BRIEF COMMUNICATION

Microsatellite diversity and crossover regionswithin homozygous and heterozygous SLA haplotypesof different pig breeds

Asako Ando & Hirohide Uenishi & Hisako Kawata &

Maiko Tanaka-Matsuda & Atsuko Shigenari &Laurence Flori & Patrick Chardon & Joan K Lunney &

Jerzy K Kulski & Hidetoshi Inoko

Received: 27 October 2007 /Accepted: 26 February 2008 /Published online: 17 June 2008# Springer-Verlag 2008

Abstract Our aim was to investigate microsatellite (MS)diversity and find crossover regions at 42 polymorphic MSloci in the swine leukocyte antigen (SLA) genomic regionof 72 pigs with different well-defined homozygous andheterozygous SLA haplotypes. We analyzed the geneticpolymorphisms of 42 MS markers in 23 SLA homozygous–heterozygous, common pig breeds with 12 SLA serologicalhaplotypes and 49 National Institutes of Health (NIH) andClawn homozygous–heterozygous miniature pigs with nine

SLA serological or genotyped haplotypes including fourrecombinant haplotypes. In comparing the same anddifferent haplotypes, both haplospecific patterns and allelicvariations were observed at the MS loci. Some of the sharedhaplotype blocks extended over 2 Mb suggesting theexistence of strong linkage disequilibrium (LD) in theentire SLA region. Crossover regions were easily definedby the MS markers within the class I and/or III region in theNIH and Clawn recombinant haplotypes. The present

Immunogenetics (2008) 60:399–407DOI 10.1007/s00251-008-0289-z

DO00289; No of Pages

Electronic supplementary material The online version of this article(doi:10.1007/s00251-008-0289-z) contains supplementary material,which is available to authorized users.

A. Ando :A. Shigenari : J. K. Kulski :H. Inoko (*)Department of Molecular Life Science,Division of Basic Medical Science and Molecular Medicine,Tokai University School of Medicine,143 Shimokasuya,Isehara, Kanagawa 259-1193, Japane-mail: hinoko@is.icc.u-tokai.ac.jp

H. UenishiDivision of Animal Sciences,National Institute of Agrobiological Sciences,2-1-2 Kannondai,Tsukuba, Ibaraki 305-8602, Japan

H. Uenishi :M. Tanaka-MatsudaAnimal Genome Research Program (NIAS/STAFF),446-1 Ippaizuka, Kamiyokoba,Tsukuba, Ibaraki 305-0854, Japan

H. KawataTeaching and Research Support Center,Tokai University School of Medicine,143 Shimokasuya,Isehara, Kanagawa 259-1193, Japan

M. Tanaka-MatsudaSecond Research Division,STAFF-Institute,446-1 Ippaizuka, Kamiyokoba,Tsukuba, Ibaraki 305-0854, Japan

L. Flori : P. ChardonINRA, Institut National de la Recherche Agronomique,Laboratoire Mixte de Radiobiologie et d’Etude du Génome;CEA DSV, IRCM,78352 Jouy-en-Josas, France

J. K. LunneyAnimal Parasitic Diseases Laboratory,ANRI, ARS, USDA,Beltsville, MD 20705-2350, USA

J. K. KulskiCentre for Forensic Science,The University of Western Australia,Nedlands, Western Australia, Australia

haplotype comparison shows that our set of MS markersprovides a fast and cost-efficient alternative, or comple-mentary, method to the serological or sequence-baseddetermination of the SLA alleles for the characterizationof SLA haplotypes and/or the crossover regions betweendifferent haplotypes.

Keywords Swine major histocompatibility antigen .

Microsatellite marker . Polymorphism . Homozygote .

Crossover

AbbreviationsHT heterozygosityMHC major histocompatibility complexMS microsatelliteSLA swine leukocyte antigenPCR polymerase chain reactionPIC polymorphic information contentLD linkage disequilibriumLW Large WhiteLR LandracePC Poland ChinaM Meishan

The genomic region of the swine major histocompatibilitycomplex (MHC: swine leukocyte antigen (SLA)) plays animportant role in regulating the immune response systemagainst infection and in disease, and allotransplantation andxenotransplantation. The DNA sequence of the entire SLAregion (2.4 Mb) of the H01 (recently assigned as Hp-1a.1;Smith et al. 2005a, b) haplotype was completed recently(Chardon et al. 2001, Renard et al. 2001, 2006; Shigenariet al. 2004; Ando et al. 2005a) and made available as areference for developing new genetic markers, such aspolymorphic microsatellites (Ando and Chardon 2006).Microsatellite (MS) markers are simple tandem repeat poly-morphisms made of repeats of two (e.g., CA), three (e.g.,CGA), or four base pairs (e.g., GATA), with the polymor-phism being represented by the number of repeats varyingfrom at least three to ten copies. MS markers as variations incopy number are easy to genotype by polymerase chainreaction (PCR) for linkage mapping and segregation studies inrelated animals. In pigs, 40 polymorphic MS markers with anaverage distance of 59 kb between markers were selectedwithin the SLA H01 haplotype sequence and the allelefrequency of these markers was determined by PCR for apanel of 97 animals representing 12 different breeds (Tanakaet al. 2005). These MS markers possess marked heterozy-gosity (HT) of 0.71 and a high polymorphic informationcontent (PIC) of 0.68 (Tanaka et al. 2005), which iscomparable to the PIC for 68 human MS markers (0.6~0.7in approximately 100 unrelated individuals; Tamiya et al.1998, 1999; Matsuzaka et al. 2000, 2001).

MS markers have been widely used for linkage mappingof pig disease susceptibility genes and economic traits(Conley et al. 1988; Genet et al. 2001; Geffrotin et al.2004). In addition, typing for haplospecific MS alleles inthe SLA region of pigs would help to better define donor–recipient compatibility in allotransplantation. MS markershave been extensively used to evaluate genetic homozy-gosity in animals and at least 72 SLA haplotypes have beenreported for common pig breeds as the result of serologicalSLA typing of homozygous haplotypes (Renard et al. 1988;review: Chardon et al. 2000). Because few homozygouspigs, except those with several limited haplotypes such asH01, H28, H12,and H34, have been studied at the DNAlevel (recent designations as Hp-1a.1, 1b.0, 14.0, and 15.0,respectively; review: Smith et al. 2005a, b), manyhaplotypes that were defined only by the serologicaltyping might be further subdivided and categorized bypolymorphic analysis of MS markers across the SLAregion.

Besides the 72 SLA haplotypes of the common large pigbreeds, several additional haplotypes have been defined in afew inbred miniature pig lines. For instance, in the NationalInstitutes of Health (NIH) miniature pigs, three founderhaplotypes (Hp-2.2 (a), Hp-3.3 (c), and Hp-4a.4 (d)) andtwo recombinant haplotypes (Hp-2.4 (h) and Hp-3.4 (g))were reported (Sachs 1992; Supplementary Table 1). Wealso developed novel lines of inbred Clawn miniature pigswith two founder haplotypes (Hp-16.16 (c1) and Hp-17.17(c2)), a recombinant haplotype (Hp-16.17 (c3); Ando et al.2005b), and a new recombinant haplotype (designated asHp-17.16 (c4)) in Clawn miniature pigs (Shinmura et al.unpublished data; Supplementary Table 1). Althoughrecombination events might have occurred in a locationbetween the SLA class I and class II regions of the fourrecombinant haplotypes (Hp-2.4, Hp-3.4, Hp-16.17, andHp-17.16; Martens et al. 2003; Ando et al. 2005b;Supplementary Table 1), a detailed analysis of the recom-bination sites in the NIH and Clawn miniature pigs has notyet been reported. Thus, the analysis of MS markers isexpected to provide additional information on the recom-bination sites in SLA homozygous–heterozygous pigs andcomplement preliminary SLA allelic evidence alreadyavailable from crossover events.

In this study, to clarify the microsatellite diversity andcrossover points within the SLA region, we analyzed thegenetic polymorphisms at 42 MS loci of 72 pigs of differentbreeds and with known SLA serological haplotypes.

We obtained genomic DNA samples from 23 SLAhomozygous–heterozygous common large pig breeds (19Large White (LW), two Landrace (LR), one Poland China(PC, a synthetic line), and one Meishan (M)) with 12previously typed SLA serological haplotypes (Renard et al.1988; Vaiman et al. 1998) and from 34 NIH and 15 Clawn

400 Immunogenetics (2008) 60:399–407

homozygous–heterozygous miniature pigs with nine previ-ously typed SLA haplotypes including four recombinanthaplotypes as listed in Table 1 and Supplementary Table 1(Martens et al. 2003; Ando et al. 2005b). These pig genomicDNA samples were obtained from Institut National de laRecherche Agronomique Commissariat à l’énergie atomique(Jouy-en-Josas, France), US Department of Agriculture,Agricultural Research Service, Beltsville Agricultural Re-search Center, Animal Parasite Diseases Laboratory, (Belts-ville, MD, USA), and Japan Farm Co., Ltd. (Kagoshima,Japan). Forty previously developed polymorphic MS markersand two new markers, SLAMS097 and SLAMSA21 (Table 1,Fig. 1a), which showed high heterozygosity within the SLAregion, were genotyped by PCR in the 72 pigs (Table 1). Thesequences from the 42 microsatellite loci were amplified byPCR using the 42 PCR primer pairs that were labeled withfluorescent dyes as described previously (Operon Biotechnol-ogies, Tokyo, Japan; Applied Biosystems; Tanaka et al. 2005).The sizes of the PCR products were analyzed using the ABI3730 sequencer and GeneMapper® software version 4(Applied Biosystems, Foster City, CA, USA).

Five haplospecific patterns for the MS markers wereobserved across the entire SLA region of the 19 NIH andnine Clawn homozygous–heterozygous miniature pigs withthe Hp-2.2, Hp-3.3, Hp-4a.4, Hp-16.16, and/or Hp-17.17haplotypes reflecting the inbred miniature pigs with definedSLA haplotypes (Table 1, Fig. 1). Therefore, the MSanalysis of miniature pigs confirmed the previous classifi-cation of the five haplotypes by SLA DNA typing. The MSanalysis of SLA haplotypes in miniature pigs also high-lights the usefulness of MS markers for high-resolutionmapping of crossover or recombination sites. In the Hp-3.4and Hp-2.4 recombinant haplotypes, a crossover region wasobserved in a 222-kb fragment located between SLAMS043and SLAMS044 in the class III region. To define moreprecisely the crossover point, two additional MS markers,SLAMS097 and SLAMSA21, were developed in the 222-kbfragment located between SLAMS043 and SLAMS044.These two markers narrowed down the crossover point toa 40-kb fragment located between the SKIV2L and ZBTB12genes. In the Hp-2.4 haplotype, a crossover region wasobserved within a 46-kb fragment located betweenSLAMSA14 and SLAMS055 in the class I region. Perhapsnot by coincidence, both the Hp-3.4 and Hp-2.4 haplotypesshare the crossover region in the SLA class III region(Fig. 1c). Furthermore, a crossover in the Clawn Hp-16.17haplotype was observed within a 208-kb fragment locatedbetween SLAMS037 and SLAMSA16 in the class I region(Fig. 1d). In addition, two different kinds of crossoverregions were found in the class I and class III regions offour Clawn pigs with the Hp-17.16 haplotype. One of themwas observed in pigs S56 and N23 and mapped within a159-kb fragment located between SLAMSA16 and

SLAMSA02 in the class I region. The other crossover wasobserved in pigs O03 and AD20 and mapped to a 111-kbfragment located between SLAMSA13 and SLAMSA14across the class III and class I regions. Taken together, atotal of five different recombination haplotypes were foundin 15 NIH and six Clawn miniature pigs.

The crossover regions that mapped within the class I orclass III regions suggest that large LD blocks exist acrossthe centromere which is located between the class II andclass III regions of pigs. Therefore, the centromeresequences may have been generated without overtlyaffecting crossover sites in the SLA region. In humans,frequent recombination events have been observed in theHLA class I region (Bouissou et al. 1995) and sixrecombination hot spots were mapped in a 216-kb fragmentlocated between theDNA and TAP2 genes in the HLA class IIregion (Jeffreys et al. 2000). In mice, several recombinationhot spots were mapped in the H2-class II regions (Isobe et al.2002; Yauk et al. 2003). Although the sites of recombinationat the nucleotide level were not identified in this study, it isclear that recombinations were more frequent in the SLA classI region. It will be of interest to verify the nucleotide patternsof LD blocks and recombination hot spots in pigs andcompare them to the distribution of the hot spots in humansand mice.

Table 1 shows the haplospecific MS patterns at 42 MSloci in the panel of 23 SLA homozygous–heterozygouscommon pigs with the 12 serological SLA haplotypes. Forthe large pig breeds, the same serological haplotypes (H01,H03, H04, H10, and H24) in different pigs generally sharedlarge blocks of sequence homology and identical MS allelicpatterns. This was true except for the observed largedifferences in the genomic blocks of some haplotypes,such as H04 (pig 5055), H01 (pig 31103), and H10 (pig95072). For example, of the four unrelated pigs with theH04 haplotype, pigs 30 and 31541 shared identical MSallelic patterns but were markedly different to the MSalleles of pigs 5055 and 31111 across the entire class II andclass III regions. Heterozygous alleles were detected at oneor more MS loci for at least five homozygous samples (pigs31111 and 5055 with H04, pig 4081 with H06, and pigs4023 and 4024 with H24 haplotypes). Interestingly, thesame MS pattern for pig 5055 (H04) was observed in pig31326, with the H08 haplotype, at most of the MS lociacross the 1.6-Mb genomic region between SLAMS048 andSLAMSA02 spanning the SLA class III region. However,the sizes of the amplicons in pig 5055 at 7of 11 class I MSloci across the 0.48-Mb region between SLAMS035 andSLAMSA061 including a classical class I gene cluster werenot identical to those in pig 31326 with H08, affirming thedifference in the class I assignment.

The absence of a strong correlation between some of theMS and serological haplotype results might be explained in

Immunogenetics (2008) 60:399–407 401

Table 1 Allele designation (numbers of nucleotides in the MS allele) of 42 MS loci in 72 SLA homozygous–heterozygous samples

402 Immunogenetics (2008) 60:399–407

Table 1 (continued)

Immunogenetics (2008) 60:399–407 403

part by the limited serological analysis performed on thecommon pig breeds. Only the SLA-class-Ia-specific alloan-tisera were used for haplotype classification and the SLAclass II and III regions of the 23 SLA homozygous–heterozygous samples were not typed by serologicalmethods. In addition, although the antibody reagents weredirected mostly against antigenic determinants characteristicof a unique SLA allele, antigenic determinants common toseveral alleles might also have been recognized to prevent anexact determination of all SLA types. Therefore, it isexpected that unrelated individuals typed as SLA identicalby serology could present different MS profiles as exempli-fied by the two animals 1485 and 31103 sharing theserologically defined SLA H01 haplotypes but harboringdifferent sets of MS alleles. Moreover, individuals detectedas SLA homozygous within the SLA class Ia region byserology typing could be heterozygous at the MS loci,reflecting in fact two different SLA haplotypes, as seen forpig 5055.

The heterozygous H01/08 haplotypes (pigs 26984 and26989) shared more alleles with the H01 and H04haplotypes than with the H08 haplotype across 2.36 Mbof the entire SLA region and 1.5 Mb of genomic sequencebetween SLAMS047 and SLAMSA05, respectively. Thesetwo pigs had H01 haplospecific amplicons at 11 MS lociacross 0.77 Mb of the class I region including the classicalclass I gene cluster. In comparison, pig 31501 that had beentyped as a heterozygous H01/38 haplotype shared allelesmostly with the H01 as one of the two MS haplotypes andrevealed a unique H38 haplospecific MS pattern as theother MS and serological haplotype.

In the two pigs 4023 and 4024 with the H24 haplotype, twodifferent alleles were observed only at SLAMS034, a locationthat is in the classical class I gene cluster near the 3’untranslated region of the SLA-1 gene. Heterozygous alleles inthe SLA-1 and SLA-2 genes were previously detected in oneof the H24 homozygous samples (pig 4024) using asequencing-based typing method for the SLA-1 and SLA-2genes (Ando et al. 2003; data not shown). Furthermore,SLAMS034 was previously demonstrated to generate threeamplicons in three individuals from three different breeds,Landrace, Berkshire, and Jinhua (Tanaka et al. 2005).

Moreover, in several haplotypes, the possibility of duplicationof the SLA class I genes has already been reported(Ruohonen-Lehto et al. 1998). Taken together, these resultssuggest that the two alleles at SLAMS034 in the two individualpigs might be duplicated around the SLA-1 gene. Such allelicduplications can be missed by serology but detected by MStyping.

Furthermore, in two pigs with the H06 or H16haplotypes, we found heterozygous alleles at SLAMS043and SLAMS050 in the class III and II regions, respectively.The possibility of the generation of heterozygous alleles inthe homozygous samples due to instability of amplificationcannot be ruled out. Therefore, in the future we shouldinvestigate duplication around the MS marker using othermethods, such as sequencing of the genomic regionsdirectly.

Comparison between the MS polymorphisms of 23 SLAhomozygous–heterozygous common pigs with the 12 SLAserological haplotypes and the MS polymorphisms of theNIH Hp-2.2and Hp-4a.4 haplotypes revealed that the H04and H10 haplotypes correlated with the NIH Hp-2.2 andHp-4a.4 haplotypes, respectively. All of the polymorphicmarkers across 2.36 Mb of the SLA genomic regionmatched pigs 30 and 31541 with the H04 haplotype andthe NIH pigs with the Hp-4a.4 haplotype (Table 1, Fig. 1b).These observations are compatible with the previousfinding that the Hp-4a.4 haplotype shared serologicalspecificities with the H04 haplotype (Vaiman et al. 1998;Smith et al. 2005a, b). The serological SLA H04 haplotype,which is considered to be a pig ancestral haplotype, hasbeen found in most commercial breeds (Vaiman et al. 1998;Smith et al. 2005a, b). Because the SLA homozygous–heterozygous samples in this study were not randomizedsamples, the existence and significance of the linkagedisequilibrium extending across the entire SLA regionshould be further investigated for MS polymorphisms usingmore pig samples with the serological H04 haplotype. Thestrong linkage disequilibrium and longer haplotypes may beexpected in some pig populations with the short evolutionaryhistory of a haplotype or in the case of selective sweep (Sabetiet al. 2002; 2006). Furthermore, one of the pigs with the H10haplotype, pig 95072, shared alleles with the NIH Hp-2.2

a Names of breeds or synthetic lines are abbreviated as follows: LW, Large White; MS, Meishan; PC, Poland China; LR, Landraceb Features of SLAMS09 are shown as follows: position of SLAMS09, from 20089 to 14374; repeat type, (AC)5AT(AC)22 ; positions of primers andsequences given in parentheses, from 13972 to 13991 (CAGCCCTTCCTCGTCAAATA) and from 14383 to 14402 (CGGCAAAGATGCAGA-GATAA); size of amplicon in BAC 707F1 (submitted as AL773527), 431 bpc Features of SLAMSA21 are shown as follows: position of SLAMSA21, from 55036 to 55073; repeat type, (CA)19 ; positions of primers andsequences given in parentheses, from 54721 to 54741 (TCCTGGGAAACAAACTTGAAA) and from 55077 to 55096 (CAACGGGAACTC-CAAGAAAA); size of amplicon in BAC 707F1 (submitted as AL773527), 376 bpd Previous designations of haplotypes are shown in parentheses and Supplementary Table 1e Pig 5799 indicates a Large White male pig that has been previously used for genomic sequencing of the SLA region (Renard et al. 2006)f No obvious fragments were generated by the corresponding individual(s)g The corresponding individual(s) were not tested

Table 1 (continued)

404 Immunogenetics (2008) 60:399–407

haplotype across 1.53 Mb of genomic sequence betweenSLAMS047 and SLAMSA05 including the entire class II andIII regions and the centromeric side of a classical class I genecluster (Fig. 1b). However, none of the 12 SLA serologicalhaplotypes of common pigs correlated with the NIH Hp-3.3and Clawn Hp-16.16 and Hp-17.17 haplotypes.

There are numerous polymorphisms of MS markers nearpolymorphic SLA genes, e.g., three and four kinds of MSalleles were observed in SLAMS034 and SLAMS051, locatednear SLA-1 and between the DRB1 and DQA, respectively,using 72 homozygous–heterozygous pig samples. Thisnumber of MS alleles was much less than the number of

SLA alleles for SLA-1, DRB1, and DQA. Therefore, thepolymorphic analysis of MS markers is suitable for the rapididentification of haplotypes and to follow segregation of SLAhaplotypes in families but may be insufficient for identifyingall SLA alleles in unrelated, outbred heterozygous animals.For the latter case, genomic sequencing, or a dense SNPpanel in the SLA region, could provide a more robust typingsystem than MS typing alone. Nevertheless, SLA MS typingis currently performed in pig families to select donor andrecipient for allograft experiment programs. The availabilityof our MS typing set covering the whole SLA region mayallow pinpointing SLA recombinants, which may have

Fig. 1 Map of the locations of theMSmarkers and genes within the SLAgenomic region and a schematic representation of the haplotypes of NIHand Clawn miniature pigs and homozygous common pig breeds with theH04 or H10 haplotypes. a Map of the locations of 42 MS markers(above the horizontal arrow) and genes (below the horizontal arrow)within the SLA genomic region. All of the MS markers except twomarkers, SLAMS097 and SLAMSA21, were developed previously(Tanaka et al. 2005). Asterisks indicate the two additional MS markersdeveloped in this study (Table 1). b Schematic representation ofhaplotypes of NIH pigs and two pigs with the H04 or H10 haplotypes.MS polymorphisms of NIH pigs with Hp-4a.4 (d) or Hp-2.2 (a)haplotypes were compared with those of pigs 30 or 31541 and 95072with the H04 and H10 haplotypes, respectively. A gray box indicates theentire SLA region containing alleles shared between the NIH pigs with

Hp-4a4 (d) haplotype and the pigs with the H04 haplotype. A black boxindicates a 1.53-Mb genomic fragment containing alleles sharedbetween the NIH pigs with Hp-2.2 (a) haplotype and the pig with theH10 haplotype. c Schematic representation of haplotypes of NIH pigsincluding crossover haplotypes. Check, white and gray boxes indicateHp-2.2, Hp-3.3, and Hp-4a.4 haplotypes, respectively. Dashed linesindicate crossover regions of Hp-3.4 and Hp-2.4 haplotypes. dSchematic representation of haplotypes of Clawn pigs includingcrossover haplotypes. Diagonal stripe and dot pattern indicate Hp-16.16 (c1) and Hp-17.17 (c2) haplotypes, respectively. Dashed linesindicate crossing over regions of Hp-16.17 (c3), Hp-17.16a (c4a), andHp-17.16b (c4b) haplotypes. The labels Hp-17.16a and Hp-17.16b

indicate the crossover haplotypes of pigs S56 and N23, O03 andAD20, respectively

Immunogenetics (2008) 60:399–407 405

occurred at low frequency (<1.0%) between the class I andclass II regions and which previously have not beenscrupulously investigated within class I or within class II.Intrafamilial mating of animals bearing identical SLAhaplotypes as identified by the MS markers also providesgenetically SLA homozygous pigs, which constitute relevantresources for deciphering the role of major histocompatibilitycomplex in immune process.

In conclusion, haplospecific MS patterns, MS allelicvariations and genomic crossover regions were determinedin 72 SLA homozygous–heterozygous pigs by genotyping42 MS markers that covered the entire SLA region. Thepolymorphic analysis of the MS markers facilitated therapid identification of the haplotypes and the recombinationevents between haplotypes in common pig breeds and theNIH and Clawn miniature pigs. The MS marker techniqueprovides a fast and cost-efficient alternative, or comple-mentary, method to serological or molecular SLA typingmethods.

Acknowledgements We wish to thank Drs. Christine Renard (aformer researcher in Institut National de la Recherche AgronomiqueCommissariat à l’énergie atomique), Kouji Tanaka, Yukari M,Shinmura, and Junichi Tottori (Japan Farm CLAWN Institute) forproviding us with samples for SLA homozygous–heterozygous pigsand the Clawn miniature pigs, respectively. This study was supportedby grants from an arm of the Science and Technology Agency, theMinistry of Education, Science, Sports, and Culture, Japan, theAnimal Genome Research Project of the Ministry of Agriculture,Forestry and Fisheries of Japan, and the US Department of AgricultureAgricultural Research Service project funds.

References

Ando A, Chardon P (2006) Gene organization and polymorphism ofthe swine major histocompatibility complex. Animal Sci J77:127–137

Ando A, Kawata H, Shigenari A, Anzai T, Ota M, Katsuyama Y, SadaM, Goto R, Katsuyama Y, Takeshima S, Aida Y, Iwanaga T,Fujimura N, Inoko H (2003) Genetic polymorphism of the swinemajor histocompatibility complex (SLA) class I genes, SLA-1, -2and -3. Immunogenetics 55:583–593

Ando A, Shigenari A, Kulski JK, Renard C, Chardon P, Shiina T,Inoko H (2005a) Genomic sequence analysis of the 238-kb swinesegment with a cluster of TRIM and olfactory receptor genes butno class I genes located at the distal end of the SLA class Iregion. Immunogenetics 57:864–873

Ando A, Ota M, SadaM, Katsuyama Y, Goto R, Shigenari A, Kawata H,Anzai T, Iwanaga T,Miyoshi Y, Fujimura N, InokoH (2005b) Rapidassignment of the swine major histocompatibility complex (SLA)class I and II genotypes in Clawn miniature swine using PCR-SSPand PCR-RFLP methods. Xenotransplantation 12:121–126

Bouissou C, Pontarotti P, Crouau-Roy B (1995) A precise meioticmap in the class I region of the human major histocompatibilitycomplex. Genomics 30:486–492

Chardon P, Renard C, Rogel-Gaillard C, Vaiman M (2000) Theporcine major histocompatibility complex and related paralogousregions a review. Genet Sel Evol 32:109–128

Chardon P, Rogel-Gaillard C, Cattolico L, Duprat S, Vaiman M,Renard C (2001) Sequence of the swine major histocompatibilitycomplex region containing all non-classical class I genes. TissueAntigens 57:55–65

Conley AJ, Jung YC, Schwartz NK Warner CM, Rothschild MF, FordSP (1988) Influence of SLA haplotype on ovulation rate and littersize in miniature pigs. J Reproduction Fertility 82:595–601

Geffrotin C, Crechet F, Le Roy P, Le Chalony C, Leplat JJ, IannuccelliN, Barbosa A, Renard C, Gruand J, Milan D, Horak V, TricaudY, Bouet S, Franck M, Frelat G, Vincent-Naulleau S (2004)Identification of five chromosomal regions involved in predisposi-tion to melanoma by genome-wide scan in theMeLiM swinemodel.Int J Cancer 110:39–50

Genet C, Renard C, Cabau C, Rogel-Gaillard C, Gellin J, Millan D(2001) In the QTL region surrounding porcine MHC, gene orderis conserved with human genome. Mamm Genome 12:246–249

Isobe T, Yoshino M, Mizuno K, Lindahl F, Koide T, Gaudieri S,Gojobori T, Shiroishi T (2002) Molecular characterization of thePb recombination hotspot in the mouse major histocompatibilitycomplex class II region. Genomics 80:229–235

Jeffreys AJ, Ritchie A, Neumann R (2000) High resolution analysis ofhaplotype diversity and meiotic crossover in the human TAP2recombination hotspot. Hum Mol Genet 9:725–733

Martens GW, Lunney JK, Baker JE, Smith JD (2003) Rapidassignment of swine leukocyte antigen haplotypes in pedigreedherds using a polymerase chain reaction-based assay. Immuno-genetics 55:395–401

Matsuzaka Y, Makino S, Nakajima K, Tomizawa M, Oka A, KimuraM, Bahram S, Tamiya G, Inoko H (2000) New polymorphicmicrosatellite markers in the human MHC class II region. TissueAntigens 56:492–500

Matsuzaka Y, Makino S, Nakajima K, Tomizawa M, Oka A, BahramS, Kulski JK, Tamiya G, Inoko H (2001) New polymorphicmicrosatellite markers in the human MHC class III region. TissueAntigens 57:397–404

Renard C, Kristensen B, Gautschi C, Hruban V, Fredholm M, VaimanM (1988) Joint report of the first international comparison test onswine lymphocyte alloantigens (SLA). Animal Genet 19:63–72

Renard C,VaimanM, Chiannilkulchai N, Cattolico L, Robert C, Chardon P(2001) Sequence of the pig major histocompatibility regioncontaining the classical class I genes. Immunogenetics 53:490–500

Renard C, Chardon P, Vaiman M (2003) The phylogenetic history ofthe MHC class I gene families in pig, including a fossil genepredating mammalian radiation. J Mol Evol 57:420–434

Renard C, Sehra HK, Beasley HR, Coggill PC, Howe KL, Harrow JL,Gilbert JGR, Sims S, Rogers JR, Ando A, Shigenari A, Shiina T,Inoko H, Chardon P, Beck S (2006) The genomic sequence andanalysis of the swine major histocompatibility complex.Genomics 88:96–110

Ruohonen-Lehto MK, Renard C, Rothschild MF, Edfors-Lilja I,Kristensen B, Gustafsson U, Larson RG, Varvio SL (1998)Variable number of pig MHC class I genes in differentserologically defined haplotypes identified by a 3’-untranslatedregion probe. Anim Genet 29:178–184

Sabeti PC, Reich DE, Higgins JM, Levine HZP, Richter DJ, Schaffner SF,Gabriel SB, Platko JV, Patterson NJ, McDonald GJ, Ackerman HC,Campbell SJ, Altshuler D, Cooperk R, Kwiatkowski D, Ward R,Lander ES (2002) Detecting recent positive selection in the humangenome from haplotype structure. Nature 419:832–837

Sabeti PC, Schaffner SF, Fry B, Lohmueller J, Varilly P, ShamovskyO, Palma A, Mikkelsen TS, Altshuler D, Lander ES (2006)Positive natural selection in the human lineage. Science312:1614–1620

Sachs DH (1992) MHC-homozygous miniature swine. In: SwindleMM, Moody DC, Phillips LD (eds) Swine as models inbiomedical research. Iowa State University Press, Ames, pp 3–15

406 Immunogenetics (2008) 60:399–407

Shigenari A, Ando A, Renard C, Chardon P, Shiina T, Kulski JK, YasueH, Inoko H (2004) Nucleotide sequencing analysis of the swine433-kb genomic segment located between the non-classical andclassical SLA class I gene clusters. Immunogenetics 55:695–705

Smith DM, Lunney JK, Martens GW, Ando A, Lee JH, Ho CS, SchookL, Renard C, Chardon P (2005a) Nomenclature for factors of theSLA class-I system, 2004. Tissue Antigens 65:136–149

Smith DM, Lunney JK, Ho CS, Martens GW, Ando A, Lee JH, SchookL, Renard C, Chardon P (2005b) Nomenclature for factors of theSLA class-II system, 2005. Tissue Antigens 66:623–639

Tamiya G, Ota M, Katsuyama Y, Shiina T, Oka A, Makino S, KimuraM, Inoko H (1998) Twenty-six new polymorphic microsatellitemarkers around the HLA-B, -C and -E loci in the human MHCclass I region. Tissue Antigens 51:337–346

Tamiya G, Shiina T, Oka A, Tomizawa M, Ota M, Katsuyama Y,Yoshitome M, Makino S, Kimura M, Inoko H (1999) Newpolymorphic microsatellite markers in the human MHC class Iregion. Tissue Antigens 54:221–228

Tanaka M, Ando A, Renard C, Chardon P, Domukai M, OkumuraN, Awata T, Uenishi H (2005) Development of dense micro-satellite markers in the entire SLA region and evaluation oftheir polymorphisms in porcine breeds. Immunogenetics 57:690–696

Vaiman M, Chardon P, Rothschild MF (1998) Porcine major histocom-patibility complex. Rev Sci Tech Off Int Epiz 17:95–107

Yauk CL, Bois PR, Jeffreys AJ (2003) High-resolution sperm typingof meiotic recombination in the mouse MHC Eb gene. EMBO J22:1389–1397

Immunogenetics (2008) 60:399–407 407