about your career before you

started working for Big Brother – could you tell

us a bit about that?

MB I’m an actor I left drama school in 1992

went straight into theatre, where I worked

solidly for about three years. Then for about two

years I seemed to star in about 10 TV adverts. At

one point I was the face of MacLean’s Tootpaste,

BT and Blockbuster! I even had a small role in an

Elizabeth Hurley movie, which was a big flop!

Then all of a sudden from being very busy I had

no good acting work for two years, which was

very frustrating. Then I started doing voiceovers

and got Big Brother.

MM What do you think it is about your voice

that makes it perfect for voiceover?

MB I’d like to think it was perfect! But I think

I’ve developed a style that is unique. There is

an argument that a voice shouldn’t be noticed

just understood, but I didn’t want to be boring. I

wanted to be noticed! I’m a punk at heart!

MM Do people recognise your voice when

you’re out and about?

MB Yes I live in the South East so I don’t blend

in so well. If I get talking in a shop say I usually

get asked and I always get a pleasant response!

MM You’re the narrative voice of Big Brother

but who writes the script? Can you tell us a bit

about the process?

MB The script is written by the Big Brother

producers, in a certain style, which has been

developed over the years and it is dictated by

the ‘Houser-action’. It is then ‘tweaked’ by me!

MediaMag meets….

Marcus Bentley Voice of Big Brother


memorable voice!

MB Yes. Sometimes they like me to say

irreverent things to shock… ‘booze’, ‘boobs’ and

this year I even used the ‘F’ word !

MM You’ve only appeared in front of the

camera once on Big Brother – why do you

choose to keep such a low profile?

MB I have appeared on Little Brother about

five times over the years… but I want to

return to TV drama one day and not be facially

recognised!

MM Do your kids enjoy hearing you on Big

Brother?

MB My Kids have grown up with Big Brother

and get a big thrill in hearing their dad’s voice

coming out of the T.V. They also get a bit of

attention at school…which they think is ‘cool!

MM Big Brother is referred to as ‘reality

television’ but of course it’s also ‘created’ – how

‘real’ do you feel Big Brotheris?

MB Big Brother is unique and should be in its

own bracket. There is only one Big Brother. It is

not another talent show it’s about real people,

however outlandish and how they interact

with each other and their surroundings. And

because the producers put together the right

combination it usually is highly entertaining!

MM What do you think are the essential

ingredients for a good episode of Big Brother?

MB Put into the House individuals from

whatever walk of life then see what happens!

MB The show is fundamentally about the

housemates and as long as they get that

right…each series is only as good as who

they put in! Big Brother 10 was probably the

best yet – Noireen the love siren, Siarvash the

fashionista, Marcus The Ego, Freddy the weird

posh bloke, Bea ‘The Bxxxx’. David + Lisa almost

a straight gay couple, Shree from India and very

different… Sophie the girl next door page three

girl etc etc etc.

MM What’s been the most difficult time for

you on the show?

MB I always have a ball!

MM Do you think people will look back in

twenty years time and view Big Brother with the

same affection they have for Coronation Street

or EastEnders?

MB If these soaps can last for decades so can

Big Brother… until people get tired of watching

people and hearing their stories!

MM Which housemate(s) made the best Big

Brother ‘character’ and why?

MB The list is enless…but I loved Brian

Dowling for his humour, Jade Goody for being

‘Jade’, Nadia for being a woman, Siavash for

being an individual and Bea for being horrible.

MM What is the future of reality television? Is

there a future?

MB Big Brother is expected to be taken onto

another Channel from 2011. There’s plenty

of life in the show as Big Brother 10 has just

MM What are you career plans for the future

– any ambitions you’ve yet to fulfil?

MB I’m going to get back into acting over the

next 3 years and do some good stuff!

MM How did you feel about the way in which

the media covered the death of Jade Goody?

MB The media are unpredictable at times.

Who would have thought Jade’s Big Brother

story was so interesting but it was and not

because the media told us that it was, people

wanted to know all about her and fed her every

success and failure. God Bless Jade!

MM How do you feel about Middlesborough

leaving the Premier League?

MB Gutted! But ever since we got to the

UEFFA Cup Final the club have shown an

appalling lack of ambition!

MM Any tips for the media students out there

who would like to get into voiceover work?

MB I’m thinking of putting together a course,

passing on my tips and helping with demos etc.

Watch this space!

MM And for media teachers – any tips for

when we lose our voice?

MB Never raise your voice and stress your

vocal cords! I once cheered Middlesbrough

on at a play-off match and couldn’t sing at an

audition the next day!

Stephen Hill


In this article Bev Fenner explores the relationship between 18th-century philosophy, government policy, reality television and new media.

Is Britain becoming a surveillance society?

In recent years there has been a growing

debate about whether or not the United

Kingdom is becoming a surveillance

society. Closed Circuit Television was first

introduced in the UK in the ’70s and ’80s after

initially being developed for use in banks.

Bournemouth was the first town to introduce

outdoor CCTV in 1985, leading to trials in

many town and city centres throughout the

country. A home office report in 1994 deeming

the trials to have been successful lead to the

proliferation of CCTV in the UK. Since then the

number of cameras in this country has grown

to an estimated 4.2 million, confirming the

Information Commissioner Richard Thomas’

fear that Britain would ‘sleepwalk into a

surveillance society’.

Big Brother is watching youAlarmingly CCTV is now less of a tool

for crime prevention – with only one crime

being solved per thousand cameras – and

has instead become emblematic of the wider

trend of increasingly pervasive security and

surveillance measures post 9/11; culminating

in the controversial shooting of suspected

terrorist Jean Charles de Menezes in July

2005 and the Identity Cards Act the following

year. It therefore seems ironic that concurrent

with these rapid changes in public security

policy that has placed public life under the

scrutiny of private eyes, there has been a

boom in Reality television; a phenomenon

that puts individuals’ private lives in the

public eye. Likewise, whilst the culture of

surveillance has arguably promoted a climate

of paranoia and the Orwellian fear that Big

Brother is watching our every move, this has

also coincided with new media technologies

which are propagating increasingly open,

unguarded and communal attitudes to private

life. Is the danger then, that such openness

exposes us to the risk of being snooped upon?

The recent increase in cases of identity theft

and the trend for ‘data mining’; the use of

data extracted from ‘private’ sources such as

credit card accounts and social networking

sites such as MySpace, Facebook and Bebo,

for marketing, surveillance or fraud, seem

to suggest that this is indeed the case.

Recently, Facebook has come under scrutiny

for not deleting the profiles of those who

had deactivated their accounts. Likewise,

in January 2008, over 567,000 private

photographs were downloaded from MySpace

by using a bug available on the Internet.

Utilitarianism and the MediaMany forms of surveillance are justified

under the political ideology of social

utilitarianism. The 18th-Century philosopher

Jeremy Bentham is attributed to the devising

the principles of social utilitarianism. In his

doctrine on legal jurisdiction The Principles

of Morals and Legislation (1786), Bentham

introduces the concept of social utility: a

measure of the overall happiness of a society.

The utility principle is expressed as ‘the

greatest happiness of the greatest number’;

a phase Bentham borrowed from theologian

Joseph Priestly’s First Principles of Government

(1768). At a most basic level, it is possible

to see Bentham’s concept of utilitarianism

as the premise on which broadcast media is

based. For example, the Royal Charter, which

governs the role of the BBC as a public service

broadcaster stipulates that the corporation

must sustain citizenship, promote education

and learning, stimulate creativity and cultural

excellence. In effect, the remit of the BBC is

to bring the greatest good to the greatest

number. Likewise, Bentham’s original concept

of utilitarianism also has much in common

with the principles of the Conservative

Party under Margaret Thatcher in the

1980s a time when surveillance was

still in its infancy.

Public Sector ReformDuring the 1980s the Conservative

government in the UK embraced a series

of reforms to the public sector

that reflected the rise of

electoral engagement

with the role of the

individual as consumer

as opposed to

producer. As a feature

of the generalisable

proliferation of post-

modern culture, the decline of heavy industry

and domination of society by information

technology, Tory reforms pertained to be at

the vanguard of social utilitarianism. Indeed,

central to Margaret Thatcher’s policy of

governance was financial expedience in the

public sector. By appropriating the principals

of free-market capitalism Thatcher’s reforms

encouraged the electorate to engage as

consumers of public sector services. This was

a time during which forms of governance

and social monitoring became increasingly

transparent. Public sector services adopted

consumer models of quality assurance

including audits, opinion poles and the

national curriculum and OFSTED in schools.

Other examples of utilarian reforms which

supposedly catered for both public and

private interests include the publication

of school league tables, the privatisation

of nationalised transport systems and the

sub-contraction of auxiliary services in the

NHS. The short-term effect of this was that

the Conservative government was able to

lower taxes creating considerable ‘happiness’

for middle-income earners. The long-term

corollary, however, was that public sector

services suffered not only from chronic under

investment but that the selfish interests

of consumers undermined the premise

of egalitarianism in the provision of state

services.

