Profound Prevention of Experimental Brain Metastases of Breast Cancer by Temozolomide in an...

2014;20:2727-2739. Published OnlineFirst March 14, 2014.Clin Cancer Res Diane Palmieri, Renata Duchnowska, Stephan Woditschka, et al. Cancer by Temozolomide in an MGMT-Dependent MannerProfound Prevention of Experimental Brain Metastases of Breast

Updated version

10.1158/1078-0432.CCR-13-2588doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2014/03/14/1078-0432.CCR-13-2588.DC1.html

Access the most recent supplemental material at:

Cited Articles

http://clincancerres.aacrjournals.org/content/20/10/2727.full.html#ref-list-1

This article cites by 51 articles, 12 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

[email protected]

To request permission to re-use all or part of this article, contact the AACR Publications Department at

on May 15, 2014. © 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 14, 2014; DOI: 10.1158/1078-0432.CCR-13-2588



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-13-2588

http://clincancerres.aacrjournals.org/content/suppl/2014/03/14/1078-0432.CCR-13-2588.DC1.html

http://clincancerres.aacrjournals.org/content/20/10/2727.full.html#ref-list-1

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]

http://clincancerres.aacrjournals.org/


Cancer Therapy: Preclinical

Profound Prevention of Experimental Brain Metastases ofBreast Cancer by Temozolomide in an MGMT-DependentManner

DianePalmieri1,RenataDuchnowska5, StephanWoditschka1, EmilyHua1, YongzhenQian4,WojciechBiernat6,Katarzyna Sosi�nska-Mielcarek8, Brunilde Gril1, Andreas M. Stark9, Stephen M. Hewitt2, David J. Liewehr3,Seth M. Steinberg3, Jacek Jassem2,7, and Patricia S. Steeg1

AbstractPurpose:Brainmetastases of breast cancer cause neurocognitive damage and are incurable.We evaluated

a role for temozolomide in the prevention of brain metastases of breast cancer in experimental brain

metastasis models.

Experimental Design: Temozolomide was administered in mice following earlier injection of brain-

tropic HER2–positive JIMT-1-BR3 and triple-negative 231-BR-EGFP sublines, the latter with and without

expression of O6-methylguanine-DNA methyltransferase (MGMT). In addition, the percentage of MGMT-

positive tumor cells in 62 patient-matched sets of breast cancer primary tumors and resected brain

metastases was determined immunohistochemically.

Results: Temozolomide, when dosed at 50, 25, 10, or 5 mg/kg, 5 days per week, beginning 3 days after

inoculation, completely prevented the formation of experimental brain metastases from MGMT-negative

231-BR-EGFP cells. At a 1 mg/kg dose, temozolomide prevented 68% of large brain metastases, and was

ineffective at a dose of 0.5 mg/kg. When the 50 mg/kg dose was administered beginning on days 18 or 24,

temozolomide efficacywas reduced or absent. Temozolomidewas ineffective at preventing brainmetastases

inMGMT-transduced231-BR-EGFPandMGMT-expressing JIMT-1-BR3 sublines. In 62patient-matched sets

of primary breast tumors and resected brainmetastases, 43.5%of the specimens had concordant lowMGMT

expression, whereas in another 14.5% of sets highMGMT staining in the primary tumor corresponded with

low staining in the brain metastasis.

Conclusions: Temozolomide profoundly prevented the outgrowth of experimental brain metastases of

breast cancer in an MGMT-dependent manner. These data provide compelling rationale for investigating the

preventive efficacy of temozolomide in a clinical setting. Clin Cancer Res; 20(10); 2727–39. �2014 AACR.

IntroductionBreast cancer is the second most frequent cause of brain

metastases, after lung cancer. Brain metastases often occurin patients with advanced HER2-positive breast cancer,

including those with stable extracranial disease or whileresponding to systemic therapy (1, 2). For patients withtriple-negative (estrogen receptor and progesterone recep-tor negative, HER2-normal) advanced breast cancer, a sim-ilar percentage develop brain metastases in a setting ofprogressive systemic disease (3). Current treatments forbrainmetastasis are palliative, includingwhole-brain radio-therapy (WBRT), stereotactic radiosurgery, neurosurgery,and steroids (4).

Chemotherapy ormolecular therapies have played only alimited role in the treatment of brain metastases (5–11), asthe brain is protected from most drugs by the blood–brainbarrier (BBB). Pharmacokinetic and imaging studies inmouse models indicate that the extent of BBB openingfollowing its disruption by the formation of a brain metas-tasis is limited and heterogeneous (12–14), a conclusionsupported by clinical studies (reviewed in refs. 15–17).Using an experimental brain metastasis model system, wepreviously tested multiple drugs for the ability to preventthe formation of brain metastases or to shrink establishedbrain metastases. Six drugs have shown partial efficacy in

Authors' Affiliations: 1Women's Malignancies Branch; 2Laboratory ofPathology, Center for Cancer Research; 3Biostatistics and Data Manage-ment Section, NCI, NIH, Bethesda; 4Laboratory Animal Sciences Program,SAIC-Frederick, NCI, NIH, Frederick, Maryland; 5Department of Oncology,Military Institute of Medicine,Warsaw; Departments of 6Pathomorphology,and 7Oncology and Radiotherapy, Medical University; 8Regional CancerCenter,Gda�nsk, Poland; and 9Klinik furNeurochirurgieUKSHCampusKiel,Kiel, Germany

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

Current address for D. Palmieri: Office of the Scientific Director, NationalHeart, Lung and Blood Institute, NIH, Bethesda, MD.

Corresponding Author: Patricia S. Steeg, National Cancer Institute, 37/1126 NIH, Bethesda, MD 20892. Phone: 301-402-2732; Fax: 301-402-8910; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-13-2588

�2014 American Association for Cancer Research.

ClinicalCancer

Research

www.aacrjournals.org 2727




the prevention setting (reviewed in ref. 18), none were ableto shrink established brain metastases.

Temozolomide is an oral, brain-permeable alkylatingagent characterized by significant uptake in the centralnervous system, and is used in the treatment of primarybrain tumors (19–21). This compound induces a numberof different DNA lesions and acts in an O6-methylgua-nine-DNA methyltransferase (MGMT)–dependent man-ner (review in ref. 22). Knowledge on the efficacy oftemozolomide in advanced breast cancer is scarce (23),and the potential of this compound in prevention ofbrain metastases from breast cancer is unknown. Weinvestigated the preventive effect of temozolomide usingan experimental model of breast cancer brain metastasis,and determined the functional contribution of MGMTexpression in this setting.

We hypothesized that temozolomide would significantlyprevent the formation of brain metastases in patients withbreast cancer whose tumors have low-to-noMGMT activity.The percentage of patients with breast cancer representingthis category, as well as whether the primary breast tumor isa good indication of MGMT status in tumor cells metastaticto the brain was unknown. To address these questions, wedetermined MGMT expression immunohistochemically inpatient-matched sets of primary breast cancers and resectedbrain metastases.

Materials and MethodsMaterials

For in vitro and in vivo experiments, temozolomide wasobtained from Sigma or the Drug Synthesis and Chem-istry Branch, Developmental Therapeutics Program, NCI,respectively.

Cell culture and in vitro experiments in 231-BR-EGFPcells

A brain metastatic derivative of the triple-negative breastcancer cell line MDA-MB-231 was transduced with EGFP(231-BR-EGFP), as previously reported (24). Cells weremaintained in high glucose Dulbecco’s Modified EagleMedium (Life Technologies) supplemented with 10% FBS(Life Technologies) at 37�C in 5% CO2.

