ORIGINAL PAPER

Molecular characterization and expression patternof three zona pellucida 3 genes in the Chinese sturgeon,Acipenser sinensis

Li Chuang-Ju • Wei Qi-Wei • Chen Xi-Hua •

Zhou Li • Cao Hong • Gan Fang • Gui Jian-Fang

Received: 22 July 2010 / Accepted: 29 October 2010 / Published online: 12 November 2010

� Springer Science+Business Media B.V. 2010

Abstract Chinese sturgeon (Acipenser sinensis) is

a rare and endangered species and also an important

resource for the sturgeon aquaculture industry.

SMART cDNAs were synthesized from the ovary of

A. sinensis, and the full-length cDNAs of three zona

pellucida glycoprotein 3 genes (the new gene named

AsZP3) were cloned and sequenced. AsZP3.1,

AsZP3.2, and AsZP3.3 were 1,388 base pairs (bp),

1,288, and 1,290 bp in length, respectively, and they

could be translated into proteins with 440, 394, and 398

amino acids, respectively. High level of amino acids

sequence identity was seen between AsZP3.2 and

AsZP3.3 (about 82%), but they share low identity with

AsZP3.1 (26 and 23%, respectively). The AsZP3.1 has

42–50% amino acids sequence identity values with

other fish and lower values with higher vertebrates

(38%); AsZP3.2 and AsZP3.3 shared about 30–44%

sequence identity with higher vertebrates and other

fish. RT–PCR analysis indicated that AsZP3.1 dis-

played a wide tissue distribution at the mRNA levels

including liver, kidney, spleen, heart, and ovary, but

AsZP3.2 and AsZP3.3 mRNAs were expressed exclu-

sively in the gonad. All three AsZP3 mRNAs were not

detected during embryogenesis and early larval devel-

opment; furthermore, they were not detected in the

gonads of 1- and 2-year-old Chinese sturgeons. All

three AsZP3 mRNAs were detected in the testes of

3-year-old males and in the ovaries of 4- and 5-year-old

female Chinese sturgeons.

Keywords Chinese sturgeon � Zona pellucida

protein 3 � Gene expression � RT–PCR

Abbreviations

Cys Cysteine

RT–PCR Reverse transcriptase polymerase chain

reaction

Ser Serine

SMART Switching mechanism at 50-end of RNA

transcript

TMD Transmembrane domain

ZP Zona pellucida

L. Chuang-Ju � W. Qi-Wei � C. Xi-Hua (&) � G. Fang

Key Laboratory of Freshwater Biodiversity Conservation

and Utilization, Ministry of Agriculture of China,

Yangtze River Fisheries Research Institute,

Chinese Academy of Fisheries Science,

Jingzhou 434000, China

e-mail: chenxh@yfi.ac.cn

Z. Li � G. Jian-Fang

State Key Laboratory of Freshwater Ecology and

Biotechnology, Wuhan Center for Developmental

Biology, Institute of Hydrobiology,

Chinese Academy of Sciences, Wuhan 430072, China

L. Chuang-Ju � W. Qi-Wei � C. Xi-Hua

Freshwater Fisheries Research Center, Chinese Academy

of Fisheries Science, Wuxi 214081, China

C. Hong

College of Life Sciences, Wuhan University,

Wuhan 430072, China

123

Fish Physiol Biochem (2011) 37:471–484

DOI 10.1007/s10695-010-9448-x

UTR Untranslated region

RACE Rapid amplification of cDNA ends

Introduction

During the growth of the ovarian follicle, vertebrate

eggs are surrounded by an extracellular matrix called

the chorion in fish, the vitelline envelope in amphib-

ians, the perivitelline envelope in reptiles and birds,

and the zona pellucida in mammals. This matrix

consists of two-four major glycoproteins named zona

pellucida (ZP) proteins (Wassarman 2008).

The ZP proteins are characterized by a conserved

motif named ZP domain, which was first identified by

Bork and Sander (1992). ZP domain is a large domain

(about 260 amino acid residues) and contains eight

cysteine (Cys) residues and conserved internal hydro-

phobic patch, which plays an important role in the

secondary and tertiary structures of the ZP protein

(Bork and Sander 1992). ZP proteins are encoded by

multiple gene families and can be divided into six

subfamilies: the ZPA/ZP2 subfamily, the ZPB/ZP4

subfamily, the ZPC/ZP3 subfamily, the ZP1 subfam-

ily, the ZPAX subfamily, and the ZPD subfamily

(Goudet et al. 2008). The mammalian genome contains

three to four ZP genes, the Xenopus genome contains

five ZP genes, and the chicken genome contains six

ZP genes. In fish, there are at least seven genes

encoding ZP proteins, with ZPC being in particular

highly duplicated in medaka and zebrafish (Goudet

et al. 2008). ZP proteins play important roles during

fertilization and in the prevention of polyspermy

(Spargo and Hope 2003; Wassarman 2008). In mam-

mals, ZP3 proteins function as the primary sperm

receptors and induce the acrosome reaction, while ZP2

proteins function as the secondary sperm receptors and

ZP1 proteins provide structural integrity of the egg

membrane and may also be involved in sperm binding

(Dean 2004; Hoodbhoy and Dean 2004).

Since fish ZP3 cDNA molecules were first char-

acterized in medaka, Oryzias latipes (Murata et al.

1995), cDNA cloning and sequencing of ZP3 have

been reported in a number of fish species, such as

gilthead sea bream, Sparus aurata (Del Giacco et al.

1998; Modig et al. 2006), zebrafish, Danio rerio

(Wang and Gong 1999; Del Giacco et al. 2000),

common carp, Cyprinus carpio (Chang et al. 1996),

gyno-crucian and gono-crucian carp (Fan et al. 2001),

rainbow trout, Oncorhynchus mykiss (Hyllner et al.