Theories of surveillanceIt is perhaps no coincidence then, that

Bentham is not only seen as the founder of

modern conservitism but is also attributed

with the invention of surveillance. Key to

this is Bentham’s panopticon: a

re-design of the prison

building

mucmucmuccm h ih ihh n cn ccommommmmommmon onon on

e e e ConConConnserserse vatvatvatvativeiveivee

aatchtchtchcc er erer ee in in n thethethethth

iillallallaaancencencecce wa wawwas s s

eformConCConnserseserrvatvatvativeiveive

mbmbmbracracceded ed ed a sa sa serierieries es es

sesesectoctocc r r r

thithithith s is is iis Bs Bs Bs BBentententententtnn hamhamhamhamhamhamm’s ’s ’ss panpanpannoptoptoptticoicoicoicon: n: a a aa

re-re-e-e-e desdesdesdesignignigngnn ofofof off tht thhe pe prisrisrison on

buibuibuib ildildildiing ngng

Surveillance Society

Utilitarianism and the Media


with the primary aim of improving its cost

and efficiency. The design consisted of a

circular building allowing for a single layer

of tiered prison cells built around a central

tower from which a single observer could

view all of the cells. The cells were to be

backlit and the central void surrounding the

tower unlit so that observer could remain

hidden whilst those in the cells would be

constantly visible. The observation room

would be darkened and it’s windows obscured

to disguise its occupant. The main function

of the design was to reduce the number of

employed guards by handing the task over

to the prisoners themselves. The anonymity

of those guarding, effectively meant that the

prisoners could guard themselves, whilst the

impossibility of telling whether or not the

tower was occupied eliminated the need for

continuous observation. This situation would

also serve to induce discipline in the form

of self-surveillance in which the observed

would internalise the gaze of the observer.

It is this notion of self-observation – the

watched doing the watching – that inspired

French theorist Michel Foucault’s notion of

the panopticon gaze. Foucault argues that

as with the panopticon, discipline and the

mechanisms of power and social control are

embedded within institutions like schools,

hospitals, and factories and, on a generalised

level, within public consciousness. He

suggests that the disciplinary model of power

has ‘infiltrated’ other forms ‘serving as an

intermediary between them, linking them

all together, extending them and above

all making it possible to bring the effects

of power to the most minute and distant

elements’ (Foucault, 1977). Here is the idea

that discipline is so embedded at every level

of society that we have all become compliant

with and complicit in the power systems and

happy to sing from the same song sheet, so

to speak. Key to the complicity of individuals

is their internalisation of the ‘apparatus’ of

power: We can argue that our reliance on

knowledge systems of institutions of power

(including the media) or what sociologist

Anthony Giddens (1990) refers to as ‘expert

systems’, the self-reflexivity (self-scrutinising)

that enables us to express who we think we

are, and the self-consciousness required in

observing social norms and conventions

in what Goffman (1959) calls ‘front-stage’

performances, – those for the benefit of others

– are all internalised forms of external power.

You are watching Big BrotherTaking these ideas into account, their seems

to be a strong theoretical argument for the

relationship between the performance of

social transparency – from online feedback

forums for media organisations to restaurants

with ‘theatre’ kitchens, to the unguarded

openess of reality television – and the notion

of a surveillance society. The very notion of

Big Brother has its origins in George Orwell’s

dystopian vision of the future in Nineteen

Eighty Four (1948): CCTV in this instance

predicted by the two-way telescreen. And,

indeed, the popularisation of this concept in

the reality television programme Big Brother

(Channel 4) offers an ironic commentary on

this ugly aspect of contemporary society.

Its stars are able to subvert the subjecting

function of surveillance by objectifying

themselves for the cameras. Most recently,

however, it is the proliferation of social

networking sites that have lured us into a

more intimate panopotican in which our

correspondences are haunted by a vague

feeling of paranoia that MySpace is fast

becoming ‘their’ space! In theory, these sites

serve the very utilitarian function of allowing

us to communicate more effectively with

loved ones and friends. Increasingly, however,

the awareness that other people are sifting

though our photos and ‘status updates’

induces a self-conscious panoptican gaze

of its own. As the ubiquitous mobile phone

camera is testimony: in the 21st Century,

increasingly our social existence is but a prop

to support the version of our life we project

into cyberspace. Conversely, we can argue

that seeing and being seen has always been

a primary focus of youth culture. As Dick

Hebdige (1988) suggests subculture ‘forms

up the space between surveillance and the

invasion of surveillance, it translates the fact

of being under scrutiny into the pleasure of

being watched. It is hiding in the light’.

Future fears However, as our private lives become

increasingly open, are we blurring the

distinction between public and private to

the point where we are in danger of loosing

a fundamental human right; the right to

privacy? Indeed, the primary opposition for

the introduction of National Identity Cards in

2005 came from Parliament’s Joint Committee

for Human Rights whose main argument

against the scheme was that it contravened

Article 8 of the European Convention on

Human Rights: the right to respect for one’s

‘private and family life, his home and his

correspondence’. In August 2006 an article

in The Observer, Gaby Hinsliff highlighted a

relationship between National ID cards and a

wider project which would ‘widen surveillance

of everyday life by allowing high-street

businesses to share confidential information

with police databases’. By integrating the

biometric technologies developed for the

National Identity Cards scheme with consumer

technologies like store loyalty cards and cash

machines, police would then be able to track

the everyday activities of criminals, suspected

terrorists and others that they wish to monitor

by instantly identifying them from ‘unique

markers such as fingerprints and iris patterns’.

This sounds like the stuff of science fiction

but unless it is opposed will become science

fact. More recently, a report by The House of

Lords Constitution Committee argues that

as mass surveillance far from upholding

utilitarian democratic principles, negates

them by eroding privacy; undermining

‘the constitutional foundations on which

democracy and good governance have

traditionally been based in this country.’ If the

right to privacy is denied, then not only will

this confirm the Information Commissioner’s

suspicion that Britain has become a

surveillance society but also give prophetic

credence to Orwell’s vision, by paving the way

for a totalitarian police state.

Bevis Fenner

lli hi hi hh ddd dididd ttttt | D bb 2009 | Medied aMaMagazinazine 13131313133

atiatationsonsonnsnsshiphiphiphiphhiipp be be bebeetwetwetwetwetwetttween en en en en en thethethethethehe pe pepe pepepeepepp rforforforforforforformarmarmammamarmarmmancencencecencen e ofofofofofofofoff

ccialialiaialiala tr tr trtransansansansnsparparparparencencenene y –y –yy –y –– fr fr fr from om omomm onlonllonlonlonono ineinenninn fe feffefeedbdbedbedbedbedbdbedbedbedbdbdd acacacackackackacackaa

umsumsmsums fo fofofofoor mr mr mr mr mediediedededd a oa oa rgargaag nisnisisnnn atiatiatiatiationsoonsonsnsonsonsonsonsonsononso t to tot to rere rer stastastaaaaaurauuraraurauraurau ntsntsntsntsntsntssn sntn

h ‘h ‘h ‘h ‘h ‘thethetheh atratre’ e’ e’ kitkitk checheeeeeeensnsnsns,ns,sns,sns,ns,ns,ns t to tottooo th ththht e ue uue ue uuungungngungungungunng ardardrded ed

eeenesnesnesss os os oof rf rrf rf rf rrf rf rf rf rrealealeaealealeaealealealaeale le ityityityitytyitity tete tetetelevlevlevlevlevevvvevisiisisisiisiisiisision on o – a– aaand nd ndd thethethhh no notiotiotiotiottioonnn nn

aaa saa sa sa sa sa sa sa saaa urvurvurvurvurvvveileieileileileeileileie lanlanlananllalalalalllalal ceceee e eeceee ee socsocsocsocietietiiety. y. y.yyyy TheThehTheThe ve vevv ry ryyry ry yy nonotnotnonotnononono ionionioioionionioniooio of ofofoffoofffff

Brother hhhashashhhhhashah s it itittttttttts os os os os s s oooooorigrigrigrigrigriggginsinsinsinsnsinsinsins in inin ininin in ininnn ininn Ge Ge GeGe Ge Ge GeGeeGeGeGeGeGeeGG oorgorgorgorgorgororgorgrggo ggee Oe Oe Oe Oe Oe Oe Oe OOOrwerwewwwell’ll’ll s s s

sssssstoptoptopopopoptopoptt ianiananianianiaia vivivi vivivi vivivivviissssisioiosissisisiiosisiss n on ooooon of tf tf tf tf tf ttf he hehe he hehehehe hee futfutufututututfutututuuuurureureuuur in in NinNi eteeen en

htyht Four (1(1(1(1(1(1(1(1(1(1(1(19948948994899999948999 8))):: :: )):)::: :: : CCTCCTCCTCCCTCCTCCCTCCTCCTCCTC V iVV iV iV iV iV iV iV iV iVV iV iiiV iV in tn tn tn tnnnnn thishishishississs in in ini inin inininininstastastastastaststaststastastaataaancencencencen enncenncee r

eeedicdicdicdididiiiicccddidiiciiccciccicdictttetedteddtetedttedeedt by bybyby by byyyyy ttthhtht t tttht t e te te te te wwwo-wo-wo-wo-wwo-wo-owowo-w waywaywaywaywayywaywaywayaya te tett te te telesleleslescrecrecrereen.en.en.en. An AnAA d, d, dd,

eedeedeededeedd, t, t, t, t, thehe he hhe hh popopopoooopopopopp ulaulalaaaaau arrrisrisrisrrisrisrrr atiatiatiatiat on on ooon on ooon of of ofoo thithithithis cs cs cs cs conconconconceptepteptep in in in

