Enc1 expression in the chick telencephalon at intermediate and late stages of development

For Peer Review

Enc1 expression in the chick telencephalon at intermediate

and late stages of development

Journal: The Journal of Comparative Neurology

Manuscript ID: JCN-09-0047.R2

Wiley - Manuscript type: Research Article

Keywords: pallium, subpallium, corticoid plates, piriform cortex, amygdala

John Wiley & Sons

Journal of Comparative Neurology

For Peer Review

Figure 1. (A-D) Rostral coronal sections through the E12 chick telencephalon, going from rostral to caudal, hybridized for Enc1. The limits between VPall/LPall, LPall/DPall and DPall/MPall are indicated with white dash lines in B. (E) Detail of the olfactory bulb hybridized for Enc1 in an E18 embryo. Bar

= 0,5mm 172x229mm (400 x 400 DPI)

Page 1 of 51

John Wiley & Sons


For Peer Review

Figure 2. (A-D) Continuing series through intermediate and caudal coronal sections through the same chick telencephalon at E12 shown in Fig.1, hybridized for Enc1. The limits between Sp/VPall, VPall/LPall, LPall/DPall, CDL/DPall/LPall and DPall/MPall are shown by white dash lines in B. Bar

=0,5mm 172x229mm (400 x 400 DPI)

Page 2 of 51

John Wiley & Sons


For Peer Review

Figure 3. (A-G) Series of horizontal sections through the chick telencephalon at E12, going from ventral (near the olfactory bulb) to dorsal, hybridized for Enc1. All the pannels illustrate exclusively

the right half of the telencephalon. The limits between Sp/VPall, VPall/LPall, LPall/DPall and DPall/MPall are indicated with white dash lines in E. Bar = 0,5mm

172x229mm (400 x 400 DPI)

Page 3 of 51

John Wiley & Sons


For Peer Review

Figure 4. (A-E) Coronal sections through the rostral half of the chick telencephalon at E18, ordered from rostral to caudal, hybridized for Enc1. (B) Detail of Enc1 expression in the lateropallial corticoid plate in MD. The limits between Sp/VPall, VPall/LPall, LPall/DPall, CDL/DPall/LPall and DPall/MPall

are shown with white dash lines in E. Bar = 0,5mm 172x229mm (400 x 400 DPI)

Page 4 of 51

John Wiley & Sons


For Peer Review

Figure 5 (A-B) Coronal section through the caudal half of the chick telencephalon at E18, hybridized for Enc1. The limits between Sp/VPall, VPall/LPall, CDL/MPall/LPall are shown with white dash lines

in B. Bar = 0,5mm 173x230mm (450 x 450 DPI)

Page 5 of 51

John Wiley & Sons


For Peer Review

Figure 6 (A-F) Series of horizontal sections through the chick telencephalon at E18, ordered from ventral to dorsal, hybridized for Enc1. The limits between Sp/VPall, VPall/LPall, LPall /DPall, DPall/MPall are shown with black dash lines in D. (A-C, E) Bar =0,5mm; (D, F) Bar =1mm

177x227mm (400 x 400 DPI)

Page 6 of 51

John Wiley & Sons


For Peer Review

Figure 7 Lateral graphic reconstruction of pallial domains and specific superficial neuronal formations, as delimited by Enc1 differential labelling.

175x229mm (400 x 400 DPI)

Page 7 of 51

John Wiley & Sons


For Peer Review

Enc1 expression in the chick telencephalon at intermediate and late stages of

development

Elena García-Calero1,2

* and Luis Puelles1

1 - Department of Human Anatomy and Psychobiology, University of Murcia, Campus

de Espinardo, 30100, Murcia, Spain

2 - Institute of Neuroscience UMH-CSIC, Campus de San Juan, E03550, San Juan,

Alicante, Spain.

* Present address

Corresponding author: Luis Puelles

Email: [email protected]

Tel.: +34 968 364342

Fax: +34 968 363955

Number of text pages: 42

Number of Figures: 7

Number of Tables: 0

Abbreviated title: Enc1 in chicken embryo telencephalon

Associated editor: John L. R. Rubenstein

Key words: pallium; subpallium; corticoid plates; piriform cortex

Grant Sponsor: The present study was supported by the Spanish Ministry of Education

and Science (grants BFU2005-09378-C02-01/BFI and BFU2008-04156 to L.P and a

doctoral fellowship to E.G.C.).

Page 8 of 51

John Wiley & Sons


mailto:[email protected]

For Peer Review

Abstract

In this work we studied the regional expression pattern of Enc1 gene in the chick

embryo telencephalon at intermediate and late stages of development, bearing on

architectonic groupings and boundaries of current interest. In general, the Enc1 signal

shows a markedly heterogeneous areal pattern of expression throughout the

telencephalon; this corroborates new pallial and subpallial structures defined recently in

the stereotaxic chick brain atlas of Puelles L, Martinez-de-la-Torre M, Paxinos G,

Martinez S. (Eds.), 2007. The chick brain in stereotaxic coodinates. Academic Press,

San Diego. For example: a periventricular/central domain is Enc1-negative in the

ventral pallium or nidopallium; core and shell nuclei appear in the mesopallium; the

redefined caudodorsolateral area shows a characteristic pattern; the limits of the

densocellular hyperpallium in the dorsal pallium are illuminated; the postulated

entorhinal cortex area is distinct at the posterior telencephalic pole. Interestingly, Enc1

transcripts are distinctly present in the piriform cortex at the surface of the ventral

pallium throughout its longitudinal extent, as well as in the most rostral part of the

lateral pallium, implying a layout of this cortex more similar to the situation in

mammals than was assumed previously. Separate corticoid superficial strata are labelled

by the Enc1 probe in the lateral and dorsal pallial regions. In the subpallium, the

expression of Enc1 agrees with the new radial subdivisions defined by Puelles et al.

(2007).

Page 9 of 51

John Wiley & Sons


For Peer Review

Introduction

The Enc1 gene (Ectodermal and Neural Cortex) is the homolog of kelch, a

Drosophila gene essential for oogenesis (Xue and Cooley, 1993). Members of this

gene family are important in the organization and function of the cytoskeleton

(Varkey et al., 1995; Way et al., 1995). Enc1 is the only member of the family that is

expressed in the central nervous system, where it codifies for a protein that interacts

with cytoskeletal actin, organizing the cytoskeleton during the specification of neural

fate (Hernández et al., 1997). The Enc1 neural expression pattern was studied before in

mouse at embryonic and postnatal stages (Hernandez et al., 1997; Garcia-Calero and

Puelles, 2005); transcripts typically, but not exclusively, appear in cortical brain

structures such as cerebral and cerebellar cortex and superior colliculus. In the mouse

cerebral cortex the expression of Enc1 displays a clear areal pattern (García-Calero and

Puelles, 2005). It was postulated that the Enc1 protein may be implied in the

establishment of layered cytoarchitecture in the vertebrate brain (Hernandez et al.,

1997). In the mouse hindbrain, the Enc1 gene is expressed in neurons that form discrete

clusters disposed along radial glia, suggesting again a relationship with radial migration,

possibly associated to joint migration of clonally-related cells (Hernandez et al., 1997).

The telencephalon of birds and reptiles is characterized by a marked

development of the nuclear pallial structures in detriment of cortical or corticoid

structures. Corticoid areas show a more or less overt superficial neuronal stratum,

placed on top of a deeper nuclear formation that extends to the ventricular lining

(hypopallium of Holmgren, 1925). Here we examined the Enc1 expression pattern in

the developing chicken telencephalon within the recent model proposed by Puelles et al.

(2000, 2007). Enc1 labels badly known cortical and corticoid structures in the chicken

Page 10 of 51

John Wiley & Sons


For Peer Review

pallium, e.g., the piriform cortex and lateropallial and dorsopallial corticoid structures.

In general, the telencephalic expression of Enc1 in the chick shows a richly varied areal

pattern, in which new regions and nuclei proposed recently for both pallial and

subpallial territories are apparent (Reiner et al., 2004; 2005; Puelles et al., 2007). The

observed Enc1 expression pattern is a mosaic that opens numerous possibilities for

postulates of field homology between telencephalic structures of birds and mammals, in

the context of vertebrate phylogeny.

Material and methods

The animals were treated according to the regulations and laws of the

European Union (86/609/EEC) and Spanish Government (Royal Decree 223/1998)

for care and handling of research animals.

Preparation of tissue

Chick embryos were obtained from commercial fertilized eggs incubated in the

laboratory in standard ventilated incubators at 38°C. Embryos incubated for 10 and 12

days (E10, E12) were sacrificed and the heads were fixed overnight in 4%

paraformaldehyde in pH 7.4 phosphate-buffered saline (PBS). In addition, E18 embryos

were anesthetized on ice and perfused with the same fixative solution transcardially. All

brains were dissected out and postfixed for 48 hours at 4ºC. After this, the tissue was

embedded in 4% agarose in PBS and was vibratome-sectioned in various planes, 120

µm-thick for in situ hybrization.