2001), and half-smooth tongue sole, Cynoglossus

semilaevis (Sun et al. 2010). In recent years, based on

available genome sequence and subtractive cDNA

libraries, more ZP3 gene isoforms were character-

ized. For instance, there are another five ZP3 genes

detected both in zebrafish and in medaka (Kanamori

et al. 2003; Liu et al. 2006).

The synthesis sites and the regulation of the

synthesis of ZP3 protein vary from species to species.

ZP proteins are synthesized mainly in the liver of some

teleost species (Lyons et al. 1993; Hamazaki et al.

1989; Shimizu et al. 1998; Kanamori et al. 2003;

Hyllner et al. 2001) in contrast to chicken, gilthead

seabream, mouse, Xenopus, carp, and zebrafish

(Waclawek et al. 1998; Epifano et al. 1995; Yamaguchi

et al. 1989; Chang et al. 1996, 1997; Wang and Gong

1999). In chicken, the synthesis occurs both in the

granulosa cells (Waclawek et al. 1998) and in the liver

(Bausek et al. 2000), whereas mouse, human (Epifano

et al. 1995; Wassarman et al. 2004), and Xenopus

(Yamaguchi et al. 1989) synthesize ZP proteins in the

oocytes. In carp (Chang et al. 1996, 1997) and zebrafish

(Wang and Gong 1999), the synthesis of ZP proteins

takes place in the ovary. In gilthead seabream, the

mRNA of ZP3 gene was found in both liver and ovary

(Modig et al. 2006). Recently, in half-smooth tongue

sole, two ZP3s genes showed a more wide tissue

distribution other than ovary and liver (Sun et al. 2010).

Chinese sturgeon (Acipenser sinensis) is one of

the Acipenseriformes, with an evolutionary history of

over 200 million years (Wei et al. 1997; Birstein

et al. 1997). Comparable to other sturgeon species, its

stock has declined dramatically due to overfishing,

loss of natural habitat for reproduction, and other

anthropogenic interferences (Wei et al. 1997; Billard

and Lecointre 2001; Chen 2007). To save this species

more efficiently and to be able to develop an

aquaculture industry, artificial propagation has been

attempted since 1983. This task is rather difficult,

because so far little is known about the regulation

mechanism of growth and reproduction in the Chi-

nese sturgeon. Recently, we have established a

systematic molecular study in the Chinese sturgeon

and identified some important genes relate to growth,

development, and reproduction, such as somatostatins

1 and 2 (Li et al. 2009), three gonadotropin subunits

common a, FSHb, and LHb (Cao et al. 2009), growth

472 Fish Physiol Biochem (2011) 37:471–484

123

hormone/prolactin family, thyroid-stimulating hor-

mone subunit b (TSHb), insulin-like growth factor I

(IGF-I), and five ZP protein genes (ZPAX, ZPB, and

three ZP3s). In the present study, AsZP3.1, AsZP3.2,

and AsZP3.3 were cloned and characterized from the

ovary of the Chinese sturgeon. Moreover, the expres-

sion patterns of the three ZP3 genes were also

characterized in the tissues of females, in the embry-

onic and larval development stages, and in the ovaries

and the testes of 1- to 5-year-old Chinese sturgeons.

Materials and methods

Animals and samples

All animals used in this study were cultured Chinese

sturgeons from Taihu station, Yangtze River Fisher-

ies Research Institute, Chinese Academy of Fisheries

Science. Deep anesthesia was induced by a 0.05%

solution of MS-222 (Sigma, USA). The tissues

samples from three 4-year-old female Chinese stur-

geons (about 1.55 m in length and 20 kg in weight)

were collected within 30 min of exsanguinations by

tailing and immediately dipped into liquid nitrogen

and stored at -80�C. To study the ontogenetic

expression profiles, fertilized embryos and larvae

from different stages were identified, collected in

liquid nitrogen, and stored at -80�C. Ten individuals

of 1-, 2-, 3-, 4-, and 5-year-old Chinese sturgeon (two

individuals per age group) were used for temporal

transcriptional expression analysis. One-year-old

individuals were a female and a male; 2- and 3-

year-old were male; 4- and 5-year-old were female

(data not shown). The average length and weight of

individuals in each age group were 0.60 m and

0.92 kg, 1.02 m and 5.25 kg, 1.22 m and 8.4 kg,

1.26 m and 8.3 kg, 1.30 m and 11.9 kg, respectively.

The experimental procedures are based on the

standards of the Chinese Council on Animal Care.

RNA extraction and SMART cDNA synthesis

Total RNA was extracted using SV total RNA

isolation system (Promega, USA). The quality of

RNAs was measured at A260 nm and the purity from

the ratio A260:A280 nm (Eppendorf Biometer).

Double-strand cDNAs were synthesized and ampli-

fied according to the reports described previously

(Li et al. 2005) using the Switching Mechanism at

50-end of RNA Transcript (SMART) cDNA Library

synthesis Kit (Clontech). Briefly, 100 ng of total

RNAs was reverse-transcribed at 42�C for 1 h in the

presence of both cDNA synthesis primer and

SMART II oligonucleotide. And 2 lL of first-strand

reaction product was used in each 100 lL long-

distance PCR system containing 0.2 lM PCR primer.

The LD-PCR parameters were 95�C for 5 s and 68�C

for 6 min on PTC-100 thermal cycler for 15 cycles.

Five microliters of PCR products was separated and

checked by electrophoresis on 1% agarose gels

containing ethidium bromide.

Cloning and sequencing

The AsZP3 cDNAs were amplified by 30- and 50-RACE (rapid amplification of cDNA ends) as

described previously (Li et al. 2005). Degenerate

sense and antisense primers were designed and

synthesized according to a nucleotide alignment of

different ZP3 cDNAs including nearly all the animals

that could be got from the GenBank at NCBI website.

The 30-end of AsZP3.1, AsZP3.2, and AsZP3.3

cDNAs was amplified using specific sense primers

and a PCR anchor primer corresponding to the

terminal anchor sequence of the cDNA. The 50-end of

the cDNA was amplified with a 50-PCR anchor

primer and specific antisense primer. All PCRs were

performed on a PTC-100 thermal cycler by denatur-

ation at 94�C for 4 min, followed by 35 cycles of

amplification at 94�C for 30 s, 56�C for 40 s, and

72�C for 2 min and an additional elongation at 72�C

for 7 min after the last cycle. The PCR mixture

contained 1 U Taq DNA polymerase (MBI, USA)

together with 0.2 mM of each dNTPs, a suitable

reaction buffer (MBI), 1.5 mM MgCl2, 15 pmol of

each primer, and 2 lL diluted SMART cDNA. The

amplified DNAs were visualized by electrophoresis

of ethidium bromide–stained agarose gel, cloned into

pMD18-T vector (Takara, Japan), and sequenced.

Database and sequence analysis

Nucleotide and amino acid sequence identity were

performed using the BLAST program (GenBank,

NCBI). The glycosylation sites and the cleavage site

for the putative signal peptide were predicted using

NetNGlyc 1.0, YinOYang 1.2 and Signal P software

Fish Physiol Biochem (2011) 37:471–484 473

123

at ExPASy Molecular Biology Server (http://www.

expasy.pku.edu.cn). Multiple alignments were per-

formed with the MAP method at BCM Search

Launcher web servers (http://searchlauncher.bcm.tmc.

edu/), and the printing output was shaded by BOX-

SHADE 3.21 (http://www.ch.embnet.org/software/

BOX_form.html). Phylogenetic analysis was per-

formed using mega4.1 molecular evolutionary genetic

analysis software package by bootstrap analysis 1,000

replicates using neighbor joining. The following ZP3

proteins (acronym, GenBank accession number) were

included in the analysis: Homo sapiens (HsZP3,

AAA61336); Rattus norvegicus (RnZP3, NP_446214);

Gallus gallus (GgZP3, NP_989720); Xenopus tropi-

calis (XtZP3.1, NP_001081657; XtZP3.2, AAI58454);

C. carpio (CcZP3, CAA88836); Carassius gibelio

(CgZP3, AAD53947); D. rerio (DrZP3, NP_571406;

DrZP3a.1, AAI16532; DrZP3a.2, NP_001025291;

DrZP3b, AAH67692; DrZP3c1, CAX14369; DrZP3c2,

CAP09495); Anguilla japonica (AjeSRS4, BAA36593);

O. latipes (OlZPC1, NP_001098218; OlZPC2,

AAN31189; OlZPC3, NP_001098219; OlZPC4, NP_

001098220; OlZPC5, AAD38910); C. semilaevis

(CsZP3a, ABY81290; CsZP3b, ABY81291); A. sin-

ensis (AsZP3.1, ACO54852; AsZP3.2, ACO54853;

AsZP3.3, HM067972).

Spatial and temporal expression analyses

of the AsZP3.1, AsZP3.2, and AsZP3.3

For reverse transcription polymerase chain reaction

(RT–PCR), total RNA extracted from different

tissues (including liver, kidney, spleen, fat, heart,

intestines, ovary, pituitary, hypothalamus, telenceph-

alon, midbrain, cerebellum, and medulla oblongata)

from three 4-year-old cultured Chinese sturgeons was

isolated using SV Total RNA Isolation System

according to the manufacturer’s instructions (Pro-

mega, USA). Total RNAs of embryos at the first

cleavage, multicellular stage, blastula stage, gastrula

stage, blastopore stage, tail bud stage, rudiment of

heart stage, muscle contract stage, heartbeat stage,

head to tail stage, pre-hatching stage, and 1-day

larvae were isolated. Total RNAs of gonads isolated

from 10 individuals of 1-, 2-, 3-, 4-, and 5-year-old

Chinese sturgeon were used for temporal transcrip-

tional expression analysis. The quality and purity of

the RNAs were checked by electrophoresis of the

samples in a 1% agarose gel with ethidium bromide

staining and quantified by the ratio A260:A280 nm

(Eppendorf Biometer). The gonad samples were also

fixed in Bouin’s solution and subsequently processed

for light microscopy. Paraffin sections of 8 lm were

stained with hematoxylin and eosin. The terminology

used for the Chinese sturgeon gonad differentiation

was described in our previous studies (Chen et al.

2004).

Hundred nanograms of total RNAs was reverse-

transcribed with M-MLV Reverse Transcriptase and

oligo d (T)15 (Promega, USA) as described by the

manufacturer. All of the resultant cDNAs were

diluted 1:10 and then used as templates. The primer

pairs, AsZP3.1-F/AsZP3.1-R, AsZP3.2-F/AsZP3.2-R,

and AsZP3.3-F/AsZP3.3-R (Table 1), were designed

to detect the differentially expressed pattern

of AsZP3.1, AsZP3.2, and AsZP3.3, respectively.

Amplification reactions were performed in volume

of 25 lL containing 1 lL cDNA as template DNA,

0.5 lM each primer, 0.5 U Taq polymerase (MBI,

Fermentas), 0.1 lM of each dNTP, 19 buffer for Taq

polymerase (MBI). Each PCR cycle included dena-

turation at 94�C for 30 s, annealing at 55�C for 40 s,

and extension at 72�C for 40 s. As a positive control

for the RT–PCR analysis, Asb-actin was amplified by

primers Asb-actin-F/Asb-actin-R (Table 1) to deter-

mine the template concentration and to provide an

external control for PCR reaction efficiency under the

same reaction conditions as AsZP3s. The RT–PCR

was carried out as described previously (Wang et al.