ee re reerereealialialialilial ty ty ty ty yy teltelteltellelellelelellee evevievievievisiosiooooosisiooosion pn pn pn pnnn progrogrogogooo ramramrammamra me memme Bigg Br Brothother r

annannnnnaa elel el l 4)4)4)4) 4) 4)4) 4) 4) 4) )44) offoffoffoofferseersersersssssssss an a a ananan ir ir irirroniooooniooniono c cc cc ccommommommommo mmmmentenenentententententententne teee aryaryaryaryry on on on onono

s us uuuuus us us us uus uuuglyglyglyglyglyglylyglyglyglyyglyglyg asas aspecpecpecpecpect tt t t oo ot o oot t oof cff cf ccontontontoonontempemempempempempempmpempempempmm ooorooraoraorary ry ryy socsocsocsocietieteietiety. y. y. yy

stststttttttsstttaararsarsaaraaaaraaraaaaa ar arare ae ae aae aaaaaablebleblebleblebleblebleblebleblelbb tototototototo toto to to su susuubvebvebveb rt rt thethehethe su su suus bjebjebjectictictictictic ng ng ng ng nggn

nnnctictictitictiction onon nnooon of of of ofofoffffoff sursursurveiveive llallancencencen by by bby ob oboobjecjecjectiftifttiffyinyinyinyi g g g g

eeemsemsemsmseselvelvelves fs fs or or or or thethehe ca caamermermerm as.as.as. Mo Mo MoMosst st st recrecrecrecentententententtly,ly,ly,ly,lyy

wwweveeveevev r, r, it it t is is is thetheththe pr prpprolioliferferferfere atiatiatiatiation oon oo of of socsocsocsocss ialialial wwweveeveevevever,r,r, itititi isiss thethethe prprp oliolil ferferferf atiatiationonno ofofoff socsocococialialiallial

tttworworworwwo kinkinkinking sg sg ssg siteiteiteites ts ts ts ts hathathathattt ha haha ve ve vee lurlurlurlurlured ed ededdede us us ss intintintintnto ao ao aa

rrre ie ie iintintintintimatmatmamatate pe pe pe anoanoanononopotpotpototpop icaicacacai n in in iin wn wn wn wwhichichichicich oh oh our ur urr r

resresresresrr ponponnponp dendendenndencescescess ar ara a e he hhhhaunaunaunaununauntedtedtedtedtedtede by by by by by bb a a a a vagvagvaggggggue ue ueueu

linlinlinnlii g og og og of pf ppf pf paraaraaraaraararanoinoinoinoia ta ta ta thathatatatthatat My MyMy MyyySpaSpapaSpaS ce ce ce ce is is is fasfasfasaa t t tt

ccccccomiomiomiomiomommm ng ng ngg gggg ‘th‘th‘th‘th‘theireireireirei ’ s’ s’ sspacpacaaace! e! e! e!e! !e! In In InInII thethethethehtt oryoryryryoryr , t, tttheshesheshesh e se se se siteiteitetetet s s s ssss

ve ve ve thethetheheheh ve ve veveeeevery ry ry ry ry utiutiututiuuu litlittti ariariariariariiarir an an an anan aa funfunfufunfuufuf ctictictt on on ono of of offf allallalllallll owiowiowiowiow ng ngng nn

to to to oo comcomcomcomoooo mumunmunmununmunmunnmmmmm icaicaicaicate te te e te e mormormormorormorore ee ee ee effeffefefeff ctictictcctc vevelvelvelvely wy wy wwy wy wy withithithhthtith

ed ed ed ded d oneoneonenenonennes as a aas and nd nd nd nd nn frifrifrifrif iendendendendenden s. s. s. s. s.s. IncIncIncIncI rearreaare sinsinsinisinisinglyglyglyglyg yg , h, h, hh, , oweoweoweoweowooo eeverververvevervv , , ,

eeeee aw awaw aw aw aw aw awareareareeareaaaaa nesnesnesnesnessess ts ts ts ts ts thathahahathah ot ototottherherhehherherher pe pepepepeeoploploploplplo e ae ae aee ae aae aare re re rere reee sifsifsifsifsifsifssi tintintintiniing g gg

oooooooughughughughghugugugu ou ou ouu ouour pr pr pr pr pr pr pphothothothothohothhhhh os os osos ss andandandanddandanddd ‘s‘s ‘s‘s tattattattatt us us us ussu updupdupdupdupdupdddpdupdpdateateateateatetes’ s’ ss’ ss

uceuceuceuceucu es as as as aaas aa se se sese sesess lf-lf-lf-lf-lf--f concoconconconcconsciscisciscisciciousousousousousouss pa pap papaanopnopnopnonopticticticticticcict an an an aaan gazgazgazgaggg e e e e

tstststststts ow ow owow owowwn. n. n.n. n. nn. As As AsAAsAAs A thethehthethethet ub ububububiquiquiququiquuquq itoitoitoitoitoitoous us us usus uss us mobmobmomobmobmobmobmomoo ileileileileililile ph ph phoneoneneneone

mmmmmmmmmmmeraeraeeraeraeraere isisisis is is tete te te tetestististiististimonmomonmony: y: y: y in in in ininin in ththethethethetthet 21 21212121 21st st stst CenCenCenenturturturrury, y, y,y, y

reareareareareareasinsinsinnnsinsinsini glyglyglyg yg yg ou ouououu ouour sr sr sr r ssssr ociciociciocicocialalal aalal al a exiexiexieexixieexistestestestestest ncencencencenceee isis is is isi bu bu bu bu but at at at at aa pr pr prprprprprop opop op popoo

supsupupupsupsupsupus pppporporoporporpo t tt tt tt tt tthe he he hee verververererrrerv siosiosiosiosiosioon n on oon on on on on on on oon oonn f of of offf urur ur lifliflifliflifliflifffe we we weeee we pe pe projrojrojjrojectecectect

o co co cco cybeybeybeybeeeey rsprsprsprsprsprsprsprsppaceaceaceeacac . C. C. C. CC. Convonvonvonvonvnononversersrserssselyelyelyelyelyelye , w, w w, ww, we ce ce ce ccan an nannan anan argararrrargargargrggue ue ueueueee

t st st st sst st sstt st seeieeieeieeeeee ng ng ngng ng ng g anandandannd be bebebeebeingngingingiin se sese seen en enen hashashashashaha al al alwaywayways bs bs b bbeeneeneeneeeneennennenen

rimrimimmmrimrimmrimrrrriri aryaryaryaryaryryyyaryaryyyarararryyyy fo fo fofoff fo fo focuscuscuscucucuc offf ofof of yo yoyyouthuththuthuthuthhhhthuth cu cucucuucuuu cu ltultultultultulture.re.re.re.re.e.e As AsAs As A AsA Di DiDiDiD Di Dick ck ckckck ck c

bbbbbbbdigdigdigggdigdigdigigiggigdidigdigd e (e (e (((e (e e (ee e 19819819889888988198198898819 8) 8) )8) 8) 8)88)8) sugsugsugsugsugsssuggesgessssgesgesgegege tstts ts ts tst subsubsubsusubsubsubculculculcucuculcululturturtututurturuture ‘e ‘e ‘e ‘‘eee forforforforfforrms ms ms ms ms msmssss

thethetheethethetheth sp sp spsp sppspspspppaceaceaceaceacececeeacaaacaaaaa be bebebebebebebeebe be bbeb twetwetwetwewewewewewetweeenenen eneenen ennen sursururursursu veiveiveiv llallallallalal ncencencencencencecennnn an an an anannddd td ttd td td tthe he he he he he he he e

asiasiasiasiasasisiasiasiassias on on on on onononoon ofof ofof of of of ofofof sursursursursursusuusuu veveiveiveveeveee llallall ncencencecencencee, i, , i, i, i, i ,, tt tt t ttt tt tt tranranranranranranananana slaslaslaslaslaslaslaslaslaslslaslass testestestesteetesttestes thth thth thhe fe fe fe fe factactact

beibeibeibeibeibeiibeibeibe ng ng ng ng ng ngng ngn undundundundundndundundnderer eer e scrscrscrrutiutiututiiny nynyny nynyy intintntntintntntnnntintin o to too tto to to to thehe he heheheheheeehe he e pleplepleplelepleplpleppp asuasuasuas re re re of ofofof ofof

ng ng ng ngng ngggg watwatwatwawawatwa chechechechehhhecheh d. d. d. ddd It It It Itt is is is hidhidhidhidhidingingngingngngingng in in in in ininin th thththhhe le le le le le lighighighigg t’.t’.t’.

dddidisdisdddisdistintintinintinnnctctictictctctiiitctiiiiictc ooon on on on ooonoon betbetbettbetweeweewew n pn ppppublublublubllu icic icicii andandandandandand pr pprprpprprprprp prpr pr prrprppp ivivivaivaivaivaivavaivaivaivaivaivaiiv te te tete te to to totto to to too too

theththeeththehththet p popo popoopopointininnintintntntintnttinntnninintt wh w wh wh wh ereereereereereereeree we we weww ar ara e ie ie ie in dn dn dn dn dangangangangangererererer er er er er eerer er of of of fofoffoof of fof ofof ofooff loolooloolooloolooloolooloolool nsinsinsissinng g gg

a fa fffa fa ffunundundddundundu damaamamemmmemememeamamemaaaameama ntantantatatatal hl hl hl hl humaumauumauumam n rn righighghghight; tt; t;t; ; thethethethethetthhh ri ririr rightghtght to too

pripripripripripriprprr vvacvavacvacvav ccy? y? yy?y?y? y?y y? ? IndIndInnInndInIndInn eedeedeeed, t, t, t, t, hhehe he h pripripripp marmarmarmarmarararary oy oy oy oy ppoppoppooositsitsititioionionnnn f fo fooo foff r r

thethethethehethettheetth in ini ininini trotrorororootrorotrooddudducducdddududuucudduud tiotiotion on ooon on of Nf NNf Nf Nfff Nf NNatiatiatiaatiattta ononaonaononal Il Il Idendendentittittiti y Cy Cy Cardarardrdarddardddarrrddrdarrdardrds is is is is is is is is is is innnnnn nn n n n