Page 11 of 51

John Wiley & Sons


For Peer Review

In situ hybridization

For chicken Enc1 riboprobe preparation, we used a 2326 bp fragment of the gene,

subcloned in the pBluescript SK vector (gift of M.C.Hernandez). The insert was

sequenced (SAI; University of Murcia) using the following primers: two external

primers T7- CGTAATACGACTCACTATAGGGCGA and T3-

GCAATTAACCCTCACTAAAGGGAAC and four internal primers ClEnc1-Seq1-

CCTTTGTGATGACTTGAAGC, ClEnc1-Seq2- CGGACTGCTGTTTGTATGAG,

CrEnc1-Seq1- GACTAGGAGCTTTGAAATTCA, CrEnc1-Seq2-

CCACTCAGTTGATCATCTGA. The resulting sequences (three sequentiations per

primer) were assembled, and a unique consensus sequence of 2326 nucleotides was

obtained. Several alignment approaches (UCSC, VISTA, NCBI, and Ensembl tools)

indicated that a set of 587 nucleotides at the start of the clone align with the 3’ end of

the homologous Homo sapiens Enc1 gene (NM_003633.1; positions 1897-2484; 74%

similarity). The first 272 nucleotides are codifying and lie before the stop codon from

the Gallus gallus Enc1 gene (comparable to Homo sapiens NM_003633.1; positions

1897-2169), and the aligned sequence up to nucleotide 587 continues with the adjacent

part of the 3´ UTR mRNA region. The rest of the insert -1739 bp- aligns with the 3’

UTR region of the Enc1 gene in several vertebrates (VISTA browser). This sequence

was submitted to GenBank (provisional locus bankit1236572; provisional accession

number 1236572). Digestion of the fragment with SalI preceded synthesis of the

antisense riboprobe by in vitro transcription with T3 polymerase (Roche), in presence of

digoxigenin-11-UTP. Purification of the probe was performed using Quick Spin

Columns (Roche). The hybridization protocol was according to Shimamura et al.

(1994). As general in situ hibridization controls, sense (using PstI and T7) and antisense

probes were applied to adjacent representative sections (in every case the signal was

Page 12 of 51

John Wiley & Sons


For Peer Review

present only with antisense probe), and some sections were processed without either

sense or antisense probes, to check for posible background depending on the other

reactives used in the standard in situ hibridization procedure.

Image capture, manipulation and figure assembly

Digital microphotographs were obtained on a Zeiss Axioscan microscope

equipped with a Zeiss Axiocam digital camera. Digital images were processed for

contrast and brightness with Adobe Photoshop 6.0 and Adobe Photoshop Elements.

Results

Ventral pallium

The ventral pallium was defined as a new radial ontogenetic unit of the pallium

in vertebrates, in addition to the older concepts of medial, dorsal and lateral pallium

(Puelles et al., 2000; 2007). Its mature form in birds used to be called “neostriatum” and

was recently renamed as “nidopallium” (Reiner et al., 2004); it otherwise corresponds to

the ventral part of the dorsal ventricular ridge, the hypopallial bulge characteristic of

sauropsidian brains. This is the largest radial pallial domain in the avian brain; it

contacts the underlying striatum (across the palliosubpallial boundary) and the

overlying lateral pallium (“mesopallium” of Reiner et al., 2004). The vast neuronal

population of the ventral pallium includes a number of specialized periventricular,

intermediate or superficial neuronal aggregates, distinguished as strata, nuclei or

islands, depending on their relative size and aspect. The best known of these aggregates

Page 13 of 51

John Wiley & Sons


For Peer Review

are several modality-specific sensory thalamorecipient nuclei; these are surrounded by

“associative” counterparts relaying processed signals towards higher-level ventropallial

associative formations at the caudal telencephalic pole and the amygdala. The ventral

pallium contains also superficially part of the olfactory cortex and ends rostrally with

the olfactory bulb and the anterior olfactory areas that surround its stalk. We will

describe our results in sections dedicated to the olfactory structures, the

thalamorecipient nuclei with the surrounding associative domains, and the amygdala.

a) Olfactory structures

The different olfactory structures show a characteristic Enc1 expression pattern.

The olfactory bulb expresses Enc1 strongly in the granular layer and weakly in the

mitral cell layer (Figs. 1B-E). The anterior olfactory area, whose dense cell plate forms

a ring around the stalk of the olfactory bulb, is also positive and shows the most intense

Enc1 signal in its dorsal subdivision (AOD, AOV; Figs.1A-D). Classically, the avian

olfactory cortex was described as decomposed into disjoint rostral (prepiriform) and

caudal (piriform) components (Kuhlenbeck, 1938; Dubbeldam, 1998). Interestingly,

present data suggest a continuity of these two components, mediated by a normally

inconspicuous extension of the prepiriform cortex which expresses strongly Enc1. This

signal appears in an intensely positive corticoid island that sits on top of the lateral

olfactory tract (itself identifiable by experimental labelling , Reiner and Karten, 1983,

and characteristic expression of calretinin; Puelles et al., 2007). The prepiriform

corticoid plate is separated by a cell-poor gap from a deeper cell lamina that also

expresses Enc1; both laminae are continuous rostrally with the AOV (PPir; Figs.1B-D;

2A-C; 3C-F; 4B-E; 5A, B; 6C, D). It should be noted that there exists rostrally an

Page 14 of 51

John Wiley & Sons


For Peer Review

additional sector of prepiriform cortex that lies within the lateral pallium (mesopallium

of Reiner et al. 2004; Puelles et al., 2007; see below).

Caudally, the prepiriform cortex ends short of the amygdala (sensu Puelles et al.,

2007; old “archistriatum”), whose superficial stratum displays a single Enc1-positive

laminar condensation, the piriform cortex, which is not clearly delimited from deeper

pallial amygdaloid elements, such as the amygdalopiriform area (Puelles et al., 2007;

Pir in Figs.2D; 3D-F; 5C, D; 6D,F). It is so far unclear whether part of this

periamygdaloid piriform cortex may correspond to olfactorecipient cortical amygdaloid

areas of mammals. The piriform cortex reaches caudally to the lateral angle of the

caudal horn of the lateral ventricle, where it limits with the similarly olfactoreceptive

entorhinal cortex (Puelles et al., 2007; Reiner and Karten, 1983 identified it as ‘piriform

cortex’), considered to be a component of the medial pallium because of its lack of

hypopallial structure (Puelles et al., 2007; see below).

b) Thalamorecipient nuclei and related associative areas

The ventral pallium encloses several thalamorecipient nuclear formations, as

well as associative areas (Puelles et al., 2000; Reiner et al., 2004, 2005), including the

so-called island fields (Redies et al., 2001). We found that Enc1 expression shows a

heterogeneous pattern in these different formations; in general the associative areas

disposed dorsally, adjacent to the overlying mesopallium, express more strongly Enc1

than the more ventral portions that lie next to the subpallium.

Rostrally, there is the basal somatosensory nucleus (BSS), which receives the

ascending quintofrontal tract (carrying somatosensory input from the trigeminal main

sensory nucleus; Wallenberg, 1904; Witkovsky et al., 1973; Wild et al., 1985); it is

placed superficially at rostral levels of the ventral pallium (frontal nidopallium),

Page 15 of 51

John Wiley & Sons


For Peer Review

juxtaposed to the palliosubpallial border. The BSS is surrounded by an associative

somatosensory “shell area” (BSh). The BSS core appears negative for Enc1 at 10 days

(not shown), but is moderately positive at the older stages studied (E12, E18), whereas

its shell area shows a moderate to strong Enc1 expression at these stages (BSS, BSh;

Figs. 1D; 2A; 3A-C; 4C).

The visual core nucleus (VisCo; Puelles et al., 2007; old ectostriatum) is a

ventropallial subregion found caudal to the BSS, in the superficial part of the

intermediate nidopallium; it receives tectofugal visual input via the thalamic nucleus

rotundus (Karten and Revzin, 1966; Karten, 1969; Karten and Hodos, 1970); the entire

complex consists of a core portion (VisCo) plus an associative shell (VisSh), both of

which initially display Enc1 transcripts at 10 incubation days (not shown); however, at

12 and 18 days of incubation the Enc1 signal appears increasingly restricted to the core

portion and the VisSh becomes distinctly negative, contrasting with the strongly

positive nidopallial island field that surrounds it (VisCo, VisSh, NIF; Figs.1D: 2A, B;

3D-F; 4C, D). A separate, intensely positive locus associated to the NIF at intermediate

ventropallial levels is the dorsal intermediate nidopallial nucleus (NID; Puelles et al.,

2007; Figs.2A,B; 3F,G; 4D,E; 6F). The positive associative domain surrounding the

VisSh expands laterorostrally at the superficial intermediate nidopallium (NIS; Figs.1B-

D; 2A,B; 3C-E; 4B-E).

In the caudomedial part of the ventral pallium (caudal nidopallium), lies the

auditory core nucleus and its associative shell formation (AuL), a large ovoid region

clasically called “L field”. This sensory area receives auditory input from the thalamic

medial geniculate nucleus, formerly known as ovoidal nucleus (Karten, 1968, 1969;

Wild et al., 1993; Puelles et al., 2007). Only the sector that lies adjacent to the lateral

Page 16 of 51

John Wiley & Sons


For Peer Review

pallium and the more caudal periventricular stratum show strong Enc1 signal

(Aul/AuL1; Figs. 2C, D; 5).