Cell viability was assessed using MTT (Sigma) as pre-viously described (25). Three separate experiments wereperformed, with n ¼ 4 for each data point within anexperiment. For clonogenic assays, cells were plated at asingle-cell density and treated with vehicle or temozolo-mide 24 hours later and every third day for 10 days.Colonies were fixed and stained with crystal violet forquantification. Three separate experiments were per-formed with n ¼ 3 for each data point within an exper-iment. Western blot analysis was preformed per standardprocedures. Primary antibodies for MGMT (Cell SignalingTechnologies) and a-tubulin (Oncogene Sciences) wereused.

Cell culture and in vitro experiments in JIMT-1-BR3cellsDerivation of the HER2-positive JIMT-1-BR3 cells is

described below. JIMT-1-BR3 cells were maintained sim-ilarly to 231-BR-EGFP cells, but with the addition of 200mmol/L L-glutamine (Life Technologies).

For short hairpin RNA (shRNA)–mediated MGMTknockdown in JIMT-1-BR3 cells, MISSION VSV-G pseudo-typed lentiviral particles expressing shRNA-targetingMGMT(sequence #1 CCGGAGCCTGGCTGAATGCCTATTTCTC-GAGAAATAGGCATTCAGCCAGGCTTTTTTTG or #2 CCGGTGAGCGACACACACGTGTAACCTCGAGGTTACACGT-GTGTGTCGCTCATTTTTTG) and scrambled nontarget con-trol (sequence CCTAAGGTTAAGTCGCCCTCGCTCTAGC-GAG GGCGACTTAACCTTAGG; Sigma-Aldrich) were usedto transduce JIMT-1-BR3 cells at multiplicity of infection of10, according to the manufacturer’s recommendations.Polyclonal populations were selected for 2 weeks in thepresence of puromycin (Life Technologies).

For clonogenic assays in JIMT-1-BR3 cells, 250 cells wereplated at single-cell density and, after 24 hours, treated witheither vehicle or temozolomide at 10, 50, or 100 mmol/Lfinal concentrations. After 14 days, colonies were fixed andstained with crystal violet for quantification.

Animal experimentsAll animal experiments were conducted under an

approved Animal Use Agreement with the NCI.MGMT-negative cell lines. To assess the preventive role

of temozolomide, 5- to 7-week-old femaleNRCnu/numice(Charles River Laboratories) were inoculated with 175,000231-BR-EGFP cells in 0.1 mL PBS in the left ventricle of theheart (25–27). Three days after tumor cell inoculation,micewere randomized to temozolomide at a dose of 50 mg/kgdelivered by oral gavage in saline, 5 days a week for 4 weeks,or vehicle (saline). Subsequent experiments used temozo-lomide doses of 25, 10, 5, 1, and 0.5mg/kg. To evaluate the

Translational RelevanceBrain metastases of breast cancer are prevalent in

metastatic patients with HER2-positive and triple-neg-ative tumors, and contribute to patient morbidity andmortality. Chemotherapy to shrink established brainmetastases has been generally ineffective. We presentextensive preclinical data demonstrating that thebrain-permeable drug temozolomide completely pre-vented experimental brain metastasis formation in theMDA-MB-231-BR model system over a wide range ofdoses. Temozolomide failed to shrink establishedbrain metastases. Temozolomide prevention of brainmetastasis formation was dependent on low MGMTexpression. MGMT expression was determined immu-nohistochemically in matched sets of primary breasttumors and brain metastases; approximately 60% ofresected brain metastases were low in MGMT expres-sion. The data provide evidence to support a clinicaltrial of temozolomide for the prevention of breastcancer brain metastases.

Palmieri et al.

Clin Cancer Res; 20(10) May 15, 2014 Clinical Cancer Research2728




efficacy of temozolomide in treating established brainmetastases,mice received temozolomide (50mg/kg) begin-ning on either day 18 or day 24 after injection of 231-BR-EGFP cells, 5 days a week for 2 and 1 week, respectively. Inall experiments, mice were euthanized under CO2 asphyx-iation 28 days after tumor cell injection, and the brainswereremoved at necropsy. Five hematoxylin and eosin (H&E)–stained serial sections (10-mm-thick), one every 600 mm in asagittal plane through the right hemisphere of the brainwere analyzed at �50 magnification using an ocular grid.Everymicro- or large (�300 and >300 mmalong the longestaxis, respectively) metastasis in each section was tabulated.The left hemisphere of the brain was used for immunohis-tochemical analysis.To investigate the impact of temozolomide on survival,

mice injected with 231-BR-EGFP cells were randomizedto vehicle, temozolomide on days 3 to 14, or temozolo-mide on days 17 to 28 after injection, per the scheduledescribed above. Mice were maintained without furthertreatment up to 109 days and were sacrificed for signs ofmetastatic progression (loss of 20% body weight, sei-zures, and paralysis).MGMT-positive cell lines. To determine the functional

contribution of MGMT expression in the 231-BR-EGFPbrain metastasis prevention model, expression of humanMGMT or a control vector was induced in independentpolyclonal populations using a lentiviral expression system.Briefly, the human MGMT cDNA was purchased fromOrigene Technologies and cloned into the pCDH-CMV-Hygro lentiviral vector (Systems BioScience) for lentivirusproduction and subsequent infection of cells per the man-ufacturer’s recommended protocol. After infection, 231-BR-EGFP cells infected with MGMT or a vector control viruswere selected inhygromycin for 2weeks. Three independentpopulations of cells expressing MGMT or vector virus wereharvested.Two vector-expressing and two MGMT-expressing poly-

clonal populations were injected into the left cardiac ven-tricle of female nude mice, 16 mice per arm. On day 3 afterinjection, each group was randomly divided into vehicle or50mg/kg temozolomide by oral gavage arms, 5 days a weekfor 4 weeks.A brain-tropic derivative of HER2-positive JIMT-1 breast

cancer cells (28) was selected. In derivation experiments,500,000 JIMT-1 cells (28) were injected in the left ventricleof 5- to 7-week-old female NRC nu/nu mice, and micewere housed until they showed signs of distress. Mice wereeuthanized if they lost greater than 20% of their startingbody weight or they became paralyzed. At necropsy,brains were removed, manually dissociated, and placedin tissue culture. Cells that grew out were pooled as JIMT-1-BR1 cells, and the procedure was repeated two addi-tional times to establish JIMT-1-BR3 cells that form brainmetastases in 100% of mice injected over a 3- to 6-weekperiod. For temozolomide experiments, 175,000 JIMT-1-BR3 cells were injected and randomized to vehicle or 50mg/kg temozolomide identical to MGMT-negative 231-BR-EGFP experiments.

Patient-matched primary tumors and brainmetastasesMGMT status was assessed in primary tumors and in

corresponding brain metastases. Two sets of matched pri-mary breast tumors and resected brain metastases wereselected from the Polish brain metastases Consortium(n ¼ 106) and the University of Kiel (Kiel, Germany; n ¼14) databases, respectively. Formalin-fixed, paraffin-embedded (FFPE) samples were used for construction ofa tissue microarray (TMA). MGMT immunohistochemicalexpression in the primary tumor and brain metastasis wascompared for 62 matched sets; clinical parameters wereestablished for 49 of those sets (excluded were 51 sampleswith no viable tumor tissue and six with insufficient clinicalinformation).

ImmunohistochemistryAll procedures were performed according to the manu-

facturer’s instructions (Imgenex, Corp. and LifeSpan,BioSciences, Inc.). The antigen–antibody complex was visu-alized using the Novolink Polymer Detection System. TMAsections were deparaffinized in xylene and rehydratedthrough graded alcohol concentrations (100%, 96%,80%, and 70%). For antigen retrieval, slides were pretreatedwith a low pH target retrieval solution (Dako). Endogenousbiotin was blocked with an appropriate kit. Sections wereincubated for 1 hour with an antibody against the humanMGMT (monoclonal antibody, mAb; clone MT3.1; dilu-tion, 1:50; Imgenex, Corp. and mAb from LifeSpan, BioS-ciences, Inc.; dilution, 1:50). Only a nuclear staining wasconsidered positive. Tonsil tissue served as a positive con-trol. The immunoreactivity was scored semiquantitativelyas follows: 0, <5% positive tumor cells; 1þ, 5% to 75%positive tumor cells; 2þ, 75% to 95% positive tumor cells;3þ, >95%positive tumor cells (29); datawere subsequentlycombined into a MGMT-negative (�5% positive) andMGMT-positive (>5% positive) categories (SupplementaryTable S1). The testing laboratory was blinded to patientcharacteristics.

Statistical analysisTheWilcoxon rank sum test compared distributions from

two-samples. In the rare case the data were normally dis-tributed, a one-way or factorial ANOVA was performed onthedata. TheHolm’smethodwasused to adjust formultiplecomparisons. Analysis of MGMT immunohistochemicaldata used the following tests as appropriate: The Fisherexact test for 2 � 2 tables, the Cochran–Armitage trend testfor 2�C ordered tables, and the Jonckheere–Terpstra trendtest for doubly ordered R�C tables. Actuarial analyses usedthe Kaplan–Meier method. Overall survival was measuredfrom the date of first primary tumor surgery to date of deathor last follow-up. Survival times were censored if the subjectwas alive as of the last follow-up. The log-rank test was usedto test for differences between strata. All reported P valuesare two-sided. Considering the large number of tests per-formed, only P values of <0.005 were deemed statisticallysignificant, whereas 0.005 < P < 0.05 were deemed a strongtrend.

Temozolomide Prevention of Breast Cancer Brain Metastases

www.aacrjournals.org Clin Cancer Res; 20(10) May 15, 2014 2729




ResultsTemozolomide prevention of triple-negative 231-BR-EGFP experimental brain metastases

A previously characterized model system using a brain-tropic subline of the triple-negative human MDA-MB-231breast carcinoma cell line (231-BR-EGFP) was used togenerate experimental brain metastases. Tumor cells wereinjected into the left cardiac ventricle; on day 3 after injec-tion, mice were randomized to receive either vehicle ortemozolomide. At necropsy on day 28 after injection,experimental brain metastases were quantified in step sec-tions through one brain hemisphere as micrometastases orlarge metastases (based on a cutoff of 300 mm along thelongest axis, comparable with a several mm lesion in ahumanbrain). Temozolomide, administered at a dose of 50mg/kg, 5 days a week for 4 weeks, prevented the formationof all large- and micro-brain metastases over two replicateexperiments (Table 1); even single tumor cells could not bedetected in sections of the brains. Vehicle-treated micedeveloped brain metastases at normal rates. This dose wasreported to be consistent with clinically achievable doses of

temozolomide (30, 31). Doses of 25, 10, and 5 mg/kg onthe same schedule yielded the same results, complete pre-vention of brainmetastases formation in vivo (Table 1). At adose of 1 mg/kg, 50-fold lower than the starting dose,medians of 0.9 and 1.2 large metastases per section werepresent in treated brains, as comparedwith 2.3 and 4.8 largemetastases per section in vehicle-treated mice, respectively,corresponding to 61% and 75% reductions (P ¼ 0.80 and0.059, respectively) in the two experiments conducted.Similar inhibition of micrometastatic lesions was observed.At a dose of 0.5 mg/kg, two logs lower than a widelyreported preclinical regimen, temozolomide did not signif-icantly prevent the formation of large- or micrometastases.The data identify a potent preventive effect of temozolo-mide on the formation of 231-BR-EGFP experimental brainmetastases of breast cancer over a wide dose range.

Temozolomide was ineffective in the treatment (i.e.,shrinking) of metastatic breast cancer (23). In experimentstesting the ability of temozolomide to treat establishedbrain metastases, mice were randomized to receive temo-zolomide beginning on either day 18 or day 24 after

Table 1. Temozolomide prevention of experimental breast cancer brain metastases over a two-log dose–responsea

Temozolomide (mg/kg):

Experiment: Lesion: 50 25 10 5 1 0.5

1 Large 0 (2)b

P < 0.0001Micro 0 (63.3)c

P < 0.0001

2 Large 0 (2.6)P < 0.0001

0 (2.6)P < 0.0001

Micro 0 (86.4)P < 0.0001

0 (86.4)P < 0.0001

3 Large 0 (6.5)P < 0.0001

0 (6.5)P < 0.0001

0 (6.5)P < 0.0001

Micro 0 (143.3)P < 0.0001

0 (143.3)P < 0.0001

0 (143.3)P < 0.0001

4 Large 0.9 (2.3)P ¼ 0.80

1.2 (2.3)P ¼ 0.86

Micro 40.1 (101.1)P ¼ 0.22

58 (101.1)P ¼ 0.63

5 Large 1.2 (4.8)P ¼ 0.059

5 (4.8)P ¼ 0.90

Micro 67 (178.6)P ¼ 0.028

115 (178.6)P ¼ 0.30

aFemale nude mice were injected in the left cardiac ventricle with 1.75�105 tumor cells from a brain-tropic triple-negative breastcarcinomacell line (231-BR-EGFP). Beginningonday 3after injection,mice received temozolomide byoral gavage, 5 daysperweek for4 weeks. Mice were sacrificed 28 days after injection. Experimental brain metastases were quantified in serial sections throughone hemisphere as micrometastases (micro) or large metastases (�300 and >300 mm along the longest axis, respectively). Theeffect of temozolomide was compared with that of a vehicle control in each experiment. Sample size was 3 to 10 mice per group.b,cMedian number of (b) large metastases and (c) micrometastases that formed, respectively, at the indicated concentration oftemozolomide (median number of metastases that formed in vehicle-treated mice).

Palmieri et al.





injection. Temozolomide administered on day 18 afterinjection of 231-BR-EGFP cells resulted in a median of1.4 large metastases per section, compared with 4.7 for thevehicle controls, a 70% reduction (P ¼ 0.0002; Fig. 1A). A59% reduction was observed in micrometastases (P ¼0.0001; Fig. 1B). Day 18 after injection represents a timepoint where multiple micrometastases and occasional largemetastases are present.When treatment was further delayedto day 24 after injection, a time when greater numbers oflarge metastases had formed, as demonstrated in imagingstudies (32), the efficacy of temozolomide was lost (amedian of 5.8 large metastases per section compared with4.7 in vehicle-treated mice, and similar trends wereobserved for micrometastases; Fig. 1B). Prolongation of the

experiment was impossible, asmice administered vehicle ortemozolomide on day 24 required euthanasia for paralysisand other indications. The data indicate that the inhibitoryeffect of temozolomide was reduced by late administration,possibly due to decreased delivery throughout larger tumormasses and/or shorter exposure to the drug.

To investigate the impact of preventing experimentalbrain metastases on mouse survival, mice were injectedwith 231-BR-EGFP cells in the left cardiac ventricle, andthen randomized to three arms: Vehicle from days 3 to 28;temozolomide (50mg/kg, 5 days a week) from days 3 to 14or temozolomide fromdays 17 to 28. Allmicewere then leftuntreated and monitored for signs of paralysis, weight loss,or seizures requiring euthanasia. All vehicle-treated micerequired euthanasia by day 45 after injection,with amediansurvival of 5 weeks after injection compared with 10.9weeks for the delayed treatment (Fig. 2; median survivalwas not reached in the early treatment). The two schedulesof 2-week temozolomide treatment significantly increasedsurvival (P ¼ 0.0003 by log-rank test). Earlier (days 3–14)and delayed (days 17–28) administration of temozolomideresulted in long-term survival of 60% (6/10mice) and 18%(2/11mice), respectively; a significant difference comparedwith vehicle (P < 0.0001 and 0.0008, respectively). Takentogether, the data indicate that temozolomide administra-tion prolonged mouse survival and was associated withcures. This is consistent with data from previous experi-ments showing no evidence of disease fromhistopathologiccounts. In this experiment the early versus late treatmentarms received the same cumulative dose of temozolomide,and the data favored early treatment.

P = 0.0002

P = 0.0001

A

B

Figure 1. Delayed administration of temozolomide (TMZ) is less effectiveon experimental 231-BR-EGFP brain metastasis. Of note, 231-BR-EGFPcells were injected into the left cardiac ventricle of female nude mice; themice randomized to three treatment groups: vehicle on days 3 to 28 afterinjection, or 50 mg/kg temozolomide 5 days a week, beginning either atday 18 or day 24 after injection. A, number of large metastases (>300 mmin a single dimension) per brain section. B, number of micrometastasesper brain section (<300 mm). Each dot represents median per mouseand the line designates the group median. A one-way ANOVA wasperformed on transformed data and the Holm's method was used toadjust the model-based t test P values (n ¼ 8–10).

Overall survival (Wk) 0 5 10 15

Pro

abili

ty o

f no

tum

or

1.0

0.8

0.6

0.4

0.0

0.2

Vehicle

TMZ - Days 3–14

TMZ - Days 17–28

VehicleTMZ - Days 3–14TMZ - Days 17–28

10 5 010 10 911 10 8

62

No. at risk

P < 0.001

P < 0.008

Figure 2. Early administration of temozolomide (TMZ) provides long-termsurvival in a preclinical model. 231-BR-EGFP cells were injected into theleft cardiac ventricle of female nude mice; the mice randomized to threetreatment groups: Vehicle, days 3 to 28 after injection; 50 mg/kgtemozolomide, 5 days a week, days 3 to 14 after injection; 50 mg/kgtemozolomide 5 days a week, days 17 to 28 after injection. Mice werehoused without further treatment until day 109 after injection. They weresacrificed upon signs of progression such as 20% body weight loss,paralysis, or seizures. Kaplan–Meier analysis of survival is shown. Thelog-rank test was used to compare strata and the Holm's method wasused to adjust P values.






Expression of MGMT and sensitivity to temozolomideWhereas temozolomide induces a number of DNA

lesions, evidence suggests that the formation of the O6

-methylguanine DNA lesions is associated with temozolo-mide activity in primary brain tumors (22). This lesion isrepaired by the enzyme MGMT. In in vitro experiments,temozolomide completely abolished the ability of single

231-BR-EGFP cells to formcolonies (Fig. 3A,P¼0.003 at 10mmol/L and P ¼ 0.0004 at 50 mmol/L) but decreasedproliferation by only 24% (P¼ 0.0002; Supplementary Fig.S1). In agreement with the sensitivity of 231-BR-EGFP cellsto temozolomide, the cellswereMGMTnegative byWesternblot analysis (Fig. 3B) and quantitative real-time PCR (datanot shown). To determine the functional contribution of

0

50

100

150M

edia

n no

. of c

olon

ies

Vecto

r

Vecto

r

Vecto

r

MGM

T

MGM

T

MGM

T

Vehicle 10 µmol/L TMZ 50 µmol/L TMZ

A

C

E

D

B

Figure 3. MGMT overexpressionabrogates temozolomide (TMZ)prevention of experimental brainmetastasis formation. A,clonogenic assay for the effect oftemozolomide on the outgrowthof single cells in vitro. Of note,231-BR-EGFP vector andMGMT-transduced populations wereplated at single-cell densities,treated with the indicatedconcentration of temozolomideand the number of coloniescounted after 10 days. Each dotrepresents the mean of triplicatedata points within an experimentand the line designates themedian of the data from threeexperiments (n ¼ 6–9). Nocolonies formed in the vector cellsin the presence of temozolomide.B, Western blot analysis of threeindependent polyclonalpopulations of 231-BR-EGFPcells transduced with either anempty vector or human MGMTcDNA. Two other cell lines, MCF7and JIMT-1-BR3 are also shownas positive controls. C to E, 231-BR-EGFP cells transduced withvector orMGMTwere injected intothe left cardiac ventricle of femalenude mice, and randomized tovehicle or 50 mg/kgtemozolomide, 5 days a week,beginning on day 3 after injection.(n ¼ 8–16). C, median largemetastases per brain section.D, median micrometastases perbrain section. E, expression ofMGMT in experimental brainmetastases. FFPE sections ofmouse brain with metastaseswere stained for MGMTexpression. Representativeimages are shown from 2mice pergroup. Magnification, �200.

Palmieri et al.





MGMT expression in our brain metastasis preventive mod-el, expression of a MGMT cDNA was induced using alentiviral expression system. Independent polyclonal popu-lations of vector or MGMT-expressing 231-BR-EGFP cellswere isolated (Fig. 3B). When 231-BR-EGFP cells wereforced to express MGMT, in vitro colonization was similarto vehicle-treated cells at both 10 (P ¼ 1.0) and 50 mmol/L(P ¼ 0.92) concentrations of temozolomide; proliferationin vitro was unaffected.The impact of MGMT expression on temozolomide pre-

vention of 231-BR-EGFP brain metastases was tested inexperimental brain metastases assays. Two vector– and twoMGMT–positive polyclonal populations were injected intomice as described, and randomized to vehicle or 50 mg/kgtemozolomide on the same schedule as previouslydescribed.Data from the two vector and twoMGMT-expres-sing polyclonal cell populations were combined as nosignificant difference was detected between the popula-tions. A representative experiment of two conducted isshown (Fig. 3C andD). For the two experiments conducted,vehicle-treatedmice injectedwith 231-BR-EGFP-vector cellsdevelopedmedians of 1.4 and 0.7 large brainmetastases persection, whereas temozolomide again abrogated all largeand micrometastasis development. Mice that received 231-BR-EGFP cells expressing MGMT, and were treated withtemozolomide, developed a median of 1.7 and 2.8 largebrain metastases per section, respectively. These data weresimilar to that of untreatedmice injectedwith 231-BR-EGFPand represented a strong trend of distinction from thetemozolomide-treated mice injected with 231-BR-EGFP(P ¼ 0.066 and P ¼ 0.0003, respectively). The data suggestthat MGMT expression may modulate brain metastaticactivity to a limited extent (Fig. 3C). In agreement withprevious data, temozolomide completely inhibited theformation of brain metastasis by 231-BR-EGFP-vector cells(P < 0.001 for both experiments), bringing to four thenumber of independent experiments with complete pre-ventive activity at 50 mg/kg (see Table 1). For the MGMT-expressing 231-BR-EGFP cells, temozolomide administra-tion resulted in a median of 0.6 and 2.8 large brain metas-tases per section in the two experiments conducted, ascompared with 1.7 and 2.8 large brain metastases persection in vehicle-treated mice, respectively (P¼ 0.010 andP¼0.48). Similar trendswere observed formicrometastases(Fig. 3D). Expression of MGMT in the tumor cells thatformed metastases in the brain was heterogeneous at theend of the experiment; however, the majority of lesionsmaintained some level of expression of the transduced gene(Fig. 3E). Thus, temozolomide prevention of brain metas-tases formation in this model system was MGMT depen-dent. We have been unable to identify a second brainmetastasis model system that is low in MGMT expressionfor validation purposes.We tested the brain metastases preventive ability of

temozolomide in a second experimental brain metastasismodel system. A brain-tropic subline of the HER2-positivebreast cancer cell line JIMT-1 (28), which is MGMT-positive(Fig. 3B), was derived by three rounds of intracardiac

injection, formation of experimental brain metastases, ster-ile harvest, and ex vivo culture. JIMT-1 cells are reported to belapatinib-resistant in vitro and may, therefore, be represen-tative of advanced disease (33). In keeping with its MGMT-positive status, there was no significant prevention of brainmetastases formation by temozolomide when mice wereinjectedwith JIMT-1-BR3 cells and randomized to vehicle or50 mg/kg temozolomide beginning on day 3 after injection(5 d/wk; Supplementary Fig. S2A and S2B). Vehicle-treatedmice developed a median of 8.6 large metastases and 64.6micrometastases per section, compared with 8.5 largemetastases and 57.7 micrometastases for mice treated with50 mg/kg temozolomide (P ¼ 0.36 and P ¼ 0.63, respec-tively). JIMT-1-BR3cellswere then transducedwith shRNAs,using a scrambled control and two independent MGMT-targeting constructs. MGMT expression of the resultingpolyclonal populations is shown on Supplementary Fig.S2C. Colonization assays, which were a faithful indicator ofin vivo experimental brain metastasis for 231-BR-EGFP cells(Fig. 3A), were performed in the presence and absence oftemozolomide. Knockdown of MGMT had no significanteffect on the colonization of JIMT-1-BR3 cells in the absenceof temozolomide; both shRNA constructs strongly sensi-tized the cells to temozolomide, at 50 and 100 mmol/Lconcentrations (P < 0.0001 for comparisons with scramblecontrol; Supplementary Fig. S2D). The data are consistentwith a requirement for low MGMT expression for temozo-lomide prevention of experimental brain metastasis.

MGMT expression in patient-matched primary breasttumors and brain metastases

We hypothesize, based on the preclinical data presented,that temozolomide may be effective in preventing the for-mation of brainmetastases from single tumor cells ormicro-metastases in patients with tumors that have low-to-noMGMT activity. What percentage of patients with breastcancer this represents, as well as whether the primary breasttumor is an accurate predictor of MGMT status in brainmetastases, remains a question.MGMThas been screenedbymultiple methodologies, with the methylation status of itspromoter used most often. We reasoned that many molec-ular mechanisms can downregulate MGMT, besides DNAmethylation, and elected to use an immunohistochemicalassay for overall protein levels. Two TMAs were stained forMGMT and the percentage of MGMT-positive tumor cellsscored by a pathologist. A total of 62 matched sets werestained, each consisting of a primary breast tumor andresected brain metastasis from the same patient, a cohortof rare specimens. Initially apreviously reported set of cutoffswas used, including >5%, 6% to 75%, 76% to 95% and>95%positive tumor cells (29).On thebasis of thepaucityofsamples in each of the latter three categories, the data weredichotomized to low (<5% positive tumor cells) and high(�5%) staining categories. All four potential patterns ofMGMT staining in the primary tumor and matched resectedbrain metastasis were observed (low MGMT expression inboth primary tumor and brain metastasis; low expression inthe primary tumor, high expression in the brain metastasis;






high expression in the primary tumor, low expression in thebrain metastasis; low expression in both the primary tumorand brain metastasis; Fig. 4). Overall, the concordance ofprimary tumor and brain metastasis MGMT expression wasweak: in only 60% of cases dichotomized MGMT status inprimary tumor and brain metastasis was concordant. Ofnote, 44% (n ¼ 27) contained concordant low MGMTstaining in primary tumors and brain metastases and inanother9 cases (15%)highMGMTexpression in theprimarytumor correspondedwith low expression in the brainmetas-tasis. Taken together, a majority of brain metastases (36 ofthe 62matched sets, 58%) had lowMGMT–expressing brainmetastases. The data indicate that a majority of brain metas-tases are low inMGMTexpression and, therefore, potentiallypreventable by temozolomide.

Clinical parameters, including hormone receptor status,grade, and subtype of primary tumor, as well as treatment,type of first metastatic progression, and dominant site ofmetastatic disease, were compared for low versus highMGMT-staining tumors, either the primary tumor or the

matched resected brain metastasis (Table 2). A strong trendwas observed in brainmetastases for an association of HER2overexpression and MGMT negativity (P ¼ 0.089), suggest-ing the eligibility of this subset for potential clinical trials.Nine patients (33%) with lowMGMT brainmetastases (n¼27) experienced brain as the first site of metastatic progres-sion, as comparedwith16patients (76%)withhighMGMT–expressing brainmetastases (P¼ 0.004). Brain metastasis asa first site of progressionwas associated with overall survival(log-rank P¼ 0.008), whereas MGMT staining, either in theprimary tumor or resected brain metastasis was not (Sup-plementary Table S2; Supplementary Fig. S3).

DiscussionTemozolomide shows efficacy in primary brain tumors,

but is considered inactive in metastatic breast cancer (23).This compound has also been tested in patients with est-ablished brain metastases from a variety of cancer typeswith limited responses, either as monotherapy (34–37), in

A B

C D

Figure 4. MGMT expression in matched sets of human breast primary tumors and resected brain metastases. A to D, sixty-two patient-matched sets werecollected from tumor banks in Poland and Germany. TMAs of the specimens were stained for MGMT and evaluated for the percentage of positively stainingtumor cells (nuclear staining only), dichotomized at 5%. The number and percentage of specimens in each category is given below each representativephotomicrograph.

Palmieri et al.





Table 2. Associations of primary tumor and brain metastasis MGMT expression with patientcharacteristicsa

Number with characteristic/total (%)

Variable

MGMT-negative(�5% positivetumor cells)

MGMT-positive(>5% positivetumor cells) P

Primary tumor (n ¼ 43 and 19, respectively)Breast cancer typeDuctal 26/31 (84%) 13/17 (76%) 0.52Lobular 3/31 (9.7%) 1/17 (5.9%)Other 2/31 (6.5%) 3/17 (18%)

HR statusER-positive 17/31 (55%) 12/17 (71%) 0.36PR-positive 10/31 (32%) 9/16 (56%) 0.13HER2-positive 16/31 (52%) 7/17 (41%) 0.56

Subtypeb

HR(þ)/HER2(�) 8/31 (26%) 8/17 (47%) 0.23HR(þ)/HER2(þ) 10/31 (32%) 4/17 (24%)HR(�)/HER2(þ) 6/31 (19%) 3/17 (18%)HR(�)/HER2(�) 7/31 (23%) 2/17 (12%)

Grade1 0/28 (0%) 2/17 (12%)2 10/28 (36%) 6/17 (35%) 0.193 18/28 (64%) 9/17 (53%)Unknownc 2 4

Treatment before brain metastasisNeoadjuvant chemotherapy 8/31 (26%) 4/17 (24%) 1.0Adjuvant chemotherapy 12/31 (39%) 7/17 (41%)Metastatic chemotherapy 2/31 (6.5%) 0/17 (0%)Adjuvant/neoadjuvant and metastatic chemotherapy 17/31 (55%) 8/17 (47%) 0.25No 0/31 (0%) 2/17 (12%)Endocrine therapy 13/31 (42%) 10/17 (59%) 0.37Trastuzumab 11/31 (35%) 5/16 (31%) 1.0Radiotherapy 20/28 (71%) 16/17 (94%) 0.12

Site of first progressionRegional (nodal) 3/31 (9.7%) 0/17 (0%) 0.54Distant 28/31 (90.3%) 17/17 (100%)

Dominant site of metastatic diseased

Soft tissuee 0 0 0.11Bone 0/31 (0%) 2/16 (13%)Viscera 31/31 (100%) 14/16 (87%)

Brain metastases (n ¼ 36 and 26, respectively)Receptor statusER-positive 16/27 (59%) 13/21 (62%) 1.0PR-positive 9/26 (35%) 10/21 (48%) 0.39HER2-positive 16/27 (59%) 7/21 (33%) 0.089

Subtypeb

HR(þ)/HER2(�) 1/27 (3.7%) 4/19 (21%) 0.64HR(þ)/HER2(þ) 11/27 (41%) 7/19 (37%)HR(�)/HER2(þ) 11/27 (41%) 2/19 (11%)HR(�)/HER(�) 4/27 (15%) 6/19 (32%)

Brain as first metastatic site 9/27 (33%) 16/21 (76%) 0.004

(Continued on the following page)






combination with other cytotoxic agents (refs. 38–40, asexamples), or with radiotherapy (refs. 41–43, as examples).Manyof these studies enrolled patientswithmultiple cancerhistologies, were focused on responses rather than on initialdevelopment of disease, and did not investigate molecularcorrelates.