202022200200000020 5 c5 c5 c5 c5 amaaaammemmmammememeeeaaamema fr fr rom omom om mmm m m m m m ParParParParPaParParParParParParPaPaPaParPaaParrPaPPa llllliaiaiiaiaalliilllial menmenmenmem t’st’sst s Jo Joooooointintintintintintintintntntntntntnn Co CoCCC Co Co Co Co CoCoCCoCoCCooommmmmmimmimimmmimittettetetetettettettet eee e

foforforfofforfoororf Hu Hu HuHuHuHHuumammmmamamanmananmaaannnmanmmmamm Ri R RiRi RiiRi Ri ghtghtghtghtghtghtghtghthtghtghtghthtghghghhg s ws ws ws ws ws ws ws ws ws ws wss wwss ww shoshoshhoshohohohohohh e me me me me mmmmmmmmmmmmme ainainainainainaininninaininain ar ar a aargumgumgumumgumgu eeententennttt

agaaagaagaagaagagaaaaa aaa ininininsinsnsinnsnn t ttt t tt tt ttt tttt ttt tttt hhhe he heheeehehehhhhehheehhhhhhe ssschschschschs hhhschsss emeemeemeemeemeemeemeemeeeememe wawawa w s ts tttts hathatatathat it it it iti co co cocoo ntrntrntrntrraveaaaveeavveaveeaveav nednednednedenedneedednednednednedeeeeeeddddd

ArtAArtArtArtArtAAAAArArttArtrttAA ticlciciciccliiciccclclliiicccliiiclllllle ee 8e 8e 8e 8e 8e 8e 8e e 8e 8eeeee 8ee 8eeeeee 8 ofofofofoooofofof ofoffofofofof oooofffoo ofooofofofofoooofofffofoffof thththtth t tttttththtthththththt e Ee Ee EEEEEe EEEe EEe Ee EEEEEEEEEe EEEEEurourourourourourourourourourourourourururouroururourourourourorururoororourorrrrurooururuu pepeapeapeapepeapeaeapeppeapp n Cn Cn Cn Cn Cn Cn Cn Cn CCn Cn CCCConvonvonvnvonvonvonvonvonvonvonvnvno vvvventenenentententenenenententenenteeeeeeentenentententntneenttttttionionoionionionioionionionononononnonnionoioooiooooiononioooooono on on on onononnoonnooonn on

HumHumumumummHummHumuuHumananananananan an an an aanan an nannanananan RigRigRigRigRigRigRiggRiRRRiggRigRiggRigR gRRRRiRR hhhtshtshhtshhhhhh : t: tttttttt: thehhe hhhhe hh rigrigriggriggghthththththt ht ht to toto to toototoooo o o rererereereeresesresrerrererr pecpecpecpecpep t ft ft ffororoor or oneoneoneoneone’’s ’s

‘pr‘prpr‘prppprprrivaivaivaivaivaivavaviivavate te tttetete tetete ete tteeeteteete ee ee andandandandandandandandanandddanandaandnaanddannd fa fa fafafa aamilmilmilmilmilmilly lyy ly ly ly ly ly ly ly ly ly ly lifefifeifeifeifeifeifefifeifeiif , h, hhhis isis sis homhomhoh e ae aandnnnd nd d hishishishh

corcorcorcorororcorcorrcoccocccc resresresresresesresponpoponononponponpoponpponp nppppppp denddeddendendendendendendendedendendendededenedeee cecece’ce’ce. I. In An Auguuguuuust st stt 220200200006 a6 a6 a6 annn an an aaarttitirtticleclecleclecle

in in in ininnnni TThe ObObsers rververr, G, G, GGabyabyaby Hi Hinslnslnsliffiffffiffiff hi hi hih ghgghlghlhlllg ighighighighightedtedededed a a aa arrrrrr

relrelrelrelelelelrele atiatiatitaaaa onsonsoononoon hiphiphippppp b b be be be b twetwetween en en NatNatNationionononal al allal al aal IDID IDD carcacarcarcarrds ds ds dds andaandanand a a aa

wiwwidwidwiddwidw er er errr proproprprrop jecjececjececjecect wt wt wt t wt hichichich h wh wh wouloulould ‘d ‘d ‘widwidwiddddden enen nnn sursursurveiveiveiveillallaal ncenncencence

of of of offooo eveeveeveeveveeeerydrydrydrydry ay ay yaay y lifliffififl ee be be be y ay ay allollollowinwinwing hg hg highighhhg -st-st-s-sststtreereeeeeet t t

busbusbusbusbussusineineineineineninessessesseses ts ts ttto so so so ssoo harharharharh e ce ce confonfonfn ideideidentintintialal al al infinfn ormormormormmatiatiit on on onon

witwitwitwitwwiw h ph phh pppoliololioolioliolice cece cce datddatddatd aabaabab sessessessses. . . By By ByBy intntinintintegregregrrrrrrratiatiatiatiing ng ng ng ngng ththethtthe witwitwittw hhh ph phh ppolioliooliol ceceee datdatatatdatatd abaabaabaabaabasessesses’.’.’.. ByByByBy intintintinntteegegregreggrrrrratiatiatiingngngn thethethe

biobiobiobiobioommetmetmetmeetmetmeetmm ricricricricricricricr c te te tete teeechchnchnchnchnolooloologiegiegieiees ds ds ds ds eveeveeveevev loplopoplopopopppped ededed ed ede forforforforfofooff th th ththtt e e eee

NatNNatNaaNatNatNNa ionioiiononioionnaal alal al al aaaa IdeIdeIdeIdeIdedeentintintintintinttn ty ty tyty CarCarCarrC ds ds ds schschschs hememeememeemeeemeeee wi wiw wi wi w th th thhh conconconconconcc sumsumsumsumuumerer er err

tetectectececttect hnhnohnohnohnonoohnon logloglogogogloggiesiesiesiesieseiesies li li liliike ke kke eke ke keeee stostostostostotstore re re rere loyloyloyloyloyyaltaltaltaltaltaltyyy cy cy cy ardardaaardaa s as as as as aaaaas and nd nnddnnn cacacascascascc h h h h h

macmmacmacmacmacmacm cccchhhihinhinhiinh es,es,es,ees,es,es,, po po po po po po pooollliclicliclilicliclice we we we we wwwwwwwoulouloulououlouououluo d td ttdd td td td hehehenhenheen be bebebebe ab ab aba le le le to toto to tratratratratratraatrack ckckckck ck

thththehehehehehehth ev eevev everyeryeryryydaydaydaydaydaydayyyayyd yyyayyy ac ac acacacacctivtivtivtivtivitiitii ii es es es eeee of of of of ofoo cricricricririic minminminminmmminalslalsalsalsals, s, s s, s, ssssuspuspuspusppspppectectectctcted ed ed ed eeed d

teteterertert rorrorrororrrorrististiisists as as as as as aaand nd ndnd nddd nddndn othooothotooo ersersersersrsers th t th th thttthhhat at at thethththetheey wy wy wy wy wwwy ishishishishshhh to totototottoo mo mo mo mommm nitnitnitnitnititi or or or

bybyy by y by byby byb insinsssinsinssstatantanntatanantatanna tlytlytlytlytlytlyytlyt id ididididid idddd id identententnteenen ifyifyfyyfyfyyyyyingingingingingginging th ththtthtt em em mmemem frofrofrofroof m ‘m ‘m m ‘m ‘‘m uniuniuniuniuniuniuniu quequequequeqqqu

mammmarmarmaraararmarrmarkerkerkerkerkererrkerrrs ss ss sss sss s s uchuchucuchuchchuchhhu hu h as asa as asa fi ffffifif ngengengengegengeengeeeerprrprrprprintintintnntntttts as as as as aaand nd nndndnd iriiririiis ps ps ps ps pppattattattaatternernernernns’.s’.s’.s’.’s’..