2004). Briefly, 10 duplicate reactions were performed

by alternate cycle numbers from 15 to 33 to ensure

that the semi-qualitative RT–PCR products were in a

linear range of accumulation. After the cycle number

was optimized, temporal and spatial expression

analysis of AsZP3 was completed by RT–PCR from

different samples. Thirty-one cycles were performed,

followed by a final extension at 72�C for 7 min. Each

experiment was repeated three times.

Results

Cloning of the full-length cDNA of AsZP3.1,

AsZP3.2, and AsZP3.3

To isolate ZP3 homolog from the Chinese sturgeon,

we designed a pair of degenerate primers against the

conserved regions of ZP domains. Three fragments

474 Fish Physiol Biochem (2011) 37:471–484

123

showing high level of sequence identity with verte-

brate ZP3 proteins were produced from the SMART

cDNAs of the ovary of Chinese sturgeon. Following

the fragment sequence, we cloned and sequenced the

full-length cDNAs of AsZP3.1, AsZP3.2, and

AsZP3.3 using RACE strategy. The cDNA sequences

and deduced amino acid sequences were shown in

Fig. 1. The AsZP3.1 cDNA is 1,388 bp in total length

(poly (A) tail excluded) and consists of 29-bp

50-untranslated region (UTR), a coding sequence of

1,323 bp, and a 36-bp 30-UTR. A consensus polyad-

enylation signal (AATAAA) was found at 10 bp

upstream from the poly (A) tail. The cleavage site for

the putative signal peptide was predicted by means of

Signal P and was located between amino acid

position -1 and 1. The proposed mature peptide

AsZP3.1 contains a putative N-linked glycosylation

site at residue Asn144 and an O-linked glycosylation

site at residue Thr414 (Fig. 1a).

The AsZP3.2 cDNA is 1388 bp in total length

(poly (A) tail excluded) and has an open reading

frame of 1,185 bp, starting with the first ATG codon

at position 18 and ending with a stop TGA codon at

position 1202. A consensus polyadenylation signal

(AATAAA) is located 11 bp upstream from the poly

(A) tail. When a signal peptide of 20 amino acids is

removed, the proposed mature AsZP3.2 consists of

374 amino acids residues. AsZP3.2 contains a puta-

tive N-linked glycosylation site at residue Asn241, but

not any latent O-linked glycosylation site predicted

(Fig. 1b).

The full-length cDNA of AsZP3.3 contains

1,289 bp (poly (A) tail excluded) and has an open

reading frame of 1,194 bp that begins from the start

codon (ATG) at position 23 and ends with a stop

codon (TGA) at position 1216. A putative polyade-

nylation signal (AATAAA) was found at 8 bp

upstream from the poly (A) tail. The 1,194-bp coding

region encodes a mature peptide of 377 amino acids

and a 20 amino acid signal peptide. The mature

peptide of AsZP3.3 contains a putative N-linked

glycosylation site at residue Asn68 and six O-linked

glycosylation sites at residue Ser5, Ser42, Thr138,

Thr174, Ser268, and Ser365 (Fig. 1c).

The identity of the cDNA sequence between

AsZP3.2 and AsZP3.3 was about 86%, but both

AsZP3.2 and AsZP3.3 showed low sequence identity

with AsZP3.1 (both about 48%, data not shown).

Similarly, AsZP3.2 and AsZP3.3 shared 82% of

amino acid sequence identity, but they showed low

identity with AsZP3.1 (26 and 23%, respectively,

Fig. 2a).

Comparison and phylogenetic analysis

of the ZP3s of the Chinese sturgeon and other

vertebrates

Alignments and identities of the deduced AsZP3s

amino acid sequences were compared with those of

other well-studied species including fish, amphibian,

and mammals. Gaps were introduced for the maxi-

mum alignment of these sequences. AsZP3.1 has 46,

44, 46, and 40% amino acid sequence identities to

that of zebrafish, frog, chicken, and human, respec-

tively (Fig. 2a). AsZP3.1, AsZP3.2, and AsZP3.3 had

a ZP domain with 258, 244, and 247 amino acid

residues, respectively. The longest stretch of very

high similarity is only found in the ZP domain, in

which eight Cys residues, one N-linked glycosylation

site, and internal hydrophobic patch were highly

conserved in terms of both number and location as

other ZP3 proteins (Fig. 2a).

Phylogenetic tree of vertebrate ZP3 proteins

was determined to clarify AsZP3s status in the

Table 1 Specific primers

used for RT–PCR analysis

in the present study

Primers Sequence (50–30) Production size (bp)

AsZP3.1-RTF CTCACCCTGGCTCGGTTCTC 192

AsZP3.1-RTR AGCTGACCGATACCGAACAG

AsZP3.2-RTF ATCGTCCTGTTTTCACGATG 219

AsZP3.2-RTR TGCAGAGTGTTGTAGCTGCC

AsZP3.3-RTF GATAACTGTTGGTTTGGAAG 233

AsZP3.3-RTR ACCACCATGTTATTACCGGC

Asb-actin-F TTATGCCCTGCCCCACGCTATC 201

Asb-actin-R CGTGTGAAGTGGTAAGTCCGT

Fish Physiol Biochem (2011) 37:471–484 475

123

evolutionary history. As shown in Fig. 2b, two

zebrafish ZP3 variants (DrZP3c1 and DrZP3c2) are

separated from other vertebrate ZP3 proteins that are

grouped into two clades. One branch clade consists of

two AsZP3s (AsZP3.2 and AsZP3.3), OlZPC1,

OlZPC2, CsZP3b, and XtZP3.2. In the other clade,

OlZPC3 is separated from other ZP3s, and AsZP3.1 is

grouped with higher vertebrates ZP3s including frog,

chicken, rat, and human while other fish ZP3s

grouped together (Fig. 2b).

Fig. 1 Nucleotide and

deduced amino acids of the

Chinese sturgeon AsZP3.1(a), AsZP3.2 (b), and

AsZP3.3 (c). The first amino

acid of the mature peptide is

in bold and numbered as

?1; amino acids of the

signal peptide are

underlined and given

negative numbers. Putative

N-linked glycosylation site

at Asn144 of AsZP3.1,

Asn241 of AsZP3.2, and

Asn68 of AsZP3.3 and

O-linked glycosylation site

at Thr414 of AsZP3.1 and

Ser5, Ser42, Thr138, Thr174,

Ser268, and Ser365 of

AsZP3.3 are shaded.

Consensus polyadenylation

signals AATAAA are

boxed. The primers used in

RT–PCR analysis were

marked by forward and

reverse arrows under the

nucleotide sequence. The

nucleotide sequences of

AsZP3.1, AsZP3.2, and

AsZP3.3 have been

deposited in the GenBank

nucleotide database, under

accession nos. FJ610233,

FJ610234, and HM067972,

respectively

476 Fish Physiol Biochem (2011) 37:471–484

123

Tissue distribution of AsZP3.1, AsZP3.2,

and AsZP3.3 mRNAs

Following cloning and characterization of AsZP3.1,

AsZP3.2, and AsZP3.3 cDNAs, their expression

patterns were analyzed among different tissues by

RT–PCR at mRNA levels. Total RNAs were isolated

from the tissues of three 4-year-old female Chinese

sturgeons, including liver, kidney, spleen, fat, heart,

intestines, ovary, pituitary, hypothalamus, telenceph-

alon, midbrain, cerebellum, and medulla oblongata.

Three primers specific to AsZP3.1, AsZP3.2, and

Fig. 1 continued

Fish Physiol Biochem (2011) 37:471–484 477

123

AsZP3.3 were designed for RT–PCR analysis, and the

amplified fragment were 192, 219, and 233 bp,

respectively (Fig. 1). RT–PCR analysis indicated that

the AsZP3.1 mRNAs were detected abundantly in

ovary and poorly in liver, kidney, spleen, and fat, and

no signals were detected from other tissues (Fig. 3a).

Unlike AsZP3.1, both AsZP3.2 and AsZP3.3 mRNAs

were transcribed in the ovary, whereas no AsZP3.2

and AsZP3.3 transcripts are detected in other tissues

examined (Fig. 3b, c). As-bactin mRNA, used as a

control for gene expression, was expressed in all

tissues investigated.

Fig. 1 continued

478 Fish Physiol Biochem (2011) 37:471–484

123

Fig. 2 a Alignment of the predicted amino acid sequences of

AsZP3 s and other vertebrates. Multiple alignments were

performed with the MAP method at BCM Search Launcher

web servers, and the printing output was shaded by BOX-

SHADE 3.21. Identical residues are in black, and conservative

substitutions are in gray. The 8 Cys residues in ZP domain are

shaded and numbered accordingly. The conserved amino acids

of internal hydrophobic patch are shown by asterisks above the

sequence. One conserved N-linked glycosylation site is shown

by a line above the sequence. Numbers of residues are shown at

the left margin. The two black arrows indicate positions for

degenerate primers design. b Unrooted neighbor-joining

phylogenetic trees of the ZP3 protein of fish and higher

vertebrates. The horizontal branch lengths are proportional to

the estimated divergence of the sequence from the branch

point. The sequences were extracted from GenBank databases

as listed in ‘‘Materials and methods’’ section

Fish Physiol Biochem (2011) 37:471–484 479

123

Expression patterns of AsZP3.1, AsZP3.2,

and AsZP3.3 during embryogenesis

According to the cDNA sequence, we employed

RT–PCR to investigate the temporal expression

patterns of AsZP3.1, AsZP3.2, and AsZP3.3 during

embryogenesis. The results showed that all three

AsZP3 mRNAs were not detected from embryos at

the first cleavage to one-day larvae (data not shown);

Expression characterization of AsZP3.1, AsZP3.2,

and AsZP3.3 in immature Chinese sturgeons

To investigate the relationship of AsZP3.1, AsZP3.2,

and AsZP3.3 expression with gonad development, we

further analyzed the mRNA expression levels of the

three AsZP3s in the gonads of the Chinese sturgeons

at different development stages. The total RNAs were

isolated from the gonads of ten 1- to 5-year-old

Chinese sturgeons, each year two specimen. Histo-

logical observation showed that two 1-year-old

individuals were a female and a male; 2- and

3-year-old individuals were males; and 4- and

5-year-old individuals were females. In fact, we

observed microscopic characteristics of gonad tissues

in the immature individuals. The primary spermato-

cytes had formed in the testicular tissues of 2-year-

old males (Fig. 4a). In 3-year-old males, the testis

seems to differentiate, and some primary spermato-

cytes existed in differentiated lobules (Fig. 4b).

Interestingly, in the ovarian tissues of 5-year-old

females, the primary oocytes were small and its

diameter was 350–400 lm (Fig. 4c), while ovarian

tissues of the ovary of 4-year-old females had larger

primary oocyte with the diameter from 500 to

1,000 lm (Fig. 4d).

The expression pattern of three AsZP3 s in 1- to

5-year-old immature individuals was detected by

RT–PCR. As shown in Fig. 5, all three AsZP3

mRNAs were not detected in the ovaries and testes

of 1- and 2-year-old Chinese sturgeons. To our

surprise, AsZP3.1, AsZP3.2, and AsZP3.3 showed a

A

B

C

DAsZP3.3

AsZP3.2

AsZP3.1

L K S F H O P Hy Te Md Ce Mo I C M 2000bp

750b

100bp

500bp 250bp

500bp 250bp

2000bp

500b250bp 100bp

1000bp

750bp

2000bp

2000bp

500b250bp 100bp

1000bp

As -actinββ

Fig. 3 AsZP3.1 (a),

AsZP3.2 (b), and AsZP3.3(c) tissue distribution

detected by RT–PCR.