We report the preclinical testing of temozolomide in the231-BR-EGFP experimental brain metastasis model system.The 231-BR-EGFPmodel systemwas previously reported tobe representative of breast cancer craniotomy specimens interms of proliferation and apoptosis rates, and a neuroin-flammatory response (44). The experimental metastasismodel used histologic counts as opposed to imaging,because imaging signals can be variably diminished by theirdepth within the brain. This model was extensively testedfor the prevention of brain metastases by 10 drugs (18).Partial prevention of brain metastases was noted for severaldrugs (18), but none was completely effective. In contrast,four experiments at 50mg/kg, two experiments at 25mg/kg,and one experiment each at 10 and 5 mg/kg dosing sche-dules completely prevented the formation of 231-BR-EGFPbrainmetastases. We attempted dual fluorescent staining ofbrain sections with antibodies specific to humanmitochon-dria and endoplasmic reticulum to identify residual tumorcells that may have been unseen on H&E staining, butremain uncertain of any positive staining. The completeabrogation of brainmetastases demonstrated in this study is

unique. The extensive dose–response of temozolomideprevention of 231-BR-EGFP brain metastases, over a log ofdoses, suggests that lower doses of drug may be used in aprevention trial. Indeed, temozolomide efficacy has beenstudied in lower metronomic regimens with good results(45–47).

Our data also suggest that the inhibitory effect oftemozolomide was reduced by late administration. Usinghistologic counts, a 2-week administration of temozolo-mide starting at day 17 after injection was superior to a 1-week regimen starting on day 24 after injection. Thisexperiment contained two variables: The size of the brainlesions at the initiation of treatment and the cumulativedose of temozolomide delivered. However, in a survivalanalysis, equal cumulative doses of temozolomide wereadministered. Earlier administration of temozolomide(days 3–14 after injection) produced long-term survivalin 60% of mice, superior to later administration (days17–28 after injection). It remains possible that evengreater numbers of mice were "cured" of brain metastasesin the survival experiment, as some mice also developbone metastases and require euthanasia for similar symp-toms, such as paralysis.

In the 231-BR-EGFPmodel system, thepreventive efficacyof temozolomide was MGMT dependent. Expression ofMGMT in the MGMT-null 231-BR-EGFP subline abrogatedthe brainmetastasis preventive activity of temozolomide. In

Table 2. Associations of primary tumor and brain metastasis MGMT expression with patientcharacteristicsa (Cont'd )

Number with characteristic/total (%)

Variable

MGMT-negative(�5% positivetumor cells)

MGMT-positive(>5% positivetumor cells) P

No. of brain metastases at time of surgery1 19/27 (70%) 9/20 (45%) 0.132—3 6/27 (22%) 8/20 (40%)>3 2/27 (7.4%) 3/20 (15%)

KPS>70 25/27 (93%) 17/21 (81%) 0.38Treatment after brain metastasisRadiotherapy 23/25 (92%) 18/20 (90%) 1.0Chemotherapy 16/24 (67%) 12/19 (63%) 1.0Endocrine therapy 5/24 (21%) 3/20 (15%) 0.71Trastuzumab 5/10 (50%) 2/2 (100%) 0.47Lapatinib 6/10 (60%) 0/2 (0%) 0.45

aHistopathologic and clinical data from a cohort of 49 patients with metastatic breast cancer, for which matched primary tumor andresected brain metastasis FFPE specimens, and clinical data were available for analysis. MGMT expression was determinedimmunohistochemically and dichotomized into negative (�5%MGMT-staining tumor cells) and positive (>5%MGMT-staining tumorcells) samples. The following statistical tests were used as appropriate: The Fisher exact test for 2 � 2 tables, the Cochran–Armitagetrend test for 2 � C ordered tables, and the Jonckheere–Terpstra trend test for doubly ordered R � C tables.bSubtype was analyzed as an ordered variable.cUnknown was not used in the statistical analysis of the tumor grade.dMultiple metastatic sites were assigned into three categories (soft tissue, bones, and viscera) and the dominant site classified by thecategory associated with the worst prognosis in the following order of increasing gravidity: soft tissues, bones, and viscera.eSoft tissue was not used in the statistical analysis of the dominant site of disease.

Palmieri et al.





addition, we developed a newmodel system for experimen-tal brain metastasis of breast cancer based on the JIMT-1breast cancer cell line (28). Temozolomide was ineffectiveat preventing brain metastases in the MGMT-positive JIMT-1-BR3model. This observation raises thequestionofwheth-erMGMT expression needs to be an enrollment criterion fora temozolomide brain metastasis preventive trial. In earlierstudies MGMT expression was detected by enzymatic activ-ity, promoter methylation, mRNA level, and immunohis-tochemistry (48, 49). We reasoned that many events, notjust promoter methylation, can downregulate MGMT geneexpression and enzymatic activity; therefore, we used animmunohistochemical assay. We used two TMAs contain-ing rare matched sets of primary breast tumors and theresected brain metastasis from the same patient. In thisseries, 59% of patients had low MGMT–expressing brainmetastases. However, only 60%of resected brainmetastasisretained concordant MGMT staining with the primarytumor. Thus, primary tumor MGMT status is an unfaithfulpredictor of the brain metastasis status, and, therefore,should not be used as trial enrollment criterion. In patientsundergoing brainmetastases excision,MGMT statusmay bedetermined in the first metastasis, but its consistency insubsequent metastases remains to be established. Currentknowledge indicates that all patients should be enrolled,and primary tumorMGMT expression should be quantifiedretrospectively. A higher than 40%MGMT-positivity rate ofbrain metastases might be factored into statistical calcula-tions of a trial size.Pharmacologic prevention of brain metastases remains

an important goal that is rarely addressed in clinical trials.In small-cell lung cancer prophylactic WBRT has beenprospectively demonstrated to reduce brain metastasesincidence (50). Cognitive decline from WBRT occurs ina proportion of patients and is irreversible, leading tohesitation in using this modality in breast cancer wheresurvival times can be relatively long. Thus, the identifica-tion of new brain metastasis preventive strategies remainsan important goal. We advocate for randomized phase IIsecondary brain metastasis prevention trials to provideinitial evidence of a preventive effect (51). Patients withlimited numbers of brain metastases, treated with surgeryor stereotactic radiosurgery are at high risk for the devel-opment of subsequent brain lesions. Such patients couldbe randomized to placebo or the proposed preventive, inaddition to standard systemic therapy. The primary end-point would be freedom from a new brain metastasis,distant from radiosurgical or surgical beds, and other end-points should include time to WBRT and quality of life,rather than shrinkage of an established lesion. The findingthat temozolomide more effectively prevents the out-growth of a few tumor cells, as opposed to shrinking a

lesion containing millions of tumor cells, makes intuitivesense. The number of tumor cells that must be impactedvaries. Micrometastases may have a more normal vascula-ture and peritumoral hydrostatic pressure, both of whichfacilitate drug delivery. A cytostatic agent may be sufficientto prevent brain colonization, whereas a cytotoxic agentwould be required to shrink an established lesion. Thereare some hints of clinical brain metastasis preventiveactivity of temozolomide. In advancedmelanomapatients,2 of 20 patients treated with temozolomide developedbrain metastases, as compared with 9 of 21 treated withdacarbazine (P¼0.03; ref. 35). Extensive stable diseasewasreported in early trials of capecitabine/temozolomide andlapatinib/temozolomide for patients with breast cancerand brain metastases (7, 40).

In conclusion, our preclinical study suggests that temo-zolomide may effectively prevent the outgrowth of brainmetastases in patients with high-risk advanced breast can-cer. These data provide a compelling rationale for brainmetastasis prevention trials using temozolomide in patientswith high-risk advanced breast cancer.

Disclosure of Potential Conflicts of InterestP.S. Steeg reports receiving a commercial research grant from Glaxo-

SmithKline and Sanofi. No potential conflicts of interest were disclosed bythe other authors.

Authors' ContributionsConception and design: D. Palmieri, R. Duchnowska, S. Woditschka,B. Gril, J. Jassem, P.S SteegDevelopment ofmethodology:D. Palmieri, B. Gril, S.Hewitt, J. Jassem, P.SSteegAcquisitionofdata (provided animals, acquired andmanagedpatients,provided facilities, etc.): D. Palmieri, R. Duchnowska, S. Woditschka,Y. Qian, W. Biernat, K. Sosi�nska-Mielcarek, B. Gril, A. Stark, S. HewittAnalysis and interpretation of data (e.g., statistical analysis, biosta-tistics, computational analysis): D. Palmieri, R. Duchnowska, D.J Lie-wehr,S.M Steinberg, P.S SteegWriting, review, and/or revision of the manuscript: D. Palmieri,R. Duchnowska, S. Woditschka, W. Biernat, K. Sosi�nska-Mielcarek, B. Gril,A. Stark, S. Hewitt, D.J Liewehr, S.M Steinberg, J. Jassem, P.S SteegAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): R. Duchnowska, S. Woditschka,E. Hua, Y. Qian, A. StarkStudy supervision: R. Duchnowska, J. Jassem, P.S Steeg

Grant SupportThis work was supported by the Intramural program of the National

Cancer Institute and U.S. Department of Defense Breast Cancer ResearchProgram, grant number: W81 XWH-062-0033, and an Intramural grant ofthe Medical University of Gda�nsk (Gda�nsk, Poland), grant number ST-51.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received September 19, 2013; revised February 6, 2014; accepted February21, 2014; published OnlineFirst March 14, 2014.

References1. Brufsky A, Mayer M, Rugo H, Kaufman P, Tan-Chiu E, Tripathy D, et al.

Central nervous system metastases in patients with Her2-positivemetastatic breast cancer: Incidence, treatment, andsurvival in patientsfrom registHER. Clin Cancer Res 2011;17:4834–43.

2. Bendell J, Domchek S, Burstein H, Harris L, Younger J, Kuter I, et al.Central nervous system metastases in women who receive trastuzu-mab-based therapy for metastatic breast carcinoma. Cancer 2003;97:2972–7.






3. Lin N, Claus E, Sohl J, Razzak A, Arnout A, Winer E. Sites of distantrecurrence and clinical outcomes in patients with metastatic triple-negative breast cancer. high incidence of central nervous systemmetastases. Cancer 2008;113:2638–45.

4. Steeg P,CamphausenK, SmithQ. Brainmetastases as preventive andtherapeutic targets. Nat Rev Cancer 2011;11:352–63.

5. Rosner D, Nemoto T, Lane W. Chemotherapy induces regression ofbrain metastases in breast carcinoma. Cancer 1986;58:832–9.

6. Boogerd W, Dalesio O, Bais E, van der Sande JJ. Response of brainmetastases from breast cancer to systemic chemotherapy. Cancer1992;69:972–80.

7. RiveraE,MeyersC,GrovesM,Valero V, FrancisD,ArunB, et al. Phase Istudy of capecitabine in combination with temozolomide in the treat-ment of patients with brain metastases of breast cancer. Cancer2006;107:1348–54.

8. Melisko ME, Kunwar S, Prados M, Berger MS, Park JW. Brain metas-tases of breast cancer. Expert Rev Anticancer Ther 2005;5:253–68.

9. Walbert T, Gilbert M. The role of chemotherapy in the treatment ofpatientswithbrainmetastases fromsolid tumors. Int JClinOncol 2009;14:299–306.

10. Lin N, Carey L, LiuM, Younger J, ComeS, Bullitt E, et al. Phase II trial oflapatinib for brain metastases in patients with HER2þ breast cancer.J Clin Oncol 2006;24:503.

11. Lin N, Carey L, Liu M, Younger J, Come S, EwendM, et al. Phase II trialof lapatinib for brain metasetases in patients with human epidermalgrowth factor receptor 2-positive breast cancer. Clin Cancer Res2008;26:1993–9.

12. Lockman P, Mittapalli R, Taskar K, Rudraruju V, Gril B, Bohn K, et al.Heterogeneous blood–brain barrier permeability determines drug effi-cacy in mouse brain metastases of breast cancer. Clin Cancer Res2010;16:5662–78.

13. Taskar K,Rudraraju V,Mittapali R, SamalaR, ThorsheimH, Lockman J,et al. Lapatinib distribution in HER2 overexpressing experimental brainmetastases of breast cancer. Pharm Res 2012;29:770–81.

14. Percy D, Ribot E, Chen Y, McFadden C, Simedrea C, Steeg PS, et al.In vivo characterization of changing blood-tumor barrier permeabil-ity in a mouse model of breast cancer metastasis: a complementarymagnetic resonance imaging approach. Invest Radiol 2011;46:718–25.

15. MuldoonL, SoussainC, JahnkeK, JohansonC,Siegal T, SmithQ, et al.Chemotherapydelivery issues in central nervous systemmalignancy: areality check. J Clin Oncol 2007;25:2295–305.

16. Chamberlain M. Anticancer therapies and CNS relapse: overcomingblood–brain and blood–cerebrospinal fluid barrier impermeability.Expert Rev Neuother 2010;10:547–61.

17. Deeken JF, Loscher W. The blood–brain barrier and cancer: transpor-ters, treatment, and trojan horses. Clin Cancer Res 2007;13:1663–74.

18. Lin N, Amiri-Kordestani L, Palmieri D, Liewehr D, Steeg P. CNSmetastasis: old challenge, new frontiers. Clin Cancer Res 2013;19:6404–18.

19. Brindley C, Antoni W, Newlands E. Plasma and tissue disposition ofmitozolomide in mice. Br J Cancer 1986;53:91.

20. O'Reilly S, Newlands E, Glaser M, Brampton M, Rice-Edwards J,Illingworth R, et al. Temozolomide: a new oral cytotoxic chemother-apeutic agent with promising activity against primary brain tumours.Eur J Cancer 1993;29A:940–2.

21. Newlands E, Blackledge G, Slack J, Rustin G, Smith D, Stuart N, et al.Phase I trial of temozolomide (CCRG81045:M&B39831:NSC362856.Br J Cancer 1992;65:287–91.

22. Newlands E, Stevens M, Wedge S, Wheelhouse R, Brock C. Temo-zolomide: a review of its discovery, chemical properties, pre-clinicaldevelopment and clinical trials. Cancer Trt Rev 1997;23:35–61.

23. TrudeauM,CrumpM,CharpentierD,Yelle L,BordeleauL,MatthewsS,et al. Temozolomide in metastatic breast cancer (MBC): a phase II trialof the National Cancer Institute of Canada—Clinical Trials Group(NCIC-CTG). Ann Oncol 2006;17:952–6.

24. Yoneda T, Williams P, Hiraga T, Niewolna M, Nishimura R. A boneseeking clone exhibits different biological properties from the MDA-MB-231parental humanbreast cancer cells andabrain-seekingcloe invivo and in vitro. J Bone Mineral Res 2001;16:1486–95.

25. Palmieri D, Bronder JL, Herring JM, Yoneda T,Weil RJ, Stark AM, et al.Her-2 overexpression increases the metastatic outgrowth of breastcancer cells in the brain. Cancer Res 2007;67:4190–8.

26. Palmieri D, Lockman P, Thomas F, Hua E, Herring J, Hargrave E, et al.Vorinostat inhibits brain metastatic colonization in a model of triple-negative breast cancer. Clin Cancer Res 2009;15:6148–57.

27. Gril B,Palmieri D,Bronder JL,Herring JM,Vega-Valle E, FeigenbaumL,et al. Effect of lapatinib on the outgrowth of metastatic breast cancercells to the brain. J Natl Cancer Inst 2008;100:1092–103.

28. Nagy P, Friedlander E, TannerM, Kapanen A, Carraway K, Isola J, et al.Decreased accessibility and lack of activation of ErbB2 in JIMT-1, aherceptin-resistant, MUC4-expressing breast cancer cell line. CancerRes 2005;65:473–82.

29. Ingold B, Schraml P, Heppner F, Moch H. Homogeneous MGMT immu-noreactivity correlates with an unmethylated MGMT promoter status inbrain metastases of various solid tumors. PloS ONE 2009;4:e4775.

30. Hirst T, Vesterinen H, Sena E, Egan K, McleodM, Whittle I. Systematicreview andmeta-analysis of temozolomide in animalmodels of glioma:was clinical efficacy predicted? Br J Cancer 2013;108:64–71.

31. Donawho C, Luo Y, Luo Y, Penning T, Bauch J, Bouska J, et al. ABT-888, an orally active Poly (ADP-Ribose) polymerase inhibitor thatpotentiates DNA-damaging agents in preclinical tumor models. ClinCancer Res 2007;13:2728–37.

32. Heyn C, Ronald J, MacKenzie L, MacDonald I, Chambers A, Rutt B,et al. In vivo magnetic resonance imaging of single cells in mousebrains with optical validation. Magn Reson Med 2006;55:23–9.

33. Koninki K, Barok M, Tanner M, Staff S, Pitkanen J, Hemmila P, et al.Multiple molecular mechanisms underlying trastuzumab and lapatinibresistance in JIMT-1 breast cancer cells. Cancer Lett 2010;294:211–9.

34. Dziadzusko R, Ardizzoni A, Postmus P, Smit E, Price A, Debruyne C,et al. Temozolomide in patients with advanced non-small cell lungcancer with and without brain metastases: a phase II study of theEORTC LUng Cancer Group (08965). Eur J Cancer 2003;39:1271–6.

35. Paul M, Summers Y, Calvert A, Rustin G, Brampton M, Thatcher N,et al. Effect of temozolomide on central nervous system relapse inpatients with advanced melanoma. Melanoma Res 2002;12:175–8.

36. Siena S, Crino L, Danova M, DelPrete S, Cascinu S, Salvagni S, et al.Dose-dense temozolomide regimen for the treatment of brain metasta-ses ofmelanoma, breast cancer, or lung cancer not amenable to surgeryor radiosurgery:amulticenterphase II study.AnnOncol2010;21:655–61.

37. Abrey L, Olson J, Raizer J, Mack M, Rodavirch A, Boutros D, et al. Aphase II trial of temozolomide for patients with recurrent or progressivebrain metastases. J Neurooncol 2001;53:259–65.

38. Larkin J,HughesS,BeirneD, Patel P,Gibbens I, BateS, et al. A phase I/II study of lumustine and temozolomide in aptients with cerebralmetastases from malignant melanoma. Br J Cancer 2007;96:44–8.

39. Christodoulou C, Bafaloukos D, Linardou H, Aravantinos G, Bamias A,Carina M, et al. Temozolomide (TMZ) combined with cisplatin (CDDP)in patientswith brainmetastses of solid tumors: aHellenicCooperativeOncology Group (HeCOG) phase II study,. J Neurooncol 2005;71:61–5.

40. Azambuja Ed, Zardavas D, Lemort M, Rossari J, Moulin C, Buttice A,et al. Phase I trial combining temozolomide plus lapatinib for thetreatment of brain metastases in patients with HER2-positive meta-static breast cancer: the LAPTEM trial. Ann Oncol 2013;24:1–5.

41. Verger E, Gil M, Yaya R, Vinolas N, Villa S, Pujol T, et al. Temozolomideand concomitant whole brain radiotherapy in patients with brainmetastases: a phase II randomized trial. Int J Rad Oncol Biol Physics2005;61:185–91.

42. ChuaD, KrzakowskiM, Chouaid C, PallottaM,Martinez J, GottfriedM,et al. Whole-brain radiation therapy plus concomitant temozolomidefor the treatment of brain metastases from non–small cell lung cancer:a randomized, open-label phase II study. Clin Lung Cancer 2010;11:176–81.

43. Addeo R, Rosa CD, Faiola V, Leo L, Cennamo G, MOntella L, et al.Phase 2 trial of temozolomide using protracted low-dose and whole-brain radiotherapy for nonsmall cell lung cancer and breast cancerpatients with brain metastases. Cancer 2008;113:2524–31.

44. Fitzgerald D, Palmieri D, Hua E, Hargrave E, Herring J, Qian Y, et al.Reactive glia are recruited by highly proliferative brain metastases of


Palmieri et al.




breast cancer and promote tumor cell colonization. Clin Exp Metast2008;25:799–810.

45. Sharp J, Bouffet E, Stempak D, Gammon J, Stephens D, Johnston D,et al. Amulti-centreCanadian pilot studyofmetronomic temozolomidecombined with radiotherapy for newly diagnosed paediatric brainstemglioma. Eur J Cancer 2010;46:3271–9.

46. Pouratian N, Gasco J, Sherman J, Shaffrey M, Schiff D. Toxicity andefficacy of protracted low dose temozolomide for the treatment of lowgrade gliomas. J Neurooncol 2007;82:281–8.

47. Lashkari H, Saso S, Moreno L, Athanasiou T, Zacharoulis S. Usingdifferent schedules of temozolomide to treat low-grade gliomas:systematic review of their efficacy and toxicity. J Neurooncol 2011;105:135–47.

48. Karayan-Tapon L, Quillien V, Guilhot J, Wagner M, Fromont G, SaikaliS, et al. Prognostic value of O6-methylguanine-DNA methyltransfer-ase status in glioblastoma patients, assessed by five different meth-ods. J Neurooncol 2010;97:311–22.

49. Christmann M, Nagel G, Horn S, Krahn U, Wiewrodt D, Sommer C,et al. MGMT activity, promoter methylation and immunohistochem-istry of pretreatment and recurrent malignant gliomas: a compar-ative study on astrocytoma and glioblastoma. Int J Cancer 2010;127:2106–18.

50. Slotman B, Faive-Finn C, Kramer G, Rankin E, SneeM, HattonM, et al.Prophylactic cranial irradiation in extensive small-cell lung cancer.New Engl J Med 2007;357:664–72.

51. Steeg P. The right trials. Nature 2012;485:S58–9.






Profound Prevention of Experimental Brain Metastases of Breast Cancer by Temozolomide in an...

Documents

Transcript of Profound Prevention of Experimental Brain Metastases of Breast Cancer by Temozolomide in an...