ThThTThiThihihhihhihis ss ss ss ss sssss oounounououno nnouounundsds ds ds ds s dsdsds lliliklikliklike te tte thehehehe he he stustussstustus uff ff f of of fffooo sciscisscisc encencnnnnnnnce fe fe fe e fficticttictcticctionionioniononio

butbuututututbubutbb un un ununnn unu leslesleseseslessl ss is is is is is is is t it it it iit it ss os os oss oppoppoppoppoppoposedsedseseese wi wiwwwwill ll becbecbecbeecomeomememe sc scsscscscs ienienieieenenencece ce e cecc

facfacacccacfaa t. t. t. t.t.t. t MorMorMororMorMMMMore re re re e e rreeeceeceecec ntlntltltllntlt y, yy, y, yy a ra rrepoepopopoee oe rt rtrt rtt by by bybbb TheThehehe Ho HoHHHoHHoouseuseuseuseeuse of ofof ofofof

LorLorLorororororLororL ds ddddds ds ddsdss s s CConCConConConConC stististstistist tutttututtuttutttutionionionionionnio Co Co C CoC mmimmimmmmimmm ttettettee ae ae ae rgurgurgurgurgurg es es sses thathathththath t tt

as as asasassas s asaass mamasmasasmasm ss ss sssssss ss ssurvurvurvuuuu eileileileileileille lanlalanlanalanl ce ce e farfarfaar fr frfrfrom om oomomommoo uphuphuphhuphupholdoldoldingingingggng

utiutiutiutiuttuuutilitlitlititlitlitlitl titarariaaariarariariaaaaaaa an an aan n n demdemdemdemeemed ocrocroc atiatitic pc pc ppc c rinrinrinrini cipcipcipcipc ppppleseseslesleel , n, nnegaegaegaagatetestestetes

ththethethethetthhehehethh m bm bm bmmmm y ey ey ey ey ey ey rodrodrodrodrroddingingingingg pr prppp ivaivavvaacy;cy;cy;cy;cy;y;;cy; un un un un un un uununu derderderderderminminmimiminm ingingggg

‘th‘thththheee ce ce ceee consonson tittittittt utiutiutiutiiutionaonaonaoonaal fl fll flll ffounounounounounouno dadaddatdatdattttionionionns os ooooooon wnnn wwn wnnn hichichicicch h hhhhh

demdemmdememdeme ocrocrcrcrcoc acyacyacyacyca an anan anaanand gd gd gd ggd gd oodoodooodoodoodo gogo goggogoooverververververeerernannanannannannnaa ce ce ce havhavhavavahh e e

tratrtratraditditditditittttionionoioo allallallallallly by by by by bbbeeneeneeneneneeen ba ba ba bba babasedsedsessedsedsed in ini in ini th th ththh ththisis iis is is coucouooountrntrntry.’y.’y.’’yy.y If IfIffIf If thth th the e e

rigrigrigright ht ht hht ht totto to to to o pripripripriprp ivacvacvacvacvacvacvvvavv y iy iy iy iy iy is ds ds ddddddenienienienienienied,ed,ed,ed,ed,e thth th then en en notnotnononnono on only ly yyyy wilwiwili l l l

thithihihithis cs cs cs cs onfoonffnfirmirmirmirmrm th tht th ththhhe Ie Ie Iee Ie Innfnfonfonformarmrrmamamam tiottiotiotiotioooon Cn Cn Cn CCommommomomomo mississssionionionooo er’er’er’s s s

sussussussuuuu picpicpicppi ionionionn th thththth thtt at atttat ata BriBriBBriBriBBBBritaitaitaitaa n hn hn hnnnnn as as asassas bbecbecbecbbecomeomemomom a a

sursurusuuu veiveiveveiveillallallallancencencencence so so sosociecieciecieci ty tyty ty ty butbutbutbutbutb al also so givgivgivgivive pe ppe proproppro hethetethhehe ic ic ic

crecreccrecrerecrecredendendendendedendencece ce ee to to tottoo OrwOrwrwOrwrwellellelleellll’s ’s ’s ss s visvissiissionionononi , b, by py py py py aviaviaviv ng ng ng thethetheheee wa wa wawawa wayy yyy y

forfororrforforofoo aa a a a tottottottottottotalialilaal tartartarttta ianiananianianianan popopppo pop pppolicliclice se sse stattattate. e.e.e. e

BevBevBevvis is is FenFenFene nernerererrer

rother Future fears

14 MediaMagazine | December 2009 | english and media centre english and media centre | December 2009 | MediaMagazine 14

Hollywood stars are the stuff that dreams are

made of. This central idea is the driving force of

the film industry. The multi-billion pound industry

is dependent on the creation of an elite ‘A’ list

of stars that somehow sparkle more brightly

than ourselves, drawing us in to the darkened

cinema space to watch their epic adventures.

They embody some central core of masculinity

or femininity that fascinates the audience. If we

examine two young male stars, such as Joaquin

Phoenix and Heath Ledger, we can see how

stars often attempt to create epic narratives with

their lives. With Heath Ledger’s tragic demise

and Joaquin Phoenix’s career meltdown, these

narratives can have a dark and deadly side.

Stars have always attempted to construct epic

dramatic narratives from their ‘real’ lives. Since

James Dean’s wild car-racing ways, some stars

have always had a fascinating ‘second life’ off

screen. The star will become embroiled in affairs

with men or women, will possibly be arrested,

may marry and divorce; the narrative unfolds

in newspapers, magazines and the web. Kiefer

Sutherland, Brad Pitt and Mel Gibson are other

classic examples.

Joaquin PhoenixOn October 27th, 2008 the established

young star Joaquin Phoenix announced he

was retiring from acting and Hollywood to

begin a new career as a Rap artist. He was a

macho star who had earned his place in the

Hollywood pantheon with several star turns

in films. His spectacular fall from ‘Stardom’

amazed us all. Phoenix started to grow a

huge beard and began to look dishevelled.

For Media students, this ‘car-crash’ spectacle

is fascinating as it deconstructs a major star

before our eyes. He continues to pursue a

rapping career and looks worse day by day.

In August 2009, Phoenix was reported to

have bought a black velvet cape and mesh

top in an L.A. store and began rapping in the

outfit before dumping his old clothes in a bin

outside. Pursuing a Rap career was a direct

challenge to the Studio and the producers

behind Phoenix’s last film Two Lovers. The

film did badly at the box-office and did some

collateral damage to the reputation of his

alteration of his facial expressions due to his

mental state. He was dysarthric, a specifically

thick tongue that again is difficult if not

impossible to mimic. And finally there was

severe motor slowing which is a yet another

feature of intoxication or a severe psychiatric

condition such as depression

If this is acting, hats off. But I have grave

concerns that we are seeing something far more

serious. If I am correct we can only hope he gets

the help he needs before it is too late. ‘

Joaquin Phoenix, brother of the late River

Phoenix, is no stranger to controversy. After a

breakthrough role as a James Dean type troubled

teen in Gus Van Sant’s To Die For (1995), he

went on to portray the cruel Roman emperor

‘Commodus’ in Ridley Scott’s Gladiator (2000). In

2005 he was nominated for the best actor Oscar

for his star turn as Johnny Cash in Walk The

Line. In the company of Heath Ledger and Phillip

Seymour Hoffman, Phoenix had the world at his

feet, or so you would think. Phoenix attempted

the unthinkable, however. He attempted to

redefine his representation and explode his

stardom.

With Ben Affleck’s brother, Casey,

documenting everything on video, the possibility

co-star, Gwyneth Paltrow.

Career suicideHis talk-show appearance on The Late Show

with David Letterman was the worst, (or most

amazing), appearance by a star on television.

Promoting the film Two Lovers, Phoenix began

the interview badly. Before continuing this

article, visit the YouTube clip of this career suicide

Letterman appearance at: http://www.youtube.

com/watch?v=HXpYk7WGN5Y. Monosyllabic

and incoherent, Phoenix’s appearance has

become so infamous as to be mocked at the 2009

Oscar Ceremony by Ben Stiller.

An American Psychologist, Dr Drew Pinsky

analysed Phoenix’s performance on Letterman

and told the website ‘RadarOnline’:

I understand that there is speculation that

he may have been fulfilling the role of a

character for a mockumentary. I maintain

an open mind and hope that this is true but

I suspect something much more serious.

It is impossible to fake flat affect. Notice

that his facial expressions are not still (as

an actor would portray in trying to recreate

this experience) but rather one can see

what we call flat suggesting a physiological

Playing with PersonasHeath Ledger, Joaquin Phoenix & ‘Real’ Life


prank, playing a game with the Media. In an

extraordinary web-site dedicated to finding

footage for this documentary JoaqDoc.com,

Casey Affleck has created a site that allows users

to upload their own videos of Phoenix rapping

on and off stage. The nature of the documentary

that Phoenix and Affleck might have in mind can

perhaps be interpreted by the rather extreme

legal consent that uploaders to the site have to

agree to:

By posting any content, images, photos,

video, sounds, profiles, works of authorship,

or any other materials (collectively,

‘Content’) on the Website, you hereby grant

to Flemmy [Affleck’s production company],

a non-exclusive, fully-paid and royalty-

free, worldwide license (with the right to

sublicensees) to use, copy, modify, adapt,

translate, publicly perform, publicly display,

store, reproduce, transmit, and distribute

such Content in any and all media and by any

means now known or hereafter devised that

Flemmy, in its sole discretion, shall deem

appropriate.

Whether Joaquin Phoenix is pretending or not,

film industry commentators suggest he may have

killed his career or at least killed the idea of the

‘star’ Joaquin Phoenix.

Heath Ledger Heath Ledger was a mercurial star in the

Hollywood firmament with potential to be one

of the all time greats. His drug death at the

age of 28 was shocking and brutal, ending a

career that had seen him defy categorization

and win a massive audience following. Ledger’s

performance as ‘The Joker’ in The Dark Knight,

eclipsed Jack Nicholson’s previous attempt at

the character and has become a popular cultural

phenomenon. T-shirts and memorabilia are

emblazoned with his painted face and internet

chatter on Ledger’s ‘Joker’ is unprecedented in

film history. Blurring the line between stardom

and reality, Ledger was a man of extremes,

taking his performances to heart. There were

some macabre similarities to the death of River

Phoenix, Joaquin Phoenix’s brother. On October

30th 1993, aged 23, he overdosed in ‘The Viper

Room’, a nightclub on Sunset Boulevard owned

by Johnny Depp. Joaquin phoenix made the 911

call for his brother.

Heath himself described the Joker as:

a psychopathic, mass-murdering,

schizophrenic clown with zero empathy

… I couldn’t stop thinking. My body was

exhausted, and my mind was still going.

He died of a drug overdose in New York on

22nd January 2008, cutting short a potentially

prolific career, with some speculation that the

role of ‘The Joker’ had pervaded his ‘real’ life.

Ledger had shown star quality in a range of

genres, in movies as varied as 10 Things I Hate

About You (1999), The Patriot (2000), Monster’s

Ball (2001) and A Knight’s Tale (2001).

His career high point arguably was Ennis Del

Mar, the emotionally terse ranch hand he played

in Ang Lee’s Brokeback Mountain (2005), for

which he earned a lead actor Oscar nomination.

With acclaim and industry kudos, Ledger had,

ideas on a fresh portrayal of the iconic Batman

villain. His total immersion in character on and off

the set is well documented, with Christian Bale,

(Batman), noting that:

He was somebody who immersed himself

completely in his role — absolutely.

For cinema lovers everywhere, the images

of the cracked white pancake makeup, black-

rimmed eyes, smeared lipstick and greasy,

greenish-tinged hair are seared into our brains.

Ledger’s manic, evil, chaotic Joker was a fatal

element to seep into Ledger’s persona. He was a

M– ethod actor who continued in character even

after filming. This type of ‘Method’ acting can be

dangerous for some fragile actors.

The curse of ‘ The Joker’Heath Ledger was always extremely ambitious

and keen to develop a unique place in the

Hollywood and acting fraternity. This attempt to

manipulate his representation echoes Joaquin

Phoenix, as Ledger was intent on avoiding being

typecast. In taking on the role of ‘The Joker’,

Ledger was well aware of the giant shadow of

Jack Nicholson on the role, but wanted to dare to

redefine himself and the iconic villain. Much has

been made of Jack Nicholson’s comments on the

death of Ledger – ‘I warned him’. This was not a

comment on the curse of the role but a reference

to his warning on prescription sleeping drugs

that killed the

young star. As art

mirrored life and

the epic narrative

of Ledger’s real

life veered off into

sinister territory,

sleeping tablet

addiction killed

the dream.

As David

Thomson noted in

The Guardian:

For good and ill,

early death can

lead to mystery

which is in turn

‘answered’ by a

cult-like legend.

We may yet

have to hear a

lot more about

Heath Ledger

than we care

to believe. He

may even be a

role for some

other promising

young actor. The

show business

devours its own

creations.’

The show-

business may well

have devoured

Joaquin Phoenix,

or maybe, he

will return to the

Affleck’s documentary is a clever expose of the

cult of celebrity and the impossibility of labelling

Hollywood artists. This is a complex and difficult

task, but one which Heath Ledger would surely

have applauded. The epic legends that film stars

attempt to construct can sometimes be their

undoing, however. The narcotic abuse in Joaquin

Phoenix’s background does not bode well and

the Letterman interview suggests problems.

From a Media Studies and Film Spectatorship

perspective, the spectacle continues to fascinate

and mesmerise us.

Sean Richardson is Head of Media Studies at Penistone

Grammar School, near Sheffield.


The Boo Radley ParadigmTony Gears explores the insights that a literary character – Boo Radley from Harper Lee’s 1960s classic To Kill a Mockingbird – can offer into the ways reality TV represents ‘otherness’ and vulnerable people.

In the novel To Kill a Mockingbird, Arthur ‘Boo’

Radley is described by Jem as:

six and a half feet tall, judging from his

tracks; he dined on raw squirrels and any cats

he could catch...There was a long...scar that

ran across his face...his eyes popped and he

drooled most of the time.

Not surprisingly the children are intrigued,

scared and entertained by this figure and so wish

to stare at his house in the hope he will come

out. Modern TV has made that more and more

possible! This TV version of looking out for the

weird people in society is what I have termed the

Boo Radley paradigm.

The Boo Radley paradigm is a way of

understanding the phenomenon of ‘hyper-reality’

TV where the ‘Uses and Gratification’ (Blumer &

Katz) to be gained from the programme are, (and

I apologise for the deliberate un-PC aspect of my

language here), ‘to watch the local loony’, both

for entertainment, social interaction and personal

identity reasons, making us feel better about

ourselves. We see this regularly in such shows as

The X-Factor and Britain’s Got Talent/America’s

Got Talent, Big Brother and so on. There is a clear

link to the concept of car crash TV.

The appeal of Nadia Almada who won Big

Brother in 2004 was that she was a transsexual;

that of Pete Bennett (who won two years later)

that he had Tourette syndrome. Vulnerable

people have appeared, sometimes with

distressing consequences, on virtually all the

reality TV shows because audiences like to see

And like Boo, the hyper-reality dominates, as

we both fear and yet voyeuristically want to see

these people, de-personalised and distanced

from us. How many people remember their

real names? Take the ‘Bonfire Night Man’ from

X-Factor for instance; or the ‘Chicken Man’. How

many people remember Boo is actually named

Arthur?

Marketing issuesAnushree Chandran writes in Marketing and

Media for the Wall Street Journal (Can edginess

and voyeurism continue to save reality shows?)

clearly makes the marketing issue a priority

concern since TV companies are relying on

New levels of edginess . . . seen as a way to

refresh a cluttered genre where every big

success spawns me-toos

Media agencies such as Madison

Communications cited by Chandran choose these

shows on their ‘controversy’ levels, which may

obviously colour media planning and buying

decisions:

Non-fiction is an area where one can afford to

explore and experiment because the viewer

is evolving.

The ‘Boo Radley Paradigm’ allows for such

planning, but diminishes the more negative

feedback that could come from courting too

much controversy – as in the Shilpa Shetty/Jade

Goody situation, which brought much criticism of

Channel 4.

Sharda Chhetri (Reality Voyeurism 2008)

makes the very clear point that ‘the participation

of emotionally vulnerable people holds the

potential for more entertainment for viewers.’

And the Able_Here_Team, a site for the

disabled, points out that ‘TV producers introduce

more vulnerable people to pull in jaded viewers’

A union official from the Actor’s Union, Equity

(Sep 16 2009) is reported on the ITN website as

stating that such programmes:

are based on exploitation and humiliation

of vulnerable people, which cannot be

acceptable

If we take the example of Susan Boyle, who

despite learning disabilities wowed audiences on

Britain’s Got Talent and YouTube, we can clearly

see the paradigm in practice. Susan, 48, lived

alone with her cat, ‘had never been kissed, and

was teased by children in the street.’ As one critic

writes:

modern TV talent show. It gave producers the

chance to wind-up the viewer’s expectation

that Susan Boyle was another ‘pathetically

deluded’ individual who wanted to be a

‘singer’. Cut to sneering audience, cynical

judges and Ant and Dec waiting to lead the

mocking abuse meted out to all those that

don’t share Susan Boyle’s happy ending.

(Ricky Gervais, Susan Boyle and the Victorian

Freak Show 09)

But she was sold to us, the audience, by the

TV producers and the media at large as the UK’s

next singing sensation. From her first appearance

she fitted the bill as the eccentric loner. The fact

that she could sing a little only added to the

fun. There can be little doubt that her attraction

was that she was ‘odd’ in her behaviour; but

because she has some talent, she gained national

recognition since we could both laugh, pity and

be in awe all at the same time. Other ‘odd’ people

are frequently brushed aside, despite their often

tragic back story.

Jo Hemmings , a behavioural psychologist who

has assessed psychometric testing on Big Brother

is quoted in The Guardian as saying:

People watch reality TV because it is car-

crash TV. It is unpredictable and that is why

people enjoy it. However, I don’t think people

enjoy seeing people fall apart emotionally or

psychologically...

TV producers may claim they are empowering

these participants (and audience) but I would

argue they are much more cynically using the

‘Boo Radley Paradigm’ as a marketing strategy

which re-enforces the notion ‘look how much

better you are, or better off you are, than them.

Andy Millman, played by Ricky Gervais in Extras

states:

The Victorian freak show never went away,

now it’s called Big Brother or X Factor where,

in the preliminary rounds, we wheel out

the bewildered to be sniggered at by multi-

millionaires.’ (The Extra Special Series Finale)

One critic of this year’s X-factor notes on a

website ‘What was previously a glorious exercise

in embarrassment and awkwardness is now little

more than an endless stream of show-offs and

weirdos.’

This issue is highlighted quite clearly in The

Guardian’s ‘OrganGrinder’ Blog:

The opening episode pulls out all the stops

to make sure you continue in your quest to

mock the pathetic, offering an ample fix of

the stupid, the mundane and the talentless...

In case you forget to laugh, Ant and Dec are

there to help you ‘take the mickey’.


Originally hilarious this show

has now degenerated into

exploitative TV at its worst.

Some of the ‘pre-screened’

contestants are clearly

mentally ill. It is like laughing

at the lunatics in Bedlam...

(But I do)

Of course the desire to watch

the lunatics is nothing new and goes

back to the 18th-Century custom for

the idle classes to visit Bedlam Lunatic

Asylum and observe the antics of

the insane patients as a novel form

of amusement – as graphically illustrated by

Hodarth and others.

The question is how far the ‘Boo Radley

paradigm’ will go. What are we to make of

Britain’s Missing Top Model in which eight

disabled women are pitched against each other

in a battle for a prize of a fashion photo-shoot to

be featured in a top women’s glossy magazine?

There is little doubt that increasingly reality

TV programmes are exploiting the disabled,

the vulnerable or the distressed to bring in

viewers. Big Brother’s clientele became more

and more eccentric over the years, as did the

tasks they were required to perform. X-Factor’s

move to present their auditions in front of a live

(baying)audience is reminiscent of the Roman

amphitheatre and the chosen ‘victims’ (who

having already been through two auditions to

get this far, and being encouraged to believe they

have a chance) are ‘thrown to the lions’ of boos

and chants of ‘off, off’, much to the delight of the

TV audiences as they enjoy the discomfort of the

‘local loony’, either through laughter or pity.

Boo Radley docsWe see the Boo Radley paradigm at work

also in documentary programming, where

mental illness and disfigurement have become

increasingly ‘freak show’ in nature. Noting

this one critic writes that these ‘exploitative

documentaries’:

…are disguised as ‘human interest’ stories

or ‘factual documentaries’. Whether it is

documentaries about the incredibly fat, or

a man who eats badgers, TV producers are

instinctively looking for the next weirdo they

can stick on TV to be stared at by millions in

the comfort and safety of their own lounges.

(Ricky Gervais, Susan Boyle and the Victorian

Freak Show)

In a survey conducted by the Voluntary Action

Media Unit the reasons for these documentaries

was seen by the clear majority as being ‘for

shock value, to increase viewer ratings and for

entertainment purposes.’ Some went a lot further;

one disabled user from the BBC’s disability site,

Ouch! noted:

They are fetishistic and parasitic. Made by

ghouls who think they can parade disabled

people for money like they used to in Bedlam.

Jo Hemmings believes that:

It is wonderful to open up these

opportunities, but if you are going to do that

there is even more of a duty of care.

Nevertheless, amongst the majority of

respondents to the survey there is still a clear

feeling, despite the huge number of negative

comments about such programmes, that they

should be shown on TV.

I would argue that it is clearly better to see

our Boo Radley in the flesh than hide them away

from view and that any kind of representation is

better than none at all. But as one writer adds, if

the vulnerable ‘are required to do things which

in anybody’s book are extraordinary, viewers will

therefore regard them as extraordinary people.’

Hegemony and the Boo Radley paradigm

The paradigm is not only extant in current

media texts like the X-Factor, but also may be

reflective and suggestive of a broader current

social malaise. One could argue that this ‘sickness’

is represented not only in reality TV, but also

in moral panic news items about society and

culture – youth, drugs, knife crime, the inner

cities etc. – wherein the imagery and texts

presented are a vicarious thrill for audiences and

are hegemonic in nature as they help reinforce

social strata and codes sublimating any real

suggestion of pro-active change. The idea here

is less simply about ‘marketing’, and more to do

with deliberate manipulation. If we are looking

at the world through the mediated ‘reality eye’ of

TV and the media, observing in a thrill-seeking

manner the ‘bad behaviour’ and so on, we are

less likely to actively pursue solutions. In terms of

theoriginal premise of To Kill a Mockingbird and

the analogy, by keeping us focussed on the ‘Boo

Radleys’ of society, we are less likely to see the

corruption of racial injustice or other social issues.

(Jan Pinsler, Power and Hegemony in Reality

Crime Programmes 2007)

Crime-appeal programmes successfully give

the impression that they defend universal rights

even though they in fact defend specific rights,

especially the right to private property, which is a

precondition for a capitalist society.

The paradigm is, of course, like hegemony

itself, not forced upon us but achieved through

consent. Programmes are designed to draw us

in through our own psychodynamic egotistical

and other weaknesses. If it is okay to laugh at the

vulnerable to make us feel better about ourselves,

then we will not look too closely at why we were

not happy with our lives, and the status quo will

be maintained.

A research team led by Professor Beverley

Skeggs (Making class and self through televised

ethical scenarios) considered the role of the

media in contemporary identity formation, and

how class is being re-made in the contemporary

culture. It concluded that:

Middle-class participants thought television

exploited uneducated vulnerable people,

yet maintained that participants were a

particular type of person – ‘desperate for

celebrity’, ‘generally trashy people’.

It is obvious that once such a majority

view takes hold, and becomes a ‘dominant

ideology’, it is accepted as the cultural viewpoint.

The minority who disagree with it then tend to

keep their objections quiet, or are simply ignored

or laughed at as ‘out of touch’ or taking it all too

seriously. Hegemony is about consent, and one of

the things it consents to is inequality.

Tony Gears is Head of Media at Bigglescliffe School.


‘I Don’t Need A Man’ (or do you?)

I see you looking at me

Like I got something that’s for you

And the way that you stare

Don’t you dare

‘Cause I’m not about to

Just give it all up to you

‘Cause there are some things I won’t do

And I’m not afraid to tell you

The music video is a medium that gives you

reality and fantasy in one swoop. It is a platform

where you are made to believe anything is

possible. Its aim is to capture the attention and

the imagination of the viewer, and to hold their

attention for a good three and a half minutes.

To achieve this, its subjects of music videos are

gorgeous, glossy and successful; you want to

be or be with them (depending on your gender

and/or sexual orientation). Its main storyline

usually revolves around sex because sex sells.

This means that song lyrics can contradict the

content of the actual video ie: even if the song

itself is nothing to do with sex the video will be.

In this article I will look at the portrayal of women

in music videos and will be focusing on the core

messages and values conveyed in ‘The Pussycat

Dolls ’ ‘I don’t need a man’, which on the radio

translates into a liberating female anthem, while

on screen it connotes the worst kind of sexual

objectification.

The establishing shot thrusts us in to a pink

world and introduces a blonde pussycat doll in

black bra and skirt. The exciting jump cut makes

it hard to focus on one particular subject. The

kinetic camerawork dominates the performance

and brings energy and dynamism to the stage:

we are drawn in immediately. A dolly shot (in

every sense) then introduces Nicole (the only

member most viewers can name from the group:

so much for girl power!) who begins the song

‘Now you looking at me like I got something

for you’ as the lens zooms in and out – like she’s

teasing you in and then kicking you away. The

camera intersperses Nicole’s moment with a close

up of blonde pussycat leaning down putting on

toe polish against a pink/black background with

the diegetic ‘Uh-a-woo Uh-a woo’ blasting us into

a world where hairdryers, lipstick and legs rule.

We seem to be in a beauty salon where the girls

are dressing up – the implication being they are

doing this because they are confident, strong

young women and they are not doing this for any

man, hence in comes the title. The pink and black

colours which provide the backdrop connote

femininity and sexual power.

We briefly get a close up shot of pussycat

blonde while Nicole delivers the lines ‘Just give it

all up for you/ Coz there are some things won’t

do’ A few extreme close-ups of Nicole break up

the beauty salon. More hairdryers and towels

fill the screen and more leg becomes on show.

The bras are on and showing; these girls mean

business.

We then cut to the back seats of the beauty

salon where the dance routine/lip synch number

which is flawless and smooth (like the girls’ legs

which are the focus of a number of close-ups)

and we see the group of girls simultaneously.

They form a line, they are a unit as they sing the

hook ‘I don’t need a man...I get off being free’

whilst most of the girls expose their knickers to

the camera.

We then cut to a silhouette of one of the dolls

– unmistakably Nicole who is getting undressed

to capture and excite the male gaze. ‘I’ve bought

my own life and everything that’s in it’ she sings

whilst she touches her boobs. We then cut to

blonde pussycat in the bath, shaving her legs

and reaching out. The background colours

then change to white, black, pink and blue as

the dance routine is performed, then to black.

Against the background, Nicole becomes the

subject of an extreme close-up. ‘I get off on being

free’ she sings as she strokes her body and plays

with her hair. This is interspersed with a high-

angle shot of brunette pussycat, who looks like

she could be in the shower.

Again we return to the rest of the girls putting

on make up, shaving their legs and spritzing

perfume (with the label reading ‘girl power’.) The

brunette pussycat takes of one top for another

with the words emblazoned upon it ‘I don’t need

a man’ again reinforcing the message of the song

in case as an audience we had been distracted by

a flutter of lashes, breasts and lipgloss. We come

to the crux as the drums play on the soundtrack

and purple confetti falls down over the dolls. The

dolly shot presents the girls in a row – they are a

‘unit.’ The girls again hug at the end and punch

the air, signifying their female solidarity.

The inherent fiction in this video is that women

are strong: we can wear what we like, put on our

make up whilst we sing confidently in the bath

tub. We are bombarded with so many images of

sex that you forget the original premise of the

song, but by that time the catchy tune is in your

head and the messages have become blurred.

The reality is somewhat different – these girls

can sing all they like about female empowerment

but if you break the video down you can see

that these girls are the product of a sex-driven

and highly sexist music industry. As artists these

women need the male gaze (and the offer of

female identification: I too can be these girls) to

sell the huge amount of records that they do.

Sadly, if there was no flesh on show in this video

and it fitted in with the progressive lyrics of its

own song then I doubt it would have made a top

ten hit.

You Tube comments of the video are mainly

supportive: Mirror image comments ‘They’re just

showing how strong women can be without a

man in their life. Strong, confident girls – that’s

what I’d call it.’ Many female viewers agree that

Nicole et al are feisty, feminist felines to many.

And if the video has this effect on female viewers

then the video directors have achieved their goal.

The main demographic of music video viewers

is mainly 13-24 and largely female. The Pussycat

Dolls’ videos attract both sexes to capture a

bigger portion of the music buying market. Some

of their videos could be classed as soft porn. ‘Girl

power’ has taken a backward step. Instead of

growing up it has turned in to ‘doll domination.’

What the producers of these videos do though

are very clever: these raunchy videos are bundled

up as feminist anthems, as confident assurances

of female power, of strong catchy hooks so both

sexes will be drawn into the video and therefore

hum the record and buy the single. Their market

is teenage girls and men – just look at audience

members at their concerts! They are dolls (for the

teenage girls) and dominating whores for the

male market. The Pussycat Dolls can pretend to

themselves and their audience that they are all

powerful but this so-called power has no value

in the real world: sex sells and the pussycat dolls’

success (literally) embodies this.

Emma Clarke is a recent graduate from Sussex

University who is now working in Brighton.

1118188888 MMeeddddiidiiaaaaMMagga ga azinazinnnnninninnnineeeeeeeee | D| DDD| D| D| D| D | D| DD | Deceeceeceeceeeemeececee ber r 22200200000090009220200009009900092 022 |||| || engglengengengengngenggg isish h aaand meededidiaaaaa ceaa ceaaaaa nnntttrent

g gg

a wa wa waa a a wa wwww oorlorlorld wd wwwwwwwdd wwwwd wwd wwhheerh rhererhere e hairaaiaiaiririraaira rririrrdrydrydddryryydrydrydryydrdryryrydrddryyersersersersersersersserererr , , l, l, l, l, lipsipsipipsipspsipstictictictict ccccccccckkkk ak akkkkkk ak ak ak ak anndd ndnddd nnd nd leggleglegsss s rsssssss uleulelllleleeeuleleuleeeee. .

We We WWWWeeee eWeWWWW seeeeeeeeess mmmmm tmm o bbbe iiiiiin n an a an an beaaututyyy sy sy sy syyy ssalalaalalaloalaaa n n where eeee te heee eeeeeee eh girrg lsls ls ls lssls sls s ss

areaareare drdrdrdrdrdreeeesesse iing uuupupupupup – – – – ththththhheheheheheehhthe imim im imimmmmi liliplipliiplipplippliplipliplip ccacacacaaatcacaacaa ionnnnn be be bbebeeeiiinginginginingngng thth thththttht eyeyeyyyyeyyyyeyyy yyy eyyyyyyy y are

p p

doldolllddddodddolddodooo lylyly lyly lyly hhhhshohohohohohohot pppppt ppptt t pt t t pt rereresresrrr entents ts the he girgirllssss s ssslls in in aa ra row w w ow – t– ttthhheyheeyeyeyeyyhehehh ar ar ar ar arre ae ae ae ae ae a

‘un‘unn‘unnit.’ T’ TTTTTheeeeeeehe he hh girgggg lss s agaaaaagaaaaaaaaain hugggggggg at attttttt ttthth th th ththe eeeeeeee ndnd dd dd d d aandndandandandndanda p pppupuppupupupp nchnchnchnchnchnchncn

thheeeee air,r,,, , sigsig ififnifnifyinyinggggg tg tggggg heir feeeemaemaeee le le e ssoolsso idaaaritrity. y

pp yyy

sucsucsucsucsucucssucsuccuccsusuccescescescescescescesccescceess (s (s (((s (s ss s ((ss litlitlitlitlitlitlil eraeraeraeraeraereereraeraerrerere llyllyyllyllylyyylllllylyyylyyyyyyy) e) e) e) eee) e))) mbmmmbmbbboboommmbbb ddiedieees ts ts ts thisshhih .

EmEmmmmmmmmmmmmmmma Caaaaaaaaa laaarararararkekkekkkeke kk is a ra raa reececeeee nnt nnt gggragggggggggg ddddduduad tee e te ffrrroof m m SSSSSSSusssu exxxxxx exx

Unniiiiiiiiveveveveveveerevere sityy wy wy wy y wwwwwy who iiiiiss iii nnnnonowown wwooooworkiinnnnng nn ininn n BBBBrriighhttoonoon.o

english and media centre | December 2009 | MediaMagazine 19 engenglengnglengengengengeenenengeneenengengeeeeeenngnngngngg ish ish ish aaa

If you liked this you maybe wasn’t cool when

you were younger. These guys are trying to be

great but are eventually not

Damon Beesley writer of The Inbetweeners

The ‘Inbetweeners’ are a social class of

teenagers that are not cool enough to be

popular but not geeky enough to be nerds. The

programme demonstrates this perfectly when

the main characters manage to get themselves

a car but it is a yellow Fiat with a tape deck and

when they dare to play truant from school they

end up drinking Beefeater Gin and Drambuie

in one of their parent’s houses as opposed to

hosting a cool party a teen would be proud of. In

their quest to fit in, things for the Inbetweeners

very rarely go to plan.

The lead character and narrator of the

programme is Will, who after the divorce of his

parents, is enrolled in the local comprehensive

after having to leave the private school that his

very attractive mother can no longer afford.

The contrast between Will and that of his new

classmates is clear and makes for some witty

observational insults from his fellow pupils

‘briefcase twat.’

A lot of the action takes place at the Rudge

Park comprehensive as the characters are

studying for their A Levels in various subjects. The

sixth form is suggested by the programme as a

place where you can reinvent yourself after the

trials and tribulations of 11-16 education and we

are shown the shows characters attempt to do

exactly that.

Storylines deal with the ordinary things that

people of this age stress over: fancying someone

of the opposite sex and trying to attract them,

fitting in with friends while trying to stand out

from the crowd and the ultimate of the age:

trying to get served in a pub. These are things

that all of us can identify with but are only funny

when you are looking back or they are happening

to somebody else.

This is a comedy programme that also touches

on some surprising, unusual and unexpected

events including the assault of a disabled girl

with a Frisbee; having everyone staring at your

erection in the common room; getting drunk and

declaring your love for a girl and then throwing

up on her younger brother and telling the

barman that all of your classmates in the pub are

underage: real social faux pars for this age group.

At times it makes for uncomfortable viewing,

the show has a way of making you feel the

characters embarrassment until you remember

that you didn’t actually do it, relax and then

enjoy it for making you cringe.

In terms of realism, some incidents have

happened to many of us; some incidents could

happen to some of us and certain situations are

unlikely to happen to any us but we fear them

all the same. The latter of these situations tend

to be the nightmare climaxes to the shows and

act as a catharsis for all of the nervous tension

that we have built up from being teenagers

ourselves and from watching the programme.

A target audience for The Inbetweeners could

be derived by the fact that it was specifically

produced for E4 which is aimed at the 15 – 35

audience and written by contributors from the 11

O’Clock Show and Peep Show. The programme

certainly managed to reach this audience as it

was nominated for a Bafta for Best British Sitcom

(eventually losing out to the IT crowd) and the

third series has just been announced with an

American version in the pipeline. Funnily enough,

whilst it featured a young cast set in a school the

first series carried an 18 certificate, an indication

of the sometimes shocking nature of scenarios in

which the characters find themselves.

‘The Inbetweeners production can be followed

outside of the programme also, for those of us

that are used to interacting with programmes

and features on the internet. The show’s website,

hosted through E4, allows us to get closer to

the characters and the actors playing them

along with reliving some episodes under the

title of ‘Watch Them Fail’ and listening to the

contemporary music that is played during each

of the shows, titled, ‘Soundtrack to Their Painful

Lives’.

Whether you are looking back at your college

years or looking forward to them, this show

presents us all with a normal characters that

could have made the same mistakes as you and

had the same aspirations and insecurities that

you had, which is both comforting and reassuring

to know and laugh along with.

Robin Makey

Being Being Normal

and ndd dddd dddndddddddd medimedimedimedidimedieddedidia cea cea cea cea ceea cea ceeentrentrentretretrentrentrentre | D | D| | D | D| DDDeceeceecemecemmmmececeemmmmmber ber ber erber berbereerr ber e 22002002002009090009090999090990909009099200099200090909900090090992002 09902 00909 | |||||| | | | ||| || | MediMediMediMMedMediedididiiiediMediMediMMedMMediMediMMMediMediMMedMediMeediMediMediMediMeMeMediMeMediddddMedddMeediMedMediMeddMediMedMedidMMeMediMeMeMeMeMediM diMMMM aMaaMagaMagaMagaMaMaMaaMagaMaggaMagaMaggaMagaMagaMagggggaMagggggaMagaMaggggaaMaMaMaaMaMa gaMaMa gaMaMMagaaaMaMaaaM ggazinazinaazinazinaaaa iinininazinzi eeeeeeeeee 191991999191999199911

Reality goes online - Guernsey Grammar School

Documents

Transcript of Reality goes online - Guernsey Grammar School