Asb-actin (d) was used as

RT-PCR control. M is the

2-kb DNA Ladder marker.

L liver; K kidney; S spleen;

F fat; H heart; I intestines;

O ovary; P pituitary;

Hyhypothalamus;

Te telencephalon;

C cerebellum;

MB midbrain; Mo medulla

oblongata; C blank control

CcZP3

CgZP3

DrZP3

DrZP3a.2

DrZP3a.1

AjeSRS4

AsZP3.1

XtZP3.1

GgZP3

HsZP3

RnZP3

CsZP3a

DrZP3b

XtZP3.2

CsZP3b

OlZPC2

AsZP3.2

AsZP3.3

DrZP3c2

DrZP3c1

100

100

100

97

72

98

100

92

100

100

100

95

81

84

52

51

100

0.2

B

Fig. 2 continued

480 Fish Physiol Biochem (2011) 37:471–484

123

high expression level in the testes of 3-year-old male

Chinese sturgeons (Fig. 5). AsZP3.1 and AsZP3.3

showed almost the same expression pattern in the

ovaries of 4- and 5-year-old Chinese sturgeons,

keeping on a relatively stable level (Fig. 5a, c), while

the AsZP3.2 mRNA expression level in 4-year-old

female Chinese sturgeons with large primary oocyte

is higher than that of 5-year-old Chinese sturgeons

with small primary oocyte (Fig. 5b).

Discussion

In the present study, we cloned and characterized

three ZP3 genes of the Chinese sturgeon, AsZP3.1,

AsZP3.2, and AsZP3.3. All three AsZP3 genes are

transcribed both in the ovary and in the testis, but

AsZP3.1 displayed a more wide tissue distribution.

We also show the expression patterns of the three

AsZP3 genes in the ovaries and in the testes of 1- to

5-year-old Chinese sturgeons.

Alignment of the three AsZP3 proteins with that of

other vertebrate species indicates that the ZP domains

of these proteins are highly conserved. All of the

eight Cys residues, internal hydrophobic patch, and

one N-linked glycosylation site of the ZP domain are

highly conserved among vertebrate species examined

(Fig. 2a). AsZP3.1 protein has only one O-linked

glycosylation site just like common carp (Chang et al.

1996) and AsZP3.2 protein has no one like zebrafish

(Wang and Gong 1999), while AsZP3.3 has more

than three sites (six) like gibel carp (five sites, Fan

et al. 2001). The C-terminus of mammalian ZP

proteins has a transmembrane domain (TMD), which

is rich in hydrophobic amino acid and anchors the ZP

protein in the membrane (Wassarman 2008). In our

Fig. 4 Histological characteristics of testicular tissues in immature males at 2 year (a) and 3 year (b) of age and of ovarian tissues in

immature females at 4 year (c) and 5 year of age (d). PS primary spermatocytes; PO primary oocytes

Fish Physiol Biochem (2011) 37:471–484 481

123

study, all three AsZP3 s produced in the ovary also

lack a C-terminus as well as other teleosts. In fact,

fish ZP protein precursors can incorporate the egg

coat without a C-terminus TMD (Sugiyama et al.

1999; Hyllner et al. 2001). So it seems that TMD

region of fish ZP proteins does not appear to be

needed for the assembly of ZP proteins that originate

in the oocyte (Modig et al. 2006).

ZPC/ZP3 genes are members of multiple ZP gene

families. It is hypothesized that the ancestral ZPC/

ZP3 gene and the ancestral gene of other ZP genes

including ZPA/ZP2, ZPB/ZP4, ZPD, ZP1, and ZPAX

were produced by gene duplication (Goudet et al.

2008). To date, there are several ZPC/ZP3 genes

identified in fish species. The multiple gene copies of

ZPC/ZP3 genes may be due to both genome and gene

duplication (Conner and Hughes 2003). For example,

in this study, the phylogenetic tree exhibits two

CsZP3s (ZP3a and ZP3b), three AsZP3s (ZP3.1,

ZP3.2, and ZP3.2), five OlZPCs (OlZPC1–OlZPC5),

and six DrZP3s (ZP3, ZP3a.1, ZP3a.2, ZP3b, ZP3c1,

and ZP3c2) genes (Fig. 2b).

It has been reported that the synthetic site of ZP3

protein is either liver or ovary, or both among various

vertebrate species. For instance, medaka (Murata

et al. 1995), rainbow trout (Hyllner et al. 2001), and

gilthead seabream (Del Giacco et al. 1998) synthe-

sized ZP3 protein in liver, which is in contrast to

chickens, mice, Xenopus, crucian carp, goldfish,

common carp, and zebrafish. In chickens, synthesis

occurs in granulose cells (Waclawek et al. 1998);

whereas in mouse, Xenopus, and crucian carp, it

occurs in the oocyte (Fan et al. 2001; Yamaguchi

et al. 1989; Waclawek et al. 1998). In goldfish,

common carp, and zebrafish, the synthesis of ZP3

takes place in the ovary (Wang and Gong 1999).

Recently, in half-smooth tongue sole, two ZP3 s genes

were cloned, and the ZP3a mRNA was detected in

four tissues of females with high expression in the

ovary and kidney and with weak expression in muscle

and spleen (Sun et al. 2010). And ZP3b mRNA had

a wide distribution in most tested tissues of females,

such as ovary, kidney, heart, brain, muscle, spleen,

gill, and intestine; interestingly, the ZP3b mRNA was

slightly detected in the testis and kidney of males

(Sun et al. 2010). In the present study, RT–PCR was

carried out to examine the expression site of the three

AsZP3 s. As shown in Fig. 3, both AsZP3.2 and

AsZP3.3 are synthesized specially in the gonad, while

AsZP3.1 mRNA expressed in much more tissues

including liver, kidney, and fat. The temporal

expression patterns of three AsZP3s in ten 1- to

5-year-old Chinese sturgeons were also carried out by

RT–PCR. We detected the expression of all three

AsZP3s in the testes of two 3-year-old male individ-

uals (Fig. 5), while the earlier observations have

found the liver of male fish can synthesize ZP

proteins induced by estradiol (Murata et al. 1995). So

M O1 T1 T21 T22 T31 T32 O4 1 O 42 O51 O52 C

AsZP3.3

AsZP3.2

AsZP3.1

A

B

C

D

2000bp 750bp

100bp

500bp 250bp

500bp 250bp

2000bp

500bp 250bp 100bp

1000bp

750bp

2000bp

2000bp

500bp 250bp

100bp

1000bp

As -actinβ

Fig. 5 Differential expression of AsZP3.1 (a), AsZP3.2 (b),

and AsZP3.3 (c) mRNAs in different gonad stages of immature

Chinese sturgeons. Lane O1: ovary of 1-year-old Chinese

sturgeon; T1: testis of 1-year-old; T21, T22: testes of 2-year-

old; T31, T32: testes of 3-year-old; O41, O42: ovaries of

4-year-old; O51, O52: ovaries of 5-year-old; M is 2-kb DNA

ladder markers and C is blank control. Asb-actin was amplified

at the same conditions as a positive control in each sample (d)

482 Fish Physiol Biochem (2011) 37:471–484

123

fish ZP3 genes may display a wide tissue distribution

other than ovary and liver. For instance, the eSRS3

(ZPB) and eSRS4 (ZPC) were cloned from the testis

of eel and known to be downregulated with the

initiation of spermatogenesis (Miura et al. 1998). All

three AsZP3s were not detected during embryogen-

esis (data not shown) and in 1- and 2-year-old

individuals with early gonad development, while in

the individuals with developing testis (3-year-old)

and ovary (4- and 5-year-old), the expression of three

AsZP3s were detected (Fig. 5). Furthermore, both

AsZP3.1 and AsZP3.3 showed almost the same

expression pattern in the ovaries of 4- and 5-year-

old Chinese sturgeons, keeping on a relatively stable

level (Fig. 5a, c). But the expression of AsZP3.2

seems to rise with the development of ovary in

female Chinese sturgeons (Fig. 5b). Therefore, it is

reasonable that three AsZP3s take part in the devel-

opment of gonad and may share different roles during

the ovary development of Chinese sturgeon.

In summary, in the present study, we isolated three

AsZP3 genes from the ovary of Chinese sturgeon and

demonstrated that they showed significant sequence

divergence and expression patterns among different

tissues. A more interesting finding is to reveal the

expression patterns of three AsZP3 genes between the

ovaries and testes of 1- to 5-year-old Chinese

sturgeons. These results provide some new informa-

tion for further research of ZP3 gene family.

Acknowledgments This work was supported by National

Nonprofit Institute Research Grant of Freshwater Fisheries

Research Center, Chinese Academy of Fisheries (CAFS); the

director fund of Yangtze River Fisheries Research Institute,

CAFS; grants from the foundation of Key Laboratory of

Freshwater Biodiversity Conservation and Utilization, Ministry

of Agriculture of China (LFBCU0704), the National Natural

Science Foundation of China (30571411), and the Open

project of State Key Laboratory of Freshwater Ecology and

Biotechnology (2008FB007).

References

Bausek N, Waclawek M, Schneider WJ, Wohlrab F (2000)

The major chicken egg envelope protein ZP1 is different

from ZPB and is synthesized in the liver. J Biol Chem

275:28866–28872

Billard R, Lecointre G (2001) Biology and conservation of

sturgeon and paddlefish. Rev Fish Biol Fish 10(4):

355–392

Birstein VJ, Bemis WE, Waldman JR (1997) The threatened

status of acipenseriform species: a summary. Environ Biol

Fish 48:427–435

Bork P, Sander C (1992) A large domain common to sperm

receptors (Zp2 and Zp3) and TGF-beta type III receptor.

FEBS Lett 300:237–240

Cao H, Zhou L, Zhang YZ, Wei QW, Chen XH, Gui JF (2009)

Molecular characterization of Chinese sturgeon gonado-

tropins and cellular distribution in pituitaries of mature

and immature individuals. Mol Cell Endocrinol 303:

34–42

Chang YS, Wang SC, Tsao CC, Huang F (1996) Molecular

cloning, structural analysis, and expression of carp ZP3

gene. Mol Reprod Dev 44:295–304

Chang YS, Hsu CC, Wang SC, Tsao CC, Huang FL (1997)

Molecular cloning, structural analysis, and expression of

carp ZP2 gene. Mol Reprod Dev 46:258–267

Chen XH (2007) Biology and resources of acipenseriform

fishes. China Ocean Press, Beijing (in Chinese)

Chen XH, Wei QW, Yang DG, Zhu YJ, Liu Y (2004) Histo-

logical studies on gonadal origin and differentiation of

cultured Acipenser sinensis. J Fisheries China 28:633–639

(in Chinese)

Conner SJ, Hughes DC (2003) Analysis of fish ZP1/ZPB

homologous genes—evidence for both genome duplica-

tion and species-specific amplification models of evolu-

tion. Reproduction 126:347–352

Dean J (2004) Reassessing the molecular biology of sperm–egg

recognition with mouse genetics. Bioessays 26:29–38

Del Giacco L, Vanoni C, Bonsignorio D, Duga S, Mosconi G,

Santucci A, Cotelli F (1998) Identification and spatial

distribution of the mRNA encoding the gp49 component

of the gilthead sea bream, Sparus aurata, egg envelope.

Mol Reprod Dev 49:58–69

Del Giacco L, Diani S, Cotelli F (2000) Identification and

spatial distribution of the mRNA encoding an egg enve-

lope component of the Cyprinid zebrafish, Danio rerio,homologous to the mammalian ZP3 (ZPC). Dev Genes

Evol 210:41–46

Epifano O, Liang LF, Dean J (1995) Mouse Zp1 encodes a

zona pellucida protein homologous to egg envelope pro-

teins in mammals and fish. J Biol Chem 270:27254–27258

Fan LC, Yang ST, Gui JF (2001) Differential screening and

characterization analysis of the egg envelope glycoprotein

ZP3 cDNAs between gynogenetic and gonochoristic cru-

cian carp. Cell Res 11:17–27

Goudet G, Mugnier S, Callebaut I, Monget P (2008) Phylo-

genetic analysis and identification of pseudogenes reveal a

progressive loss of zona pellucida genes during evolution

of vertebrates. Biol Reprod 78:796–806

Hamazaki TS, Nagahama Y, Iuchi I, Yamagami K (1989) A

glycoprotein from the liver constitutes the inner layer of

the egg envelope (zona pellucida interna) of the fish,

Oryzias latipes. Dev Biol 133:101–110

Hoodbhoy T, Dean J (2004) Insights into the molecular basis of

sperm–egg recognition in mammals. Reproduction 127:

417–422

Hyllner SJ, Westerlund L, Olsson PE, Schopen A (2001)

Cloning of rainbow trout egg envelope proteins: members

of a unique group of structural proteins. Biol Reprod

64:805–811

Fish Physiol Biochem (2011) 37:471–484 483

123

Kanamori A, Naruse K, Mitani H, Shima A, Hori H (2003)

Genomic organization of ZP domain containing egg

envelope genes in medaka (Oryzias latipes). Gene

305:35–45

Li CJ, Zhou L, Wang Y, Hong YH, Gui JF (2005) Molecular

cloning and expression characterization of three gonado-

tropin subunits common a, FSHb and LHb in groupers.

Mol Cell Endocrinol 233:33–46

Li CJ, Wei QW, Zhou L, Cao H, Zhang Y, Gui JF (2009)

Molecular and expression characterization of two

somatostatin genes in the Chinese sturgeon, Acipensersinensis. Comp Biochem Physio A 154:127–134

Liu X, Wang H, Gong Z (2006) Tandem-repeated Zebrafish

zp3 genes possess oocyte-specific promoters and are

insensitive to estrogen induction. Biol Reprod 74:1016–

1025

Lyons CE, Payette KL, Price JL, Huang RC (1993) Expression

and structural analysis of a teleost homolog of a mam-

malian zona pellucida gene. J Biol Chem 268:21351–

21358

Miura T, Kudo N, Miura C, Yamauchi K, Nagahama Y (1998)

Two testicular cDNA clones suppressed by gonadotropin

stimulation exhibit ZP2- and ZP3-like structures in Japa-

nese eel. Mol Reprod Dev 51(3):235–242

Modig C, Modesto T, Canario A, Cerda J, Von Hofsten J,

Olsson PE (2006) Molecular characterization and

expression pattern of zona pellucida proteins in gilthead

seabream (Sparus aurata). Biol Reprod 75:717–725

Murata K, Sasaki T, Yasumasu S, Iuchi I, Enami J, Yasumasu I,

Yamagami K (1995) Cloning of cDNAs for the precursor

protein of a low-molecular-weight subunit of the inner layer

of the egg envelope (chorion) of the fish Oryzias latipes.

Dev Biol 167:9–17

Shimizu M, Fujita T, Hiramatsu N, Hara A (1998) Immuno-

chemical detection, estrogen induction and occurrence in

serum of vitelline envelope-related proteins of Sakhalin

taimen Hucho perryi. Fish Sci 64:600–605

Spargo SC, Hope RM (2003) Evolution and nomenclature of

the zona pellucida gene family. Biol Reprod 68:358–362

Sugiyama H, Murata K, Iuchi I, Nomura K, Yamagami K

(1999) Formation of mature egg envelope subunit proteins

from their precursors (choriogenins) in the fish, Oryziaslatipes: loss of partial C-terminal sequences of the

choriogenins. J Biochem 125:469–475

Sun YY, Yu HY, Zhang QQ, Qi J, Zhong QW, Chen YJ,

Li CM (2010) Molecular characterization and expression

pattern of two zona pellucida genes in half-smooth tongue

sole (Cynoglossus semilaevis). Comp Biochem Physiol B

155(3):316–321

Waclawek M, Foisner R, Foisner R, Nimpf J, Schneider WJ

(1998) The chicken homologue of zona pellucida protein-

3 is synthesized by granulosa cells. Biol Reprod 59:1230–

1239

Wang H, Gong Z (1999) Characterization of two zebrafish

cDNA clones encoding egg envelope proteins ZP2 and

ZP3. Biochim Biophys Acta 1446:156–160

Wang Y, Zhou L, Yao B, Li CJ, Gui JF (2004) Differential

expression of thyroid-stimulating hormone bsubunit in

gonads during sex reversal of orange-spotted and red-

spotted groupers. Mol Cell Endocrinol 220:77–88

Wassarman PM (2008) Zona pellucida glycoproteins. J Biol

Chem 283(36):24285–24289

Wassarman PM, Jovine L, Litscher ES (2004) Mouse zona

pellucida genes and glycoproteins. Cytogenet Genome

Res 105:228–234

Wei QW, Ke FE, Zhang J, Zhuang P, Luo J, Rueqiong Z

(1997) Biology, fisheries, and conservation of sturgeons

and paddlefish, in China. Environ Biol Fish 48:241–255

Yamaguchi S, Hedrick JL, Katagiri C (1989) The synthesis and

localization of envelope glycoproteins in oocytes of

Xenopus laevis using immunocytochemical methods. Dev

Growth Differ 31:85–94

484 Fish Physiol Biochem (2011) 37:471–484

123