Wild (1987) described a caudal somatosensory area just caudal to the VisCo,

which may coincide with the caudolateral core nucleus (CLCo) identified by Puelles et

al. (2007). In our preparations, this region shows moderate Enc1 expression, much

alike the VisCo, and it is surrounded by the nidopallial caudal island field (NCIF),

which has intense Enc1 signal, like the NIF (CLCo; NCIF; Figs. 2C, D; 3F, G).

Superficial to the NCIF field there appears the more homogeneously positive superficial

caudal nidopallium, which shows a positive corticoid plate (NCS; NCcp; Figs.2C; 3E-

G; 5A, B).

While the diverse sensorially specialized parts of the ventral pallium and their

respective shell areas occupy ventral relative positions in the neighborhood of the

pallio-subpallial border, the overlying ventropallial region reaching the brain surface

and the ventral pallial lamina is thought to be associative in character (Reiner et al.

2004; Jarvis et al., 2005). This associative ventropallial domain extends from the

ventricle to the brain surface and displays, particularly at intermediate and caudal

section levels, alternating clusters of isoneurogenic (same birthdates; Striedter and

Keefer, 2000) and isoadhesive (same cadherin expression; Heyers et al., 2003) neurons

forming islands, surrounded by a relatively younger and differentially adhesive matrix

population (nidopallial island field in Puelles et al., 2007). In our material there is

intense expression of Enc1 throughout the nidopallial island field (NIF, NCIF; Figs.2A-

D; 3D,E; 5), though close examination indicates that the islands show a higher level of

signal than the surrounding matrix elements (e.g., Fig.2B, islands impinging into VisSh;

Fig. 6F, islands lateral to NCCe).

Page 17 of 51

John Wiley & Sons


For Peer Review

Caudal to the olfactory bulb complex and deep to the BSS nucleus lie the

periventricular and central areas of the frontal nidopallium. This is largely negative for

Enc1 signal, though a dorsal subdomain adjacent to the border with the lateral pallium

(mesopallium) is strongly positive (NFCe; Fig. 1D). This tandem configuration of

ventral negative and dorsal positive deep ventropallial domains extends essentially

unchanged caudalward into the intermediate and caudal regions of the ventral pallium,

and may even be thought to include the auditory L field area (NICe; AuL; Figs. 2A,B;

3D-G; 4C-E; 5) and expand caudolaterally via the NCCe found under the NCIF towards

the amygdala (the topological caudal pole of the telencephalon; Fig.2D; 5B-D; 6F).

c) The amygdala

The amygdala complex is majoritarily Enc1 positive (note our amygdala

corresponds to the classic archistriatum; see Puelles et al., 2007; Reiner et al., 2004

called part of this domain “arcopallium”, setting aside a more restricted avian amygdala;

in contrast, other authors reviewed by Puelles et al., 2007 contemplate the possibility

that the avian amygdala may be substantially larger than the classic archistriatum). This

amygdaloid signal is best appreciated in horizontal sections at all stages examined

(Figs.3D-F; 6D), but is also observable in cross-sections (Figs.5C, D). The dorsal

amygdaloid area (ADo), the posterior amygdaloid area (APo) and the core amygdaloid

complex (ACo), defined according to Puelles et al. (2007), show high levels of Enc1

transcripts, with the exception of the core nucleus 1 portion (ACo1; Figs.3E,F; 5C, D).

The nucleus taeniae is only moderately positive (ATn; Figs.3E,F; 5D), whereas the

amygdalohippocampal nucleus is strongly positive (AHi, Figs.5C, D). The amygdalo-

piriform area, a transition zone between the piriform cortex and the rest of the

amygdala, shows also a similar intense pattern of Enc1 expression (APir; Figs. 2D; 5D).

Page 18 of 51

John Wiley & Sons


For Peer Review

On the other hand, the hilar region shows low to moderate levels of expression, higher

in the corresponding core region (AHil; AHilCo; Figs.3E; 5C, D).

Lateral pallium

The lateral pallium corresponds in the classical literature to the ventral

hyperstriatum (dorsal part of the DVR), which was recently renamed “mesopallium”

(Reiner et al,. 2004; Puelles et al., 2007). This radial domain does not reach the caudal

telencephalon and is divided in dorsal and ventral mesopallium (MD, MV).

The MD is characterized by an extensive radial core nucleus that is surrounded

by a shell subdomain (MDCo, MDSh), and is topped by a compact superficial corticoid

plate (MDcp). Rostrally, the MD and MV extend over the anterior olfactory areas and in

front of the dorsal pallium towards the medial surface of the hemisphere (meeting

eventually the rostralmost medial pallium). The MV is characterized by a sizeable ovoid

core nucleus lying under an undistinct corticoid superficial stratum (MVCo; Figs.1C,D;

3E-G; 4C-E; 6E). Horizontal sections show more clearly than cross-sections the

structure and relationships at MD and MV (Figs.3 and 6).

The dorsal mesopallium is in general strongly positive for Enc1, underlining its

periventricular, central and superficial strata. The strongest signal is found in the MDcp

and the MDCo. The MDcp is thicker adjacent to the dorsal pallium and thins out both

caudalwards and towards the MV (MDcp; Figs. 3; 4B; 6C-F). Only the thicker part of

this layer lies subpially, since the thinner portion adopts a deeper position and is

covered superficially, as is the adjacent MV, by part of the rostral prepiriform cortex

(Puelles et al., 2007). The MDCo has a superficially expanded plate deep to the MDcp

(resembling a second layer to it, though part of the surrounding less dense shell domain

separates them) and a dense stalk that reaches the periventricular stratum (Figs. 3C -F;

Page 19 of 51

John Wiley & Sons


For Peer Review

4C; 6C,E). This stalk portion thickens progressively caudalwards, and finally forms the

major part of the MD, always found underneath the dorsal pallium until its caudal end

(MD; Figs.1D; 2A,B; 3G; 4D,E). The shell domain surrounding the MDCo shows a

weaker Enc1 signal.

The ventral mesopallium in general shows less Enc1 signal and is also less cell

dense than the dorsal mesopallium. It also appears subdivided in periventricular, central

and superficial parts. In the central part of MV we typically find dense clusters of cells

with moderate expression of Enc1 transcripts, which are surrounded by a clearer matrix

(MVCe; Figs. 1C, D; 2A; 3F, G; 4C-E; 6F); this area is separated from the underlying

central region of the nidopallium by a slightly discontinuous band of cells that expresses

more strongly Enc1; this corresponds to the mesopallial island field, or MIF, first

recognized as containing isochronic islands by Striedter and Keefer (2000), isoadhesive

islands by Heyers et al. (2003), and recently more extensively mapped by Puelles et al.

(2007) on the basis of a characteristic calretinin-positive cell population (MIF; Figs.

1D;2A, B; 3B-G; 4C-E; 6A-D). In the superficial part of MV, there is the massive core

nucleus (MVCo; Figs.1C, D; 3E-G; 4C-E; 6E), which is largely Enc1-negative and

appears surrounded by a belt of moderately positive cells, the superficial MV; the latter

has a slightly more compact component at the brain surface, constituting the corticoid

plate of the MV (MVcp).

As mentioned above, the rostral lateral pallium overlying the anterior olfactory

area, in front of the rostral pole of the dorsal pallium, contains a part of the prepiriform

cortex (Puelles et al., 2007). We observe there a strongly Enc1-positive compact

corticoid plate, intercalated between sparsely populated superficial and deep plexiform

layers; the superficial layer contains fibers of the lateral olfactory tract (Text Fig.13 in

Puelles et al. 2007; PPir (LPall); Figs.1A,; 3A,B; 6A,B). This Enc1-positive cortex is

Page 20 of 51

John Wiley & Sons


For Peer Review

continuous ventral- and caudalwards with the ventropallial part of the prepiriform

olfactory cortex. The rostromedial lateropallial region found in contact with the medial

pallium includes the so-called retrobulbar area, which also shows a moderate Enc1

signal (RB; Figs.1D).

The caudodorsolateral area

The caudodorsolateral area (CDL) was classically conceived merely as a

corticoid (superficial) specialization of the caudal hyperstriatum or lateral pallium

(Karten and Hodos, 1967; Kuenzel and Masson, 1988). Redies et al (2001) suggested

that this area probably corresponded to a radially complete histogenetic domain

intercalated between the lateral pallium and the caudolateral medial pallium.

Accordingly, the CDL was represented not only subpially, but also at intermediate,

periventricular and ventricular levels. This idea was expanded in the Puelles et al.,

(2007) atlas, redefining the relationships of the CDL with the dorsal, lateral, ventral and

medial pallial domains, and contemplating a superficial CDL corticoid plate (CDLcp),

as well as a compact CDL core nucleus (CDLCo) in the intermediate stratum, rostrally,

close to the boundary with the dorsal pallium, and a caudal periventricular

condensation, identified as the classical “high vocal center” or HVC. In our material, the

CDLcp and the CDLCo are not yet clearly distinct one from another at E12, though the

intermediate stratum has a stronger expression of Enc1 than the moderately positive

corticoid plate (CDL; Figs.1D; 2A, B). At E18 the corticoid plate of the CDL still

displays a moderate presence of Enc1 transcripts, whereas the core nucleus (CDLCo) is

now compact and has an intense Enc1 signal (CDLcp; CDLCo; Figs. 4D, E; 5A).

Caudally, the HVC also shows strong Enc1 signal, surrounded by moderate expression

in the periventricular stratum (HVC; CDLPe; Fig. 5B).

Page 21 of 51

John Wiley & Sons


For Peer Review

Dorsal pallium

The dorsal pallium is the region of avian telencephalon held to be field

homologous to the general cortex in mammals (Puelles, 2001; Puelles et al., 2007). It is

subdivided in four main radial domains, which recently were renamed densocellular

hyperpallium (HD), intermediate hyperpallium (HI), intercalated hyperpallial area

(IHA) and apical hyperpallium (HA) (Medina and Reiner, 2000; Reiner et al., 2004;

Puelles et al., 2007).

Enc1 expression is generally high in the dorsal pallium. At E10 and E12 the four

dorsopallial subdomains are not yet distinct; we found a more intense lateroventral

sector, which probably encompasses the still incompletely differentiated HD, HI and

IHA parts, whereas the moderately positive mediodorsal sector would correspond to the

prospective HA subdomain (DPall; Figs. 1A-D; 2A,B; 3B-G). The medial end of the

HA lies approximately at the level where the periventricular stratum changes from being

positive in the HA to negative in the adjoining medial pallium. This limit also roughly

coincides with the change between the intensely positive mediopallial cortical plate (a

dense superficial plate) and the undistinctive subpial stratum of the HA (Figs.1A-D; 2A,

B; 3D-G). The lateral boundary of the hyperpallium is a curved plane that courses

towards the medial vallecula (Puelles et al., 2007). At E18, the four dorsopallial

subdomains can be identified. The IHA clearly shows the strongest Enc1 signal, and

appears as a curved dense positive band separating HI from HA (Figs.4A, B; 6C-F). In

favorable section planes, it was noted that the HD subdomain has a dense corticoid

plate, intensely positive for Enc1, which is lacking in the HI and other hyperpallial

subdomains (Figs.4C; 6C-E). As the dorsal pallium complex dwindles to an end at the

middle of the telencephalon, the obliquity of its radial dimension relative to the plane of

cross-sections makes it appear as if it loses contact with the brain surface and retracts to

Page 22 of 51

John Wiley & Sons


For Peer Review

its periventricular portion. This implies that there is an oblique orientation of its radial

glia architecture relative to our section plane. In this transitional area, close to the caudal

end of the dorsal pallium, we observed that the strongly Enc1-positive HD subdomain

thickens, particularly close to the ventricle; here is where its densocellular characteristic

becomes most noticeable (Figs.4D, E; 6F). The other hyperpallial subdomains gradually

disappear caudalwards (substituted by the CDL) and the periventricular HD is the

caudalmost visible part of the dorsal pallium.

Medial pallium

The medial pallium is subdivided in two main subregions, the hippocampus

and the parahippocampal cortex. The medial pallium lies rostrally at the

medial wall of the telencephalon (MPall; Figs. 1A-D; 2A; 3F,G; 4C-E), but extends

backwards obliquely to a lateral end behind the amygdala, always following the lateral

ventricle to its caudolateral end (Mpall; Figs.2D; 3D-G; 5C, D; 6F). Here it contacts the

caudal piriform cortex and the arcopallium/amygdala. The hippocampus is shaped as a

tappering flap that finishes in the fimbria, which represents its main efferent tract. The

parahippocampal cortex can be subdivided into the four radial parts distinguished by

Redies et al., (2001) and Kovjanic and Redies, (2003): medial, intermediate, lateral and

caudolateral parahippocampal areas, plus a fifth region that was added by Puelles et al.

(2007), the apical parahippocampal area (PHiA), which intercalates between the PHiL

and the DPall, rostrally, and between the PHiL and the PHiCL, caudally. Enc1 appears

expressed differentially in these parts of the medial pallium, although in general there is

a strong signal in each part.

In the hippocampus itself, Enc1 expression pattern is homogeneously strong (Hi;

Figs.1D; 2A; 3G; 4E). The dentate gyrus primordium, recently described at the medial

Page 23 of 51

John Wiley & Sons


For Peer Review

tip of the hippocampus (Puelles et al., 2007), shows a similar Enc1 pattern (DGP; Fig.

2A).

The medial parahippocampal area is characterized by a prominent extra

superficial layer that bulges at the brain surface, which also has strong Enc1 expression

(PHiM; Fig.1B-D; 2A-D; 5A). This outer layer is separated by a largely negative outer

cell stratum from the strongly positive deep cellular stratum (PHiM; Figs. 2A-C; 5B).

The intermediate parahippocampal region shows again homogeneous Enc1 signal

throughout its radial extent (PHiI; Figs. 1C, D; 2A-C; 5A,B). The lateral

parahippocampal region typically has a cell poor periventricular layer, which appears

negative in our preparates, as well as bilayered superficial cell plate, which also

expresses strongly Enc1 (PHiL; Figs.1; 2A-C; 5A, B). The apical parahippocampal

region has a moderately positive outer stratum and a negative or weakly positive deep

stratum (PHiA; Figs.1A-D; 2A,B; 4C-E; 5A, B). The caudolateral parahippocampal

region appears behind the caudal end of the dorsal pallium, where the lateral ventricle

expands laterally; it is thinner than the other medial pallium parts and its cell plate

shows clustered cell aggregates with differential adhesive properties (Redies et al.,

2001; Kovjanic and Redies, 2003). It shows an intense Enc1 expression, which appears

maximal within the clusters; this area finally enters in contact with the caudal piriform

cortex (ie. Figs. 2C, D; 3G; 5A; PHiCL).

Finally, in the transition zone between caudolateral parahippocampus and

piriform cortex, we observed the entorhinal cortex belonging to the medial pallium.

This region displays an intense Enc1 signal in its external layer, in contrast with the

negative inner stratum (Ent; Figs.2D; 3G).

Subpallium

Page 24 of 51

John Wiley & Sons


For Peer Review

The subpallium is the other major subdivision of the telencephalon, apart the

pallium. These two domains are separated by the palliosubpallial boundary, a glial

pallisade extending from the ventricular lining to the pial surface. Molecular markers

suggest a subdivision of the subpallium in three concentric zones: striatum,

pallidum/peduncular (innominate) area and preoptic region (Puelles et al., 2000, 2004,

2007). Recently Puelles et al., (2007) attending to radial domains observed the existence

of new subpallial subdivisions. We will use this information for the description of Enc1

gene.

The striatal capsule, described recently by Puelles et al., (2007) as a thin striatal

domain parallel to the palliosubpallial boundary, displays intense Enc1 signal (StC;

Figs. 3B, C). In the rest of the striatum, there is generally a moderate expression of

Enc1 in the medial and lateral striatal parts (MSt, LSt; Figs. 2C; 3D-G; 4D, E; 5A, B).

Rostromedially, the accumbens nucleus shows a high presence of Enc1 transcripts in its

mantle layer, but lacks expression in the periventricular zone (Acb/StPalAcb; Fig 2A,

B; 3B, C; 4D, E). The recently defined striatopallidal area (Puelles et al., 2007), a

chemo-architectonically distinct striatal subdomain adjacent to the striatopallidal border,

shows a moderate Enc1 expression, except in the intrapeduncular nucleus, located as a

separate island in its intermediate mantle, which shows an intense expression of Enc1

(StPal, InP; Figs. 2C; 3D, E; 5A, B). Both the striatal and pallidal parts of the olfactory

tuberculum show a moderate presence of Enc1 transcripts (Tu; Figs. 2C; 4D; 5A, B).

We observed similar moderate expression in the caudal telencephalon, in the transition

region between the striatum and the amygdala, called the striatoamygdaloid area, in

contrast with the extended amygdala region, which shows a high expression of the gene

analyzed (StAm, EA;Figs. 3D-F; 5C).

Page 25 of 51

John Wiley & Sons


For Peer Review

The Enc1 transcription in the pallidal derivatives (pallidum, ventral pallidum,

ectopic pallidum, pallidoseptal area, bed nuclei of the stria terminals) is relatively

weaker, since the pallidal region is largely formed by dispersed cells (Figs.2C; 3D-F;

4D; 5A, B). In the peduncular or innominate region, the part of this radial domain next

to the preoptic area, we observe a moderate expression of Enc1 in the basal

magnocellular nucleus (B), diagonal band nuclei (HDB, VDB) and nucleus of the ansa

lenticularis, whereas the bed nuclei of stria terminalis complex shows a high presence of

Enc1 transcripts (Bst; Figs. 3D-F; 5C).

The septum is a complex located at the medial telencephalic wall, consisting of a

small Enc1 positive pallial sector, dorsally placed, and a large subjacent subpallial

sector that fuses laterally with the three subpallial regions of the lateral wall via

transitional regions under the lateral ventricle. These septal areas also show Enc1

expression, represented largely by transcripts in the lateral and medial septal nuclei

(MS, LS; Figs.2C; 5A, B). The septal transition domain to the pallido-peduncular region

shows moderate Enc1 expression (PalSe; Figs.2C; 5B). We described above the septal

transition into the striatum, the accumbens nucleus.

Finally, in the preoptic region (a non-evaginated, impar subpallial telencephalic

territory; Puelles et al., 2007) we observe a weak to moderate expression of the gene in

its different nuclei (Fig. 2D).

Discussion

By analyzing for the first time the telencephalic Enc1 expression in chicken

embryos at different developmental stages, we made a detailed, even if partial,

chemoarchitectonic study of distinct telencephalic territories in birds, testing the

Page 26 of 51

John Wiley & Sons


For Peer Review

topology and boundaries of different pallial and subpallial regions recently described or

renamed (Reiner et al., 2004, Puelles et al., 2007).

Enc1 expression in the olfactory cortex

Hernández et al., (1997), analysing the function of Enc1 in the mouse brain,

observed expression of this gene in different cortical structures, and proposed that it

might play a role in development of layered structures in general in the vertebrate CNS.

In our material, we detect indeed the presence of gene transcripts in different pallial

cortical or corticoid structures, which is of interest, since these elements have not been

analyzed in detail in the past. However, Enc1 signal is not restricted to corticoid

primordia, and appears as well in nuclei and other neuronal aggregates. The olfactory

bulb and the structures interpretable as the avian homologues of the prepiriform and

piriform cortex (and potential corticoid amygdaloid areas) constitute the best known

areas among them. There is no distinctive feature of the avian olfactory bulb, apart of its

small size and the well-known absence of an accessory bulb formation. Conventional

cytoarchitectonic analysis was previously unable to distinguish a piriform cortex

throughout the length of the olfactory pathway at the brain surface; only isolated

anterior and posterior patches were described (Kuhlenbeck, 1938, 1977; Karten and

Hodos, 1967; Reiner and Karten, 1985; Dubbeldam, 1998). Only Puelles et al. (2007)

annotated a continuous olfactory cortex, partly based on preliminary data from the

present study. Strong expression of Enc1 in the previously identified rostral and caudal

olfactory cortex patches as well as in an intervening band of superficial cells allowed us

to follow the path of piriform cortex through the whole pallium from the olfactory bulb

to the amygdaloid region (Fig. 7). It was shown that calretinin, a marker of the lateral

olfactory tract fibers, is selectively present throughout this novel olfactory corticoid

Page 27 of 51

John Wiley & Sons


For Peer Review

domain at its marginal stratum (Puelles et al., 2007; their Text Fig.13). The

autoradiographic analysis of olfactory bulb projections performed by Reiner and Karten

(1985) in the pigeon also produced continuous label along the surface of the brain, but

the intermediate portions were interpreted by the authors as mere labelling of passing

fibers destined to the caudal piriform cortex patch. These data accordingly are also in

principle consistent with the present interpretation, though this point should be

reexamined with more sensitive techniques. Our finding of a continuous

prepiriform/piriform cortex structure in the chick would resolve the long-standing issue

regarding apparent lack of similarity of the olfactory cortex between birds and other

vertebrates. Nevertheless, it is also clear that the microsmatic nature of birds is

accompanied by substantial reduction in size of the related olfactory centers.

On the other hand, the olfactory cortex in mammals and other vertebrates is a

hybrid pallial structure composed of two parts developed respectively within the lateral

and ventral pallium domains (Puelles et al., 2000; Medina et al., 2004; Puelles et al.,

submitted). Puelles et al., (2007) described a lateropallial part of the piriform cortex in

adult chicken, based in the presence of superficial calretinin expression and reelin

immunoreactive patches (Garcia-Calero, 2005). Reelin is a marker reported as strongly

expresed in the lateropallial portion of the olfactory cortex in mammals and reptiles

(Goffinet et al., 1999; Bar et al., 2000; Tissir et al., 2003). This presumably olfactory

lateropallial domain was identified only at the rostral part of the prepiriform cortex,

which displays intense Enc1 signal in our material, and is continuous with the

ventropallial prepiriform cortex (Fig. 7). This indicates that also in this aspect the

olfactory cortex of birds may not be as dissimilar from that of other vertebrates as is

commonly thought.

Page 28 of 51

John Wiley & Sons


For Peer Review

Enc1 expression in ventral pallium, excepting olfactory cortex

The major part of the ventral pallium (also called nidopallium; Reiner et al., 2004;

Puelles et al., 2007) is a large hypopallial neuronal mass that contains a variety of

sensorial nuclei receiving specific thalamic inputs, surrounded by “associative”

populations (old ectostriatum, now called visual core nucleus [VisCo] by Puelles et al,

2007, or “entopallium” by Renier et al., 2004; L field , now auditory L Field [AuL]; and

n. basalis, now basal somatosensory nucleus [BSS]; Puelles et al., 2007). The general

expression pattern observed in our Enc1 material consist in intense signal in the

associative areas disposed dorsally, close to the lateral pallium or mesopallium (NIF,

NID, NCIF, NIS, NCS), encompassing the NIF and NCIF areas organized in clusters or

“islands” surrounded by “matrix” components, as defined by Redies et al. (2001) on the

basis of differential expression of cell surface adhesion molecules (Puelles et al., 2007

partially redefined these terms). Striedter and Keefer (2000), and Heyers et al. (2003)

noted differential neurogenetic profiles between the island and matrix components. In

our material the islands show higher Enc1 expression than the surrounding matrix. In

contrast, the thalamo-recipient areas located more ventrally next to the palliosubpallial

limit and their respective associative shell areas have a moderate Enc1 expression

pattern (BSS, BSh, VisCo, VisSh, AuL and CLCo). The caudolateral core nucleus or

CLCo (mentioned previously in Puelles et al., 2007) was included in the group of

ventropallial sensorial receptive nuclei since it seems to correspond with the locus

receiving somatosensory input (Wild, 1987) in the caudal ventral pallium. Before the

avian pallial terminology was changed, Redies et al. (2001) first distinguished this area

by its strong expression of R-cadherin and lack of cadherin 7 signal, referring to it as the

“retroectostriatal nucleus”. In our study we observe that the Enc1 expression in CLCo is

similar to that in VisCo and both typically contact directly the boundary with the

Page 29 of 51

John Wiley & Sons


For Peer Review

subpallium. The presence of a caudolateral shell area is not clearly observed in our

material; however, we don’t discard this possibility. Moreover, the CLCo is also

surrounded by an associative island field, in this case the NICF, showing the typical

topological disposition observed relative to the other thalamorecipient nuclei of the

ventral pallium.

Another ventropallial structure first described by Puelles et al. (2007) is the

dorsal field of the intermediate nidopallium or NID, which appears at middle levels of

the NI, filling up a restricted dorsal deflection of the ventral pallial lamina. In our

material, which partly assisted the Atlas identification, the NID shows a particularly

intense Enc1 signal (see Figs.4D,E). We are not aware of connectivity data relative to

this particular locus, apparently unknown to earlier authors.

The ventral pallium also contains a negative domain in the region called by

Puelles et al., (2007) periventricular/central part of the frontal, intermediate and caudal

nidopallium (NFPe, NFCe, NIPe, NICe, NCM). This region contrasts with other areas

of the ventral pallium by its lack of Enc1 expression, though a dorsal stripe of cells

adjacent to the ventral pallial lamina is Enc1-positive. Previously, Redies et al. (2001),

defined a similar territory by the presence of strong cadherin-7 immunoreaction in the

Enc1-negative area, such immunoreaction being absent in the dorsal Enc1-positive

stripe. However, cad7 was excluded from the periventricular stratum, in contrast with

our results, where the Enc1 negative domain also extends into the periventricular

portion. It is posible to follow this combination of a larger ventral Enc1-negative/cad7-

positive domain with a dorsal Enc1-positive/cad7 negative stripe to the most caudal part

of the ventral pallium domain, close to the AuL, or even encompassing it, since

periventricular AuL1 is positive, whereas AuL2 and AuL3 are largely negative (Redies

et al., 2001; present results). It may be useful to denominate this entire periventricular

Page 30 of 51

John Wiley & Sons


For Peer Review

and central longitudinal territory across frontal, intermediate and caudal parts of the

ventral pallium (nidopallium) as the “deep ventral pallium” or “deep nidopallium”. The

caudal domain within this complex coincides with the caudomedial nidopallial region

described in songbirds, which has been related to song memory functions, together with

the caudomedial mesopallium (reviewed in Bolhuis and Gahr, 2006). Interestingly, the

periventricular/central part of the frontal and intermediate nidopallium was implicated

in auditory imprinting (Maier and Scheich, 1983; Wallhaüsser and Scheich, 1987; Bock

et al., 1996). This is consistent with the idea of a functional role of rostral and

intermediate parts of this region, together with the caudal part including AuL, that is,

the entire deep ventral pallium, in songbird song storage.

In the amygdaloid region (analyzed by us by reference to the subdivision schema

of Puelles et al., 2007, leaving apart other interpretive possibilities mentioned above)

there is a general intense Enc1 signal, with some exceptions, such as the negative ACo1,

a property useful to distinguish it from the other nuclei of the core group (Puelles et al.,

2007). In our material, Enc1 signal labels differentially the taenial (ATn) and

amygdallohippocampal (AHi) portions of the amygdala, with the latter showing a

particularly intense signal. In the literature, these two nuclei are usually mixed together

under the concept of “nucleus taeniae”. In their discussion of this topic, Puelles et al.

(2007) highlighted differential expression of the transcription factor Tbr1 (their Text

Fig.15A,B) and proposed to restrict the ATn apellative to the element occupying a

periventricular position, in contrast with the AHi nucleus, which lies at the telencephalic

surface and is continuous with the medial pallium division.

Enc1 expression in lateral pallium

Page 31 of 51

John Wiley & Sons


For Peer Review

The lateral pallium derivative (classically termed hyperstriatum ventrale, and

now mesopallium; Reiner et al., 2004), is constituted by dorsal and ventral parts (MD;

MV; Puelles et al., 2007). The Enc1 expression pattern is different in the dorsal and

ventral subdivisions of lateral pallium, and it highlights some internal specializations,

including the lateropallial rostral olfactory cortex, discussed above.

There is rather homogeneous strong expression of Enc1 in the dorsal

mesopallium, with more intense signal in the dorsal mesopallial core nucleus. Puelles et

al. (2007) identified this element as an AChE-positive and calretinin/calbindin-negative

central domain, extending from a deep periventricular stalk to an ovoid enlargement at

superficial levels of the MD. Our data clearly support this morphology, best observed in

horizontal sections, due to the anteroposterior obliquity of this formation (MDCo;

Figs.3F; 6E). The MDCo is sorrounded dorsally and ventrally by a shell domain

(MDSh), which is immunoreactive for calretinin and calbindin (Puelles et al., 2007; see

their Text Figs.10A-D), and is covered superficially by a dispersed mediodorsal

superficial area (MDS) and a corticoid plate (MDcp). Suarez et al., (2006), analysing

calretinin and calbindin distribution in the chicken telencephalon, also observed the

shell specializations within the mesopallium, but they called our dorsal MDSh “laminar

pallial nucleus”; likewise, they identified the MDS as “lateral hyperpallium”. We think

that they assigned both of these elements to the dorsal pallium following Shimizu and

Karten (1990), who also described our MDS formation as belonging to the hyperpallium

(dorsal pallium). In our material, however, the referred three structures (MDCo, MDSh,

MDS) clearly are located within the lateral pallium and outside of the hyperpallial

domain. The corticoid region of the dorsal mesopallium, also best observed in

horizontal sections, displays an intense Enc1 expression (e.g., Figs.3D,E; 7). This

pattern agrees with the postulated notion of a particular function of the Enc1 protein in

Page 32 of 51

John Wiley & Sons


For Peer Review

the establishment of corticoid patterns; this may relate essentially to its role in radial

glial-guided migration (Hernández et al., 1997).

Expression of Enc1 in the ventral mesopallial subdomain is generally less

marked than in MD; positive cell clusters are observed in the central or intermediate

stratum (MVCe), with higher Enc1 signal appearing n the mesopallial island field

(MIF), analogously to the situation in the ventral pallium. The core nucleus of the MV

and its shell were described before (Striedter, 1994; Durand et al., 1997; Jarvis et al.,

1998, 2000; Redies et al., 2001; MVCo and MVSh of Puelles et al., 2007). The MVCo

is conspicuous in our material as an Enc1-negative domain surrounded by the

moderately positive shell domain (e.g., Fig. 4C). The MVCo is covered superficially by

correlative superficial and corticoid areas (MVS, MVcp; Puelles et al., 2007), whose

Enc1 expression pattern is undistinctive from the mentioned shell domain.

The caudodorsolateral area

Puelles et al., (2007) recently redefined the region called caudodorsolateral area

(CDL), previously distinguished chemoarchitectonically in a superficial position caudal

to the hyperpallium, notably by the analysis of cadherins (Redies et al., 2001). The main

novel aspect introduced was the identification of intermediate and periventricular areas

associated radially to the superficial component of the CDL. This increases the

morphologic significance of the CDL domain, which was tentatively interpreted as a

third complete radial histogenetic subunit within the mesopallium, intercalated between

the hyperpallium, the MD and MV, and the nidopallium (Puelles et al., 2007). On the

basis of additional genoarchitectonic evidence (Puelles, unpublished observations) we

now tend to regard the expanded CDL as an autochtonous part of the pallium,

Page 33 of 51

John Wiley & Sons


For Peer Review

independent from the other parts. Earlier, Veenman et al., (1995) proposed the term

“pallium externum” for a superficial latero/ventral pallial region roughly coinciding

with our CDL, and described it as a major source of efferents to the striatum; moreover,

this area apparently receives important dopaminergic and cholinergic afferents, and

shows high acetylcholinestarase activity (Metzger et al., 1998; Kröner and Güntürkün,

1999; Riters et al., 1999). On the other hand, Atoji and Wild, (2005) observed that a

similar CDL area (called by these authors “temporo-parieto-occipital area”) projects to

the caudolateral parahippocampal subdivision, and is also connected with associative

regions of the ventral pallium. It is not clear that any of these areas corresponds exactly

to the present CDL. Our Enc1 marker shows widespread expression in the CDL, with

more intense signal appearing in its spherical core nucleus (CDLCo; Puelles et al.,

2007). The latter, previously observed by Brauth et al. (1986; negative for neurotensin

binding activity) and Faber et al. (1989; positive for zinc reaction) is located rostrally,

just behind the plane where the dorsal pallium begins to retract from the telencephalic

surface in cross-sections.

Delimitation of dorsopallial radial domains by expression of Enc1

We nowadays identify four radial domains within the classic Wulst, recently

called hyperpallium (Reiner et al., 2004; Puelles et al., 2007): apical hyperpallium

(HA), intercalated area of the HA (IHA), intermediate (intercalated) hyperpallium (HI)

and dorsal or densocellular hyperpallium (HD); these are held to be the derivatives of

the dorsal pallium (Karten et al., 1973; Shimizu and Karten,1990; Puelles et al., 2000;

Medina and Reiner, 2000; Redies et al., 2001; Reiner et al., 2004; Puelles et al., 2007).

In general, Enc1 was found strongly expressed throughout the hyperpallium, with more

intense reaction at the IHA and HD subdomains (e.g., Fig.6F). The HA projects to the

Page 34 of 51

John Wiley & Sons


For Peer Review

striatum and to various parts of the pallium, but also to the thalamus, midbrain tectum

and brainstem (Karten et al., 1973; Reiner and Karten, 1983; Wild, 1992; Shimizu et al.,

1995; Veenman et al., 1995; Kröner and Güntürkün, 1999; Wild and Williams, 1999,

2000); it can be divided into medial and lateral portions (HAM, HAL; Puelles et al.,

2007; Puelles, unpublished observations), but the Enc1 signal is identical in both of

them. The thin, intensely-expressing IHA sector receives visual and somatosensory

inputs from the thalamus, and projects, like the HI, to the striatum and the lateral and

ventral pallial domains (Karten et al., 1973; Bagnoli et al., 1982; Watanabe et la., 1983;

Shimizu et al., 1995) .

The boundary between the lateral pallium and the dorsal pallium was classically

accepted to correspond to the vallecula, a shallow longitudinal sulcus at the brain

surface, which possibly is comparable to the rhinal sulcus of mammals (Medina and

Reiner, 2000). However, in recent times, several authors apparently have developed

differing concepts of this boundary, using diverse criteria. The literature sometimes

identifies superficial HD, the lateralmost hyperpallial subdomain, as lying either ventral

or dorsal to the vallecula (major experts such as Reiner et al., 2004 seem to oscillate

between these interpretations in different Figures; compare their Figs.6D and 7B, C).

We think that HD probably was misidentified when described subpially ventral to the

vallecula, since this area corresponds to the dorsal part of the lateral pallium (MDcp), as

assessed by present data (see also, for review, Puelles et al., 2007). As its new name

“hyperpallium densocellulare” implies, the current main criterium for identifying HD is

the higher cell density of this pallial domain. However, at various anteroposterior

sectioning levels there exist other relatively cell-dense formations both ventral and

dorsal to the vallecula and the HD, which clearly have caused considerable confusion

over time. Moreover, Puelles et al. (2007) demonstrated the frequent existence of two

Page 35 of 51

John Wiley & Sons


For Peer Review

neighboring vallecula-like superficial furrows where only one is expected, which

possibly added to the confusion. All this suggests that the “densocellular” criterium is

not sufficient by itself and should be complemented with convenient chemo- or

genoarchitectonic markers. We here defined the HD thanks to its strong Enc1

expression (its dense cellularity no doubt contributing to this image) at late stages of

development (E18). It forms a lateral band of the dorsal pallium that curves from the

ventricle up towards the pial surface, reaching it just above the medial vallecula (vam;

Figs. 6E, F). Characteristically, there exists a compact corticoid structure restricted to

the surface of HD –i.e., it is absent in HI and is distinct from the MDcp (Fig.6E)- which

expresses intensely Enc1, corroborating once more the association of Enc1 during

development to corticoid structures (Hernández et al., 1997).

Enc1 expression in the medial pallium

The medial pallium consists basically of the hippocampus and the

parahippocampal cortex. Our data fully corroborate the subdivisions identified by the

use of cadherins as regional markers in previous work (Redies et al., 2001; Kovajanic et

al., 2003). We also detected expression of Enc1 at the primordium of dentate gyrus

postulated by Puelles et al. (2007). The tentative entorhinal cortex identified by the later

authors in the atlas, which seems to receive calretinin-immunoreactive olfactory

terminals, showed in our preparations a different Enc1 pattern than either the

caudolateral parahippocampal area or the piriform olfactory cortex found nearby. The

apical parahipocampal subdivision proposed recently in Puelles et al. (2007) is also

evident in our expression study.

Enc1 expression in the subpallium

Page 36 of 51

John Wiley & Sons


For Peer Review

In our description of findings in the subpallial region, we followed the radial

subdomains recently defined in Puelles et al. (2007). We observed Enc1 expression in

areas that were poorly described previously, such as the striatal transition zone adjacent

to the pallidum, identified in the atlas as striatopallidal area (StPal), and the transition

zones under the lateral ventricle that connect the subpallial septum with the striatal and

pallidal domains in the lateral wall (Acb, StPalAcb, SePal), or the striato-amygdaloid

transitional region. The StPal domain typically has a stronger signal than the overlying

MSt/LSt; StPal includes the conspicuous intrapeduncular nucleus. The striatal capsule

(Puelles et al., 2007), a thin discontinuous covering of the striatum at the

palliosubpallial boundary, was also distinct in our material, showing an intense signal,

particularly rostrally (StC; Figs.3A-D). Finally, additional subpallial regions including

the extended subpalial amygdala and the lateral and medial bed nuclei of the stria

terminalis appeared with a high Enc1 signal in our preparations. The observed subpallial

pattern thus essentially corroborates the structural analysis presented with the Puelles et

al. (2007) atlas.

Other acknowledgments

We thank M.C.Hernandez for the Enc1 plasmid and J.L.Ferran for the sequentiation of

the clone.

Page 37 of 51

John Wiley & Sons


For Peer Review

Literature cited

Atoji Y, Wild JM. 2005. Afferent and efferent connections of the dorsolateral corticoid

area and a comparison with connections of the temporoparieto- occipital area in the

pigeon (Columba livia). J Comp Neurol 485:165-182.

Bagnoli P, Francesconi W, Magni F.Visual wulst-optic tectum relationships in birds: a

comparison with the mammalian corticotectal system. 1982. Arch Ital Biol 120:212-

235.

Bar I, Lambert de Rouvroit C, Goffinet A M. 2000. The evolution of cortical

development. An hypothesis based on the role of the Reelin signalling pathway. Trends

Neurosci 23: 633-638.

Bolhuis JJ, Gahr M. 2006. Neural mechanisms of birdsong memory. Nat Rev Neurosci.

7:347-357.

Bock J, Wolf A, Braun K.1996. Influence of the N-methyl-Daspartate receptor

antagonist DL-2-amino-5-phosphono valeric acid on auditory filial imprinting.

Neurobiol Learning Memory 65:177-188.

Brauth SE, Kitt CA, Reiner A, Quirion R. 1986. Neurotensin binding sites in the

forebrain and midbrain of the pigeon. J Comp Neurol 253:358-373.

Dubbeldam J L. 1998. Birds. In: Nieuwenhuys R, ten Donkelaar HJ, Nicholson C,

editors. The Central Nervous System of Vertebrates. Berlin: Springer. pp 1525-1636.

Durand SE, Heaton JT, Amateau SK, Brauth SE. 1997. Vocal control pathways through

the anterior forebrain of a parrot (Melopsittacus undulatus). J Comp Neurol 377:179-

206.

Faber H, Braun K, Zuschratter W, Scheich H. 1989. System-specific distribution of zinc

in the chick brain. A light- and electron-microscopic study using the Timm method. Cell

Tissue Res 258:247-257.

Page 38 of 51

John Wiley & Sons


For Peer Review

Garcia-Calero E. 2005. Contribuciones a la regionalización telencefálica. Doct.dissert.

Univ.Murcia.

García-Calero E, Puelles L. 2005. Pallial expression of Enc1 RNA in postnatal mouse

telencephalon. Brain Res Bull 66:445-448.

Goffinet AM, Bar I, Bernier B, Trujillo, Raynaud A, Meyer G. 1999. Reelin

expression during embryonic brain development in lacertilian lizards. J Comp Neurol.

414:533-550.

Hernandez MC, Andres-Barquin PJ, Martínez S, Bulfone A, Rubenstein JLR, Israel M

A.1997. ENC-1: A novel mammalian kelch-related gene specifically expressed in the

nervous system encodes an acting-binding protein. J Neurosc 17:3038-3051.

Heyers D, Kovjanic D, Redies C.2003. Cadherin expression coincides with birth dating

patterns in patchy compartemts of the developing chicken telencephalon. J Comp

Neurol 460:155-166.

Holmgren P. 1925. Points of view concerning forebrain morphology in higher

vertebrates. Acta Zool 6:413-477.

Horn G. 1998. Visual imprinting and the neural mechanisms of recognition memory.

Trends Neurosci. 21:300-305.

Jarvis ED, Scharff C, Grossman MR, Ramos JA, Nottebohm F. 1998. For whom the

bird sings: context-dependent gene expression. Neuron 21: 775-788.

Jarvis ED, Ribeiro S, da Silva ML, Ventura D, Vielliard J, Mello CV. 2000.

Behaviourally driven gene expression reveals song nuclei in hummingbird brain. Nature

406:628-632.

Karten HJ. 1968. The ascending auditory pathway in the pigeon (Columba livia). II.

Telencephalic projections of the nucleus ovoidalis thalami. Brain Res 11:134-153.

Page 39 of 51

John Wiley & Sons


For Peer Review

Karten HJ. 1969. The organization of the avian telencephalon and some speculations on

the phylogeny of the amniote telencephalon. In: Noback C, Petras J, editors.

Comparative and evolutionary aspects of the vertebrate central nervous system. Ann N

Y Acad Sci 167:146-179.

Karten HJ, Hodos W.1967. A stereotaxic atlas of the brain of the pigeon, Columba livia.

Baltimore: The Johns Hopkins University Press.

Karten HJ, Hodos W. 1970. Telencephalic projections of the nucleus rotundus in the

pigeon (Columba livia). J Comp Neurol 140:35-51.

Karten HJ, Revzin AM. 1966. Rostral projections of the optic tectum and nucleus

rotundus in the pigeon. Brain Res 3:264-276.

Karten HJ, Hodos W, Nauta WJ, Revzin AM. 1973.Neural connections of the "visual

wulst" of the avian telencephalon..Experimental studies in the piegon (Columba livia)

and owl (Speotyto cunicularia). J Comp Neurol 150:253-78.

Kovjanic D, Redies C.2003. Small-scale pattern formation in a cortical area of the

embryonic chicken telencephalon. J Comp Neurol 456:95-104.

Kröner S, Güntürkün O. 1999. Afferent and efferent connections of the caudolateral

neostriatum in the pigeon (Columba livia): a retro- and anterograde pathway tracing

study. J Comp Neurol 407:228-260.

Kuenzel WL, Masson M. 1988. A Stereotaxic Atlas of the Brain of the Chick (Gallus

domesticus). Baltimore: Johns Hopkins University Press.

Kuhlenbeck H.1938. The ontogenetic development and phylogenetic significance of the

cortex telencephali in the chick. J Comp Neurol 69:273-301.

Kuhlenbeck H.1977. The Central Nervous System of Vertebrates, Derivatives of

the Prosencephalon: .Diencephalon and Telencephalon Vol. 5, Karger.

Page 40 of 51

John Wiley & Sons


For Peer Review

Maier V, H Scheich. 1983. Acoustic imprinting leads to differential 2-deoxy-D-glucose

uptake in the chick forebrain. Proc Natl Acad Sci U.S.A. 80:3860-3864.

Medina L, Legaz I, González G, De Castro F, Rubenstein JL, Puelles L. 2004.

Expression of Dbx1, Neurogenin 2, Semaphorin 5A, Cadherin 8, and Emx1 distinguish

ventral and lateral pallial histogenetic divisions in the developing mouse

claustroamygdaloid complex. J Comp Neurol 474:504-523.

Medina L, Reiner A. 2000. Do birds possess homologues of mammalian primary

visual, somatosensory and motor cortices? .Trends Neurosci 23:1-12.

Metzger M, Jiang S, Braun K. 1998. Organization of the dorsocaudal neostriatal

complex: a retrograde and anterograde tracing study in the domestic chick with special

emphasis on pathways relevant to imprinting. J Comp Neurol 395:380-404.

Puelles L. 2001. Thoughts on the development, structure and evolution of the

mammalian and avian telencephalic pallium. Phil Trans R Soc Lond 356 : 1583-1598.

Puelles L, Kuwana E, Puelles E, Bulfone A, Shimamura K, Keleher J, Smiga

S, Rubenstein, JRL.2000. Pallial and subpallial derivatives in the embryonic chick and

mouse telencephalon, traced by the experession of the genes Dlx-2, Emx-1, Nkx-2.1,

Pax-6, and Tbr-1. J Comp Neurol 424: 409- 438.

Puelles L, Martinez S, Martinez-De-La-Torre M, Rubenstein JLR. 2004. Gene maps

and related histogenetic domains in the forebrain and midbrain, in: Paxinos, G. (Ed.),

The Rat Nervous System, 3rd Edit., Elsevier, San Diego, pp.3-25.

Puelles L, Martinez-de-la-Torre M, Paxinos G, Martinez S. (Eds.), 2007. The chick

brain in stereotaxic coodinates. An atlas featuring Neuromeric Subdivisions and

Mammalian Homologies. Academic Press, San Diego.

Redies C, Medina L, Puelles L. 2001. Cadherin expression by embryonic divisions

Page 41 of 51

John Wiley & Sons


For Peer Review

and derived gray matter structures in the telencephalon of the chicken. J Comp Neurol

438:253-285.

Reiner A, Karten, HJ. 1983. The laminar source of efferent projections from the avian

Wulst. Brain Res 275: 349-354

Reiner A, Karten HJ.1985. Comparison of olfactory bulb projections in pigeons

and turtles. Brain Behav Evol 27:11-27.

Reiner A, Perkel DJ, Bruce LL, Butler AB, Csillag A, Kuenzel W, Medina L, Paxinos

G, Shimizu T, Striedter G, Wild M, Ball GF, Durand S, Gunturkun O, Lee DW, Mello

CV, Powers A, White SA, Hough G, Kubikova L, Smulders TV, Wada K, Dugas-Ford

J, Husband S, Yamamoto K, Yu J, Siang C, Jarvis ED. 2004. Revised nomenclature

for avian telencephalon and some related brainstem nuclei. J Comp Neurol 473:377-

414.

Reiner A, Yamamoto K, Karten HJ. 2005. Organization and evolution of the avian

forebrain. Anat Rec 287:1080-1102.

Riters LV, Erichsen JT, Krebs JR, Bingman VP. 1999. Neurochemical evidence for at

least two regional subdivisions within the homing pigeon (Columba livia) caudolateral

neostriatum. J Comp Neurol 412: 469-487.

Shimamura K, Hirano S, McMahon AP, Takeichi M. 1994.Wnt-1-dependent regulation

of local E-cadherin and alpha N-catenin expression in the embryonic mouse brain.

Development 120:2225-2234.

Shimizu T, Cox K, Karten HJ. 1995. Intratelencephalic projections of the visual wulst in

pigeons (Columba livia). J Comp Neurol 359:551-572.

Shimizu T, Karten H.J. 1990. Immunohistochemical analysis of the visual Wulst of the

pigeon (Columba livia). J Comp Neurol 300:346-369

Page 42 of 51

John Wiley & Sons


For Peer Review

Striedter GF. 1994. The vocal control pathways in budgerigars differ from those in

songbirds. J Comp Neurol 343:35-56.

Striedter GF, Keefer BP.2000. Cell migration and aggregation in the developing

telencephalon: pulse-labeling chick embryos with bromodeoxyuridine. J Neurosci 20:

8021-8030.

Suárez J, Dávila JC, Real MA, Guirado S, Medina L. 2006. Calcium-binding proteins,

neuronal nitric oxide synthase, and GABA help to distinguish different pallial areas in

the developing and adult chicken. I. Hippocampal formation and hyperpallium. J Comp

Neurol 497:751-771.

Tissir F, Goffinet AM. 2003.Reelin and brain development. Nat Rev Neurosci 4: 496-

505.

Varkey JP, Muhlrad PJ, Minniti AN, Do B, Ward S.1995. The Caenorhabditis elegans

spe-26 gene is necessary to form spermatids and encodes a protein similar to the actin-

associated proteins kelch and scruin. Genes Dev. 9: 1074-1086.

Veenman CL, Wild JM, Reiner A. 1995. Organization of the avian “corticostriatal”

projection system: a retrograde and anterograde pathway tracing study in pigeons. J

Comp Neurol 354:87-126.

Wallenberg A. 1904. Neue Untersuchungen über den Hirnstamm der Taube. Anat Anz

28:357-369.

Wallhaüsser E, Scheich H. 1987. Auditory imprinting leads to differential 2-

deoxyglucose uptake and dendritic spine loss in the chick rostral forebrain. Dev Brain

Res 31:29-44.

Watanabe M, Ito H, Masai H. 1983. Cytoarchitecture and visual receptive neurons in

the Wulst of the Japanese quail (Coturnix coturnix japonica). J Comp Neurol 213:188-

198.

Page 43 of 51

John Wiley & Sons


For Peer Review

Way M, Sanders M, Garcia C, Sakai J, Matsudaira P.1995. Sequence and domain

organization of scruin, an actin-cross-linking protein in the acrosomal process of

Limulus sperm. J Cell Biol 128:51-60.

Wild JM. 1987. The avian somatosensory system: connections of regions of body

representation in the forebrain of the pigeon. Brain Res 412:205-223.

Wild JM. 1992. Direct and indirect “cortico”-rubral and rubro-cerebellar

cortical projections in the pigeon. J Comp Neurol 326:623-636.

Wild JM, Arends JJ, Zeigler HP. 1985. Telencephalic connections of the trigeminal

system in the pigeon (Columba livia): a trigeminal sensorimotor circuit. J Comp Neurol

234:441-464.

Wild JM, Karten HJ, Frost BJ. 1993. Connections of the auditory forebrain

in the pigeon (Columba livia). J Comp Neurol 337:32-62.

Wild JM, Williams MN. 1999. Rostral wulst of passerine birds: II. Intratelencephalic

projections to nuclei associated with the auditory and song systems. J Comp Neurol

413:520-534.

Wild JM, Williams MN. 2000. Rostral wulst in passerine birds. I. Origin,

course, and terminations of an avian pyramidal tract. J Comp Neurol

416:429-450.

Witkovsky P, Zeigler HP, Silver R. 1973. The nucleus basalis of the pigeon:

a single-unit analysis. J Comp Neurol 147:119-128.

Xue F, Cooley L.1993. Kelch encodes a component of intercellular bridges in

Drosophila egg chambers. Cell 72: 681-693.

Page 44 of 51

John Wiley & Sons


For Peer Review

Figure legends

Figure 1. (A-D) Rostral coronal sections through the E12 chick telencephalon, going

from rostral to caudal, hybridized for Enc1. The limits between VPall/LPall,

LPall/DPall and DPall/MPall are indicated with white dash lines in B. (E) Detail of the

olfactory bulb hybridized for Enc1 in an E18 embryo. Bar = 0,5mm

Page 45 of 51

John Wiley & Sons


For Peer Review

Figure 2. (A-D) Continuing series through intermediate and caudal coronal sections

through the same chick telencephalon at E12 shown in Fig.1, hybridized for Enc1. The

limits between Sp/VPall, VPall/LPall, LPall/DPall, CDL/DPall/LPall and DPall/MPall

are shown by white dash lines in B. Bar =0,5mm

Figure 3. (A-G) Series of horizontal sections through the chick telencephalon at E12,

going from ventral (near the olfactory bulb) to dorsal, hybridized for Enc1. All the

pannels illustrate exclusively the right half of the telencephalon. The limits between

Sp/VPall, VPall/LPall, LPall/DPall and DPall/MPall are indicated with white dash lines

in E. Bar = 0,5mm

Figure 4. (A-E) Coronal sections through the rostral half of the chick telencephalon at

E18, ordered from rostral to caudal, hybridized for Enc1. (B) Detail of Enc1 expression

in the lateropallial corticoid plate in MD. The limits between Sp/VPall, VPall/LPall,

LPall/DPall, CDL/DPall/LPall and DPall/MPall are shown with white dash lines in E.

Bar = 0,5mm

Figure 5 (A-B) Coronal section through the caudal half of the chick telencephalon at

E18, hybridized for Enc1. The limits between Sp/VPall, VPall/LPall, CDL/MPall/LPall

are shown with white dash lines in B. Bar = 0,5mm

Figure 6 (A-F) Series of horizontal sections through the chick telencephalon at E18,

ordered from ventral to dorsal, hybridized for Enc1. The limits between Sp/VPall,

VPall/LPall, LPall /DPall, DPall/MPall are shown with black dash lines in D. (A-C, E)

Bar =0,5mm; (D, F) Bar =1mm

Page 46 of 51

John Wiley & Sons


For Peer Review

Figure 7 Lateral graphic reconstruction of pallial domains and specific superficial

neuronal formations, as delimited by Enc1 differential labelling.

Table of Abbreviations Used in the Figures

AA anterior amygdaloid area

ac anterior commissure

Acb accumbens nucleus

Page 47 of 51

John Wiley & Sons


For Peer Review

StPalAcb accumbens nucleus, striopallidal part

ACo amygdala, core nucleusACo1 amygdala, core nucleus, part 1

ACo2 amygdala, core nucleus, part 2



ADo amygdala, dorsal regionAHi amygdalohippocampal area

AHil amygdala, hilar region

AHilCo amygdala, hilar core nucleus

AIPo amygdala, intermedioposterior nucleus

Amyg amygdale

AOD anterior olfactory area, dorsal partAOV anterior olfactory area, ventral part

APir amygdalopiriform transition area

ATn amygdaloid taenial nucleus

AuL auditory area of nidopallium

AuL1 auditory area of nidopallium, shell L1 field

B basal nucleus (Meynert)

BSh basal somatosensory nucleus of the nidopallium, shell region

BSS basal somatosensory nucleus of the nidopallium

Bst bed nucleus of stria terminalis

BstL bed nucleus of stria terminalis, lateral part

BstM bed nucleus of stria terminalis, medial part

CDL caudodorsolateral pallium

CDLCo caudodorsolateral pallium, core nucleus

CDLcp caