Genetic Transformation in Stevia rebaudiana.

Mubarak, M.H* A.H. Belal Taymour M. N. EL –Din ** and E. I. El Sarag*

*Plant Production Department. Fac. Environ. Agric. Sci. (El-Arish), Suez Canal Univ., Egypt

** Agricultural Genetic Engineering Research Institute. AGERI. ARC, Egypt

Corresponding: mobark_mohamed99@yahoo.commohamed_hassan@a-sci-agr.suez.edu.eg

ABSTRACT

This study was carried out in plant Tissue Culture Laboratory in

Faculty of Environmental Agricultural Sciences El-Arish, North

Sinai, Suez Canal University during the period from 2009 to

2012 .The molecular studies were carried out in Micropropagation

Technology Laboratory (MPT) at the Agricultural Genetic

Engineering Research Institute (AGERI), Agriculture Research

Center (ARC), Giza, Egypt. Regeneration and transformation

systems on stevia var.Spanti, as an attempt to produce transgenic

stevia plants carrying bar gene as a selectable marker for

herbicide bialaphos resistance and gus gene as a reporter marker,

using biolistic gene gun protocol. At acceleration pressure of

900 psi 8 out of the 20 assayed callus stevia expressed the GUS

blue spots and the total number of blue spots was 20. While, when

the acceleration pressure was increased to 1100 psi, the number

of embryos revealing the GUS blue spots increased to reach 20

callus Stevia expressing a total of 101 blue spots.

Transformation efficiency has been calculated as the number of

regenerated plantlets/ number of bombarded callus. The

1

transformation frequency of 1100 psi was considerably higher (8.3

%) than that of 900 psi (3.3 %).

Key words: Stevia rebaudiana, Tissue culture, Genetic transformation, Callus

Introduction

Stevia rebaudiana Bertoni is a small shrub of the Asteraceae

(Composite) family. Stevia is an herb with an extensive root system

and brittle stems producing small, elliptic leaves. The tiny white

florets are perfect, borne in small corymbs of 2–6 florets. Corymbs

are arranged in loose panicles. Oddone (1997) considered that stevia

is self-incompatible and insect pollinated. Additionally, he mentioned

that clear seeds are infertile. Seeds are contained in slender

achenes, about 3 mm in length. Each achene has about 20 persistent

pappus bristles. The native occurrence of Stevia rebaudiana is between

22-24 °S and 53-56°W in Paraguay and Brazil. The plant growth requires

mild temperature between 15°and 38°C and relative humidity of about 80

% (Soejarto et al., 1983).The cultivation of such a plant could be an

alternative for the new land reclamation projects to meet the sugar

demands of the Egyptian markets and generate income for the growers

(El-Zifzafi,2003 and Ibrahim et al.,2008).

Stevia is helpful for hypoglycemia and diabetes because it

nourishes pancreas and thereby helps to restore its normal

function (Soejarto et al., 1983). Oviedo (1971) reported that

35.2% fall in normal blood sugar levels 6-8 hours following the

ingestion of stevia leaf extract (Miyazaki et al., 1978). Also,

stevia leaves extract can be used as anti fungal and anti

bacteria agent. Therefore, it lowers incidence of cold and flu.

2

Poor seed germination is one of the factors limiting large

scale cultivation. In this concern, referred to Shock (1982);

Duke, (1993) and Carneiro et al. (1997) who reported that poor

viable seeds were produced by stevia with very low germination

percentage (Felippe and Lucas, 1971 and Toffler and Orio, 1981;

Latha and Usha, 2003) .Seed germination rate is often poor, less

than 10% are common (Miyazaki et al., 1978; Goettemoeller and

Ching, 1999).

A lot of the advances in plant biotechnology have been based

on transformation; the ability to introduce DNA genes into plant

cells to recover whole transgenic plants with high yield quality

and quantity as well as resistant to biotic and abiotic stresses.

Gene transfer via biolistic particle bombardment (Biolistic gene

gun) is one of the useful techniques to overcome such problems as

previously reported in other plants (Yadav et al., 2010, Bassry,

2011). So, there is an urgent need for developing an efficient

gene transfer protocol for Stevia rebaudiana.

MATERIALS AND METHODS

`Seedlings of Stevia rebaudiana var. Spanti were kindly obtained

from Sugar Crops Research Institute, Agric., Research Center,

Ministry of Agric, Egypt, which were grown in the greenhouse of

the Faculty of Environmental Agricultural Sciences El-Arish.

Actively growing shoots were used as the explants source

during period from February to March. The terminal shoots were

collected from growing plants which were 2-3 months age and were

cut into 1-1.5 cm pieces

1.Callus induction.

3

Leaves were washed under running tap water with mild

detergent for 5 minutes, followed by distilled water. Thereafter,

in aseptic conditions, the explants were soaked in 5% (v/v)

Clorox for 10 minutes after has been washed three times with

sterile distilled water. Later, it was immersed in 0. 15%

mercuric chloride (HgCl2) solution for 1 minute and finally four

washes with sterilized distilled water to remove all traces of

HgCl2.

All steps of the sterilization had been done under aseptic

conditions inside the culture cabinet (Laminar air flow hood) and

by using sterilized instruments. The purpose of this procedure

was to disinfect the plant tissue from fungi, bacteria, and other

sources of contamination, without harming the regenerative

capacity of the explant. These leaves cultured in MS (Murashige

and Skoog, 1962) medium with five different 2,4-D concentration

(MS1, MS2, MS3, MS4 and MS5) were used in this study (Table, 1)

according Mohammed et al., (2006).

Table (1): Media composition for callus induction.

2,4-D (mgl-1 )Medium code

MSControl MS+1mgl-1

2,4-DMS1

MS+2m gl-1 2,4-DMS2

MS+3m gl-1 2,4-DMS3

MS+4m gl-1 2,4-DMS4

MS+5m gl-1 2,4-D MS5

4

The media were solidified with 2.5 gl-1phytagel. The media were

made up in distilled water, the pH adjusted to 5.8 and

sterilized by autoclaving for 20 minutes at 121 oC and 15 psi.

2.Callus regeneration.

Regeneration protocol as described by Tavazza et al. ( 1988 )

was counducted as the following steps:

1- callus was transfered as a cluster on the surface of

regeneration medium containing MS medium with 100 mgl-1myo-

inositol, 1 ml MS vitamins, 3 % sucrose, 1 mgl-1indol-3-

acetic acid (IAA), 10 mgl-1gibberellic acid (GA3) and 1 mgl-1

6-benzylaminopurine (BA).

2- The clusters from callus were incubated at 25 ± 1°C under a

photoperiod of 16 hr/day and 3000 Lux for 60 days.

3- The regenerated shoots which reach 2-3 cm in length (after 70

days from culture) in each callus tissue were calculated.

Shoots were transferred to medium consisted of MS basal

salts supplemented with 3 % sucrose, 100 mgl-1myo-inositol, 1

mgl-1GA3, 1 ml thiamin-HCl, 2 mgl-1calcium pantothenate and 2.5

gl-1 phytagel and the pH was adjusted to 5.6-5.8

3. Plant expression vector.

The plant expression vector pCGP1258 was used in

this study which is kindly provided from Dr A. Markis at

Mediterranean Agronomic Institute of China (MAICH) Crete,

Greece.

5

Bar gene for herbicide resistance

The bar gene which is controlled by cauliflower mosaic

caulimovirus (CaMV) 35S promoter and nopaline syntheases (nos)

terminator, and encodes the enzyme phosphinothricin acetyl

transferase (PAT) which inactivates phosphinothricin (De Block et

al. 1987). The active ingredient of the herbicide bialaphos was

used as selectable marker.

Preparation of micro carriers for bombardment.

Isolation of DNA plasmid (pCGP1258)

Preparation of DNA plasmid was performed according to

the method by Sambrook et al. (1989).

Polymerase chain reaction (PCR).

The polymerase chain reaction (PCR) is a method that

allows rapid detection of the presence or absence of a target

DNA. The DNA extracted from putatively transformed and non-

transformed control tissues were subjected to the polymerase

chain reaction (PCR) using a DNA thermal cycler.

In case of bar and gus genes, two specific primers for each

gene were used to detect the integrated bar and gus genes into

the genome of transformed stevia tissues by PCR analysis.

Primers were synthesized (DNA Synthesizer 392, Applied

Biosystems) at AGERI, ARC and used as shown in Table (2).

6

Table (2). Sequence of primers used in PCR analysis for

detection of Gus and bar genes.Prime

r

Sequence

(5-'3)'Lengt

h Expected productsizeGUS -

1CCTGTAGAAACCCCAACCCG 20

750 bpGUS -

2TGGCTGTGACGCACAGTTCA 20Bar-1 TGC CAC CGA GGG GAC ATG CCG 23

484 bpBar-2 CCT GAA GTG GAG GCC ATG GGG 21

Source: The primers were designed and synthesized on (ABI)

Applied Biosystems, 392 DNA/RNA synthesizers at the Genetic

Engineering Service Unit (GESU), Agricultural Genetic

Engineering Research Institute (AGERI), and ARC. (GESU).

4. Detection of bar and gus genes.

PCR detection

The target DNA sequence (bar and gus genes) were amplified by

using the step cycle program as follows: Denaturation the DNA at

95 °C for 3 min. Annealing the DNA at 60 °C for 1.5 was

primers attach. The newly synthesized DNA was heated at 72 °C for

2 min for a total of 35 cycles. Following amplification, the

PCR products were analyzed by agarose gel electrophoresis. 6 l

of each PCR reaction mixture was electrophoresed after mix with

3µl loading buffer on a 1.3 % agarose gel at 105 Volt for 20

min.

Histochemical assay.

Detection in callus tissue.

7

β-glucuronidase (GUS) assay (Beckman and Engler, 1994).

X-Glue produces the final insoluble blue precipitate dichloro-

dibromoindigo (CIBr-indigo).

Number of transformed explants and control were soaked in

500μl GUS buffer (Daniell et al. 1990) containing 50 μl X-Glu ( 5-

bromo-4-chloro-3-indoly) glucuronide and rapped with aluminum

foil, to prevent light effect ( Jefferson et al. 1987) . A blue

staining was often visible in 24 h or less, even though tissues

were incubated in the substrate solution overnight at 37˚C.

After this incubation period, the tissues were cleared with 5%

colorx for easily visualization the blue staining. Blue color

was detected under the binocular microscope.

5.Statistical analysis:Data were statistically analyzed by using a randomized

complete design (RCD) according to (Snedecore and Cochran, 1990).

Mean separations were done by using SPSS computer program V.10

(1991) and to compare between means least significant differences

(Duncan, 1955) was used. Data were recorded every six weeks.

Every treatment had four replicates

Results and Discussion

Confirmation of transformation.

Two methods were used in this study to detect the presence of

the gus and bar genes in the putatively transformed tissues.

8

These methods were the gus histochemical staining technique and

PCR analysis

1 .Transient expression of gus gene in callus.The use of 5-bromo-4-chloro-3-indolyl glucuronide (x-

gluc) as a substrate for the gus enzyme provide an effective

methods for monitoring the expression of GUS DNA introduced

into plant cells. X-gluc is the best substrate currently

available for histochemical localization of β-glucuronidase

activity in tissue and cells. This substrate works very

well, giving a blue precipitate at the site of enzyme

activity Our results indicated that GUS activity in

transformed stevia explants (callus slices) which co-

cultivated with gen gun could be detected histchemicaly for

GUS expression after two week as the first evidence of

transformation .Most of the tissues turned callus to deep

blue color compared with control (Fig. 1). These results are

in agreement with other findings reported by different

researchers such as (Martin et al. 1990), they reported that,

the GUS marker system is useful for early selection, as

bacterial expression of the marker severely compromises its

effectiveness The β-glucuronidase gene fusion system became

the most popular reporter gene in plant histochemical

research. In many cases, however, as in whole-moment

preparation and thick handmade section, the pigments present

in the most plant tissue can partially or even totally mask

the sits of GUS – activity and consequently hinder the

detection of it. A passage through an ethanol series or a

9

10% commercial bleach solution is known to remove pigments

such as chlorophyll from the tissue.

Fig .(1): Histochemical assay of β-glucuronidase (GUS) gene in callus explants

of stevia transformed via gen gun after two weeks of transformation.(A)Transformed explant of stevia showing blue color.

(B )None transformed explants.

10

A B

2. The best pressure for stevia transformation using biolistic

gene gun.In the present investigation, the transient expression of

the uidA gene was studied as a preliminary test of the

transformation efficiency and for selecting the most appropriate

bombardment acceleration pressure. The transformation experiment

was carried out with two different bombardment acceleration

pressures i.e. 900 and 1100 psi. The total number of callus

tested was 40. At acceleration pressure of 900 psi 8 out of the

20 assayed callus of stevia expressed the GUS blue spots and the

total number of blue spots was 20. While, the acceleration

pressure was increased to 1100 psi, the number of callus

revealing the GUS blue spots increased to reach 20 callus stevia

expressing a total of 101 blue spots. Therefore, from this

experiment it might be concluded that, the bombardment at an

acceleration pressure of 1100 psi revealed a significantly higher

number of callus expressing the uid A gene than the bombardment

acceleration at 900 psi, thus reflecting a higher transient

transformation efficiency.

Table (3): The uid A gene expression (gus) as revealed by the

average number of blue spots.plan Pressure No. of

callus in No. of callus with blue No. of spots

11

t petri dish spots Stev

ia 1100 20 18a 101a

900 20 8b 20b

Numbers with the same letters are not significantly different at 5%.

These results are in agreement with Cho et al. (1998) and

Harwood et al. (2000). They used gas pressure of 1100 psi to

obtain higher expression of gus gene and fertile barley plants.

Similarly, Manoharan and Dahleen (2002) found that the number of

GUS spots present in the callus 48 hrs after bombardment at 1100

psi was greater than that following bombardment at either 900 psi

or 1300 psi. In addition, El-Itriby et al. (2003) demonstrated

that the use of osmotic medium pre- and post treatment with

acceleration pressure of 1100 psi and double shots per plate was

most efficient in transformation of maize immature embryos,

judging from the transient gus expression. Moreover, Assem et al.

(2006) demonstrated that the pressure 1100 psi revealed highest

Gus expression when compared to the 900 and 1300psi acceleration

pressure in barley. ( Bassry, 2011) concluded that the

bombardment at an acceleration pressure of 1100 psi revealed a

significantly higher number of embryos expressing the uid A gene

than the bombardment acceleration at 900 psi, thus reflecting a

higher transient transformation efficiency.

3. Callus recovery and selection.

12

The transformed callus were allowed to recover for one

week on callus induction medium without selection pressure.

Bahieldin et al. (2000) found that the recovery period

increased the transformation efficiency. In contrast,

Manoharan and Dahleen (2002) transferred the transformed

callus to callus induction medium supplemented with

bialaphos for selection directly after bombardment. After one week, selection of transformed cells were

carried out by transferring the transformed callus to callus

induction medium containing 1.5 mg-1 bialaphos for 2 weeks. The

callus were transferred onto fresh selective medium containing 3

mg-1 bialaphos, with continuous subculture every 2 weeks (Fig 2).

All cultures were kept at 28°C in a dark growth chamber.

Fig ( 2): Transient bar expression in transformed callus stevia

and regeneration : expression of bar at selectable media.

13

Selection of putatively transgenic callus .Infected callus showed normal growth on co-cultivation and

resting media without selection with loss of some callus that

failed to grow after transformation. Selection was started by

transferring stevia callus to selective medium containing 1.5

mg-1bialaphos, for 2 weeks. Then, selection pressure was raised

by transferring callus to selective medium containing 3 mg-1

bialaphos. Resistant callus were subcultured every two weeks.As shown in Table (4), Stevia revealed the highest number of

putatively transgenic callus after 2 weeks on selective medium.

However, as the selection time increased, the number of stevia

resistant callus decreased significantly.Resistant callus which grew uniformly on the selective media

by Tavazza et al. ( 1988 )

Table 4. Number of bombarded explants, number of surviving callus, number of plantlets, and transformation frequency

for stevia.

pressure

No. ofbombarde

dexplants

.

No. ofsurvive

dcallus

No. ofplantle

ts

Transformati

on frequency

%

1100 120 40a 10 a 8.3 a900 120 15b 4 b 3.3 b

Numbers with the same letters are not significantly different at

14

5%

Results in Table (4) indicated that, in total, 240 explants

were bombarded using the biolistic gene gun transformation

method. Putative transgenic lines have been obtained from the

transformation experiments of the two pressures. Transformation

efficiency has been calculated as the number of regenerated

plantlets/ number of bombarded callus. The transformation

frequency of 1100 psi was considerably higher (8.3 %) than that

of 900 psi (3.3 %).In the present study, the concentration of bialaphos, used

as a selective agent started at 1.5 mg-1 and then increased to 3

mg-1. Similar concentrations of bialaphos were applied by Gordon-

Kamm et al. (1990), Wan et al. (1995), Frame et al. (2002) and Assem

et al. (2010). The other investigators employed PPT at different

concentrations. Wan and Lemeaux (1994), Cho et al. (1998),

Horvath et al. (2000), Sivamani et al. (2000), Manoharan and Dahleen

(2002) and Pellegrineschi et al. (2004) used 5 mg-1 bialaphos in

selection induction medium. In contrast, Kishchenko et al. (2005)

increased PPT concentration from 5.0 to 10 mg-1 for selection of

transformed suspension cells of sugar beet. Moreover, Pauk et al.

(2002) and Chen et al. (2007) used 10 mg-1Bialaphos as a selective

agent.

4. Detection of integrated genes (gus and bar genes). A number of callus tissues transformed by biolistic gene

gun were subjected to molecular analysis to confirm the

integration of the foreign genes (GUS and bar gene) into callus

15

genome incorporated into the genome of stevia tissues transformed

by particle bombardment . PCR analysis.

The polymerase chain reaction (PCR) is a very useful technique

for the detection of the presence or absence of a specific DNA

fragment in the plant genome. Lassner et al. (1989) reported the

potential of using PCR for analysis of foreign genes in plant

tissues in order to check the integration of a full-length gene

(s) of interest. Total genomic DNA from transformed callus and

control (non-transformed) Stevia tissues, were analyzed using

primers specific to the coding region of the GUS gene and the

coding region of the bar gene Table 2 illustrates the sequence of

the primers used in PCR assays and their sizes. The expected

amplification product was (750 bp) for GUS gene and (484 bp) for

the bar gene

As shown in Fig. 3 The amplified fragments for GUS have the

expected size of coding region of GUS gene (750bp), lane (1)

positive control resulted from amplified plasmid pCGP1258 and

lane (2) negative control resulted from non-transformed. Fig. 3

shows the presence of bar-DNA fragment at expected molecular

weight (484bp), lane (1) positive control and lane (2) negative

control resulted from non-transgenic stevia tissues.Therefore, it is evident that both GUS and bar genes were

physically present in the genomic background of the transformed

stevia tissues. Using PCR as indicator for the presence of

foreign genes into transformed stevia tissues has been reported

16

by many investigators (Smigoki and Hammerschlag, 1991 and

Xiaojian et al. 1994) reported that PCR analysis confirmed that in

most of the putative transformats. It addition, tansgenic tissues

at different developmental stages were selected, and PCR analysis

of transgenic material will be presented. Furthermore, this

method should allow the development of assays for the transient

and homogeneous expression of promoters of various genes in Stevia

rebaudiana

(Bumpus and Dhir, 2011.)

Fig (3): PCR product of bar and Gus genes amplifying partial length (484 and 750 bp) in putative Stevia rebaudiana tissuestransformed via Biolistic gun. The arrow indicates the amplified for fragment.M= 100 bp DNA ladder (Marker)+ve = positive control. -ve = negative control.

17

484 pb

M ev+ev+ ev-

057 pb

REFERENCES

Assem, S. K.; E. H. Hussein; H. A. Hussein and B. Sara (2010).

Transformation of the salte-tolerance gene BI-GST into

Egyptian maize inbred lines.Arab J. Biotech.13:99-114.

Assem S. K.; Borg N. and El-Itraby H. A. (2006). Agrobacterium-

mediated transformation of maize inbred lines using immature

embryos and a standard binary vector system. Egypian j. of

Genetics and Cytology, 35(2):173-186.

Bahieldin, A., R. Qu, W. Dyer, A. S. Haider and M. A. Madkour

(2000). A modified procedure for rapid recovery of transgenic

wheat plants. Egypt. J. Genet. Cytol. 29: 11-23.

Bassry, Mahmoud Abd El-Raheem.(2011). Genetic transformation of

some cereal plants targeting abiotic stress. Department of

genetics, M.Sc. Thesis, Faculty of AgricultureCairo

University,EGYPT.

Beckman, T. and G. Engler (1994). An easy technique for the

cleaning of histochemically stained plant tissue. Plant Mol.

Bio. Reporter, 12: 37-42.

Bumpus . P. N. and S. K. Dhir(2011). Plant Regeneration andGenetic transformation of Stevia rebaudiana Using ParticleBombardment. Association of Research Directors,Inc.16thBiennial Research SymposiumApril 9 – 13, AtlantaMarriott Marquis Atlanta, Georgia Program& Abstracts.

Carneiro, J.W.P.; A.S. Muniz and T.A. Guedes.( 1997). Green house

bedding plant production of Stevia rebaudiana (Bert) Bertoni.

Can. J. Plant Sci. 77:473–474.

18

Chen, M.; Chen, Q.-J.; Niu, X.-G.; Zhang, R.; Lin, H.-Q.; Xu, C.-Y.; Wang, X. C.; Wang, G.-Y. and J. Chen (2007). Expression of OsNHX1 gene in maize confers salt tolerance and promotes plant growth in the field. Plant Soil Environ.,53(11): 490–498.

Cho, M. J.; W. Jiang and P. O. Lemaux (1998). Transformation of

recalcitrant barley cultivars through improvement of

regenerability and decreased albinism. Plant Sci., 138:229-

224.

Daniell, H.; J. Vivekanada ; B. Nielson. ; K. K. Tewari and J. C.

Sanford (1990). Transient foreign gene expression in

chloroplasts of cultured tobacoo cells following biolistic

delivery of chloroplast vectors. Proc. Natl. Acad. Sci., USA.

De Block, M., J. Botterman, M. Vandewiele, J. Dockx, C. Thoem, V.

Gossele, N. Roamovva, G. Thompson, M. Vanmontagu and J.

Leemans (1987). Engineering herbicide resistance in plants by

expression of aoxifin enzyme. EMBO J. 6: 2513-2518.

Duke, J. (1993). Stevia rebaudiana In: handbook of ''Alternative

Cash Crops''. CRC Press, Boca Raton, 422–424.

Duncan,B.D.(1955).Multiple range and multiple F.test. Biometrics.

11:1- 42.El Zifzafi, M. A. (2003). Physiological studies on Stevia rebaudiana

Bertoni through tissue cultures techniques and its

suitability for desert regions. Ph.D. Thesis, Faculty of

Agriculture, Cairo University, Egypt .66-70.

El-Itriby, H. A.; Assem, S. K.; Hussein, Ebtissam. H. A.;

Abdel-Galil, F. M. and Madkour, M. A. (2003).

Regeneration and transformation of Egyptian maize

19

inbred lines via immature embryo culture and biolistic

particle delivery system. In vitro Cell Dev. Biol. Plant,

39 (5): 524-531.

Felippe, G.M. and N.M.C. Lucas (1971). Estudo daviabilidade dos

frutos de Stevia rebaudiana Bert. Hoehnea, 1: 95-105.In: InVitro

Cellular and Developmental Biology Plant. 39(5): 523.

Frame, B.R.; H. Shou; R.K.; Z. Chikwamba ; C. Xiang ;

Fonger,; T.M. Pegg ; B. Li ; D. Nettletonb; D. Pei and

K. Wang (2002). Agrobacterium tumefaciens mediated

transformation of maize embryos using a standard binary

vector system. Plant Physiol., 129:13– 22.

Goettemoeller,J. and A. Ching (1999). Seed germination in Stevia

rebaudiana. Perspectives on new crops and new uses.

J.tanick(ed.),ASHS press,Alexandria,VA.,510-511.

Gordon-Kamm, W. G.; T. M Spencer; M. L. Mangano ; T. R. Adams;

R. G. Daines; W. G. O. Start ; G. V. Brien; S. A.

Chamber; Adams, W. R.; G. N. G. Willetts ; T. H.

B. Rice; C. G. Backey; R. W. Krueger ; A. P. Kausch

and P.G. Lemaux (199 0).Transformation of maize cells

and regeneration of fertile transgenic plants. Plant

Cell, 2:603-618.

Harwood, W.A.; Ross, S. M.; Cilento, P. and Snape, J. W.

(2000). The effect of DNA/gold particle preparation

technique and particle bombardment device, on the

transformation of barley ( Hordeum vulgare). Euphytica,

111:67-76.

Horvath, H.; Huang, J.; Wong, O.; Kohl, E.; Okita, T.; Kannangara, C. O. and Wettstein D. V. (2000). The production

20

of recombinant proteins in transgenic barley grains. Proc. Natl. Acad. Sci. USA, 97:1914-1919.

Ibrahim. I.A.; M.I. Nasr; B.R .Mohammed and M.M. EL-Zifzafi

(2008). Plant growth regulators affecting in vitro cultivation

of Stevia rebaudiana. Sugar Tech. 3 (10) :248-253.

Jefferson, R. A.; T. A. Kavanagh and M. Bevan (1987) GUS

fusion: beta glucuronidase as a sensitive and versatile gene

fusion marker in higher plants. EMBO J., 6:3901–3907.

Kishchenko, E.M.; Komarnitskii, I. K. and Kuchuk, N. V. (2005).

Production of transgenetic sugarbeet (Beta vulgaris L.) plants

resistant to phosphinothricin. Cell Biol. Int., 29: 15-19.

Lassner, M. W., P. Peterson and J. I. Yoder (1989). Simultaneous

amplification of multiple DNA fragments by polymerase chain

reaction in the analysis of transgenic plants and their progeny.

Plant Mol. Biol. Reporter 7: 116 – 127

Latha, S. and M. Usha (2003). In vitro culture studies on Stevia

rebaudiana. InVitro Cellular and Developmental Biology Plant.

39(5): 520-523.

Manoharan, M. and L. S. Dahleen (2002). Genetic

transformation of commercial barley (Hordeum vulgare L.)

cultivar Conlon by particle bombardment of callus.

Plant Cell Rep.,21:76-80.

Martin, G. C., A. N. Miller, L. A. Castle, J. W. Morris, R. O.

Morris and A. M. Dandeker (1990). Feasibility Studies Using

-Glucuronidase as a gene fusion marker in apple, peach, and

radish. J. Amer. Soc. Hort. Sci. 115: 686-691. (Abst.).

Miyazaki, Y.; H. Watanabe and T. Watanabe(1978). Studies on the

cultivation of Stevia rebaudiana Bertoni. Yield and stevioside

21

content of 2-year-old plants. Eisi Shikenjo hokoku., 96: 86-

89.

Mohammed, S. U.; S. H. Mohammad; M. M. Muoztaba; B.U. Mohammad;

A. Romel and M. B. Azizul (2006). In vitro propagation of Stevia

rebaudiana Bert. in Bangladesh. African Journal of

Biotechnology . 5 : (13), 1238-1240.

Murashige, T. and F.Skoog (1962). A revised medium for rapid

growth and bioassays with tobacco tissue cultures.

Physiol., Plant ., 15: 473-497.

Oddone, B. (1997). How to grow stevia. Technical manual. Guarani

Botanicals, Pawtucket, CT.

http://www.scribd.com/doc/6390515/Advances-in-Agronomy-Volume-

89.

Oviedo, C.A.( 1971). Accion hipoglicemiante de la Stevia rebaudiana

Bertoni (Kaa-he-e). Excerpta Medica. 208:92-93.

Pauk, J.; Ertugrul, F.; Bartók, T.; Mihály, R.; Kiss, O.; Cseuz,

L. and Dudits, D. (2002). Improvement of wheat abiotic

stress resistance via genetic transformation. Plant

Physiology, 46:5-7.

Sambrook, J., E. F. Fritsch and T. Manitatis (1989). Molecular

cloning: A laboratory Manual. Second Edition, Cold Spring

Harbor Lab. Press, New York, USA 2nd Ed. No.pp.1626. (Cited

from Adawy. 1998).

Sndecor, G. W. and W. G. Cochran (1990). Statistical Methods. 7th

Ed. Lowa State Univ. Press, Ames-Iowa, USA., 507.

22

Sivamani, E.; Bahieldin, A.; Wraith, J.M.; Al-Niemi, T.; Dyer,

W.E.; Ho, T.D. and Qu, R. (2000). Improved biomass

productivity and water use efficiency under water deficit

conditions in transgenic wheat constitutively expressing the

barley HVA1 gene. Pl. Sci., 155(1): 1-9.

Soejarto, D.D.; C.M Compadre; P.J Medon; S.K. Kamath and

A.D.Kinghorn (1983). Potential sweetening agents of plant

origin. Economic Botany, 37(1): 71-79.

http://www.springerlink.com/content/xw7052776224j631

Shock, C.C. ( 1982). Experimental cultivation of rebaudi’s stevia

in California. Univ. California, Davis Agron. Progr. Rep.

122.

Smigocki, A. C. and F. A. Hammerschlag (1991). Regeneration of

plants from peach embryo cells infected with a shooty mutant

strain of Agrobacterium. J. Amer. Soc. Hort. Sci. 116:1092—1097.

Tavazza R., Ordas R.J., Ancora G.(1988). Procedure for the

regeneration of plants from cell suspension protoplasts of

tetraploid potato (Solanum tuberosum L.) cv. Desirée. Plant

Sci., 58: 223-230.

Toffler, F. and O. A. Orio ( 1981). Acceni sulla pin˜

atatropicale ‘Kaa-he-e’ ou ‘erba dolce’. Rev. Soc. It.Sci.

Aliment., 4: 225-230.

http://www.springerlink.com/content/3g266784t3053253

Wan Y. and Lemaux P. G. (1994). Generation of large numbers pf indepently transformed fertile barley plants. Plant physiol., 104:37-48.

23

Wan, Y.; Widholm, J. M. and P. G. Lemaux (1995). Type I callus

as a bombardment target for generating fertile transgenic

maize (Zea mays L.). Planta, 196:7–14.

Xiaojian, Y. E., R. Scorza and J. Sanford (1994). Genetic

transformation of peach tissues by particle bombardment. J.

Amer. Soc. Hort. Sci. 119: 367-373.

Yadav, M.; D. Chaudhary; M. Sainger and P. K. Jaiwal (2010).

Agrobacterium tumefaciens-mediated genetic transformation of

sesame (Sesamum indicum L.). Plant Cell Tiss. Organ. Cult.

ارك�� م�حمدح�سن� �د م�ب �اح -ع�ب ب" لال ح�لمي' ال�ف# �مورب� ي' صر - ت�" ن� ن�# ي7' مان�2ال�د ل -اي;' ال�سراح� اس�ماع�ب'اة" ال�سوي�'س ت" ام�عة" ق�" �-ح� Jال�عري�'س �ة" ب� ي' Oئ ب' Qة" ال�ئ راع�ي' ة" ال�علوم ال�ز# ك�لي'

2- ة" اع�ي' ة" ال�زر# ي' J;دسة" ال�ورات حوثJ ال�هب# �ة"–م�عهد ب� ر# ي' �ال�ج �ة" ب� راع�ي' حوثJ ال�ز# �مرك�ز# ال�بي' ة ال�دراسة ف# ي7'ت" ه�د# ر �د اج� ة" ام�عمل ق�" راع�ي' ة" ال�علوم ال�ز# ي' ك�لي' ة" ف# ي' ت;" ا �ب ة ال�ئ# �سج راعة" الاي�# ة" ر# ي' Oئ ب' Qاة"ل�ئ ت# ام�عة" ق�" �اء ، ح� ب# مال س�ئ' Jس� ، Jال�عري�'س

ي"رة" م�ن� ال�سوي�'س ، م�صر ي' ال�ف# دسة"2012-2009ف# حوثJ ال�هب# �معهدx ب� �ة" ي� وي�' ة" ال�حي' ي' ن# ق{ معمل ال�ت" �ة" ي� ي' J;ي7'ت" ال�دراس�اث" ال�ورات ر �ما اج� ي# ئ� Qب�

ة" راع�ي' ة" ال�ز# ي' J;ال�ورات– - ة" ر# ي' �ال�ج �ة" ب� راع�ي' حوثJ ال�ز# �هدف#مرك�ز# ال�ب ة" ال�دراسة" ت�" ا الى ه�د# ب' ف# ت' اث" الاس�ئ" �ب Jى' ل�ئ# حول ال�وراث; ماي�'ز# وال�ب{ اع�ادة" ال�ي"

24

ا اب�# ودب;' �ي ت�� ا ر ب" ئ� �ف# اس�ب دام ال�صت# خ# م اس�ت" ثJ ت�" ة" ح�ي' ي' J;دسة" ال�ورات ة" ال�هب# ي' ن# ق{ دام ت�" خ# اس�ت" �ي;'زه�ا ب� طو هاون�" ت" مئ' ي# ا ل�ئ{ ب' J;اث" م�عدلة" ورات اب;" �ب اح� ت�# ب" ت;� لان� ي' �دام ح� خ# اس�ت" �ن� barب� ي' �ل�ك� ح� سJ وك�د# Oاي� Jد ال�حش ب' Qاومة" م�ئ ل�ك� gus ل�مق" اث" د# ب# ن' �ف# ال�خ اد# ة" ق�" ي' ن# ق{ دام ت�" خ# اس�ت" �#ى' ب� ل ل�وث� عطي' دل�ب' ي' ت�' ال�د#

دام خ# اس�ت" �ر ب� Jاش �ع ال�مب هار# ال�دف�# �ة ج� ف" ت7' ي Biolistic gene gun ط�ر ن# ن' �ل ال�خ ق" ة" ال�ت# طاع�طث" . لاح�داثJ ع�ملي' ع# وة" ال�ض# ق"ط 8 ح�والى' 900 ع# وة" ال�ض# دام ق" خ# اس�ت" �اء ب� رق�" ع ال�ز# ق" �ادث" ال�ت ي#ما ر# ئ� Qاء ب� رق�" ع ر# ق" �مالى' 20واع�طث" 1100 ت� �اء م�ن� اج� رق�" عة" ر# ق" �101 ت�

ط ك�الس ع# وة" ال�ض# Jى' ل�ق" حول ال�وراث; اءة" ال�ب{ ة" ك�ق# �سي ط 8.3% و 3.3 هي' 900وك�اي�#ت" ي�# ع# وة" ال�ض# .1100% ل�ق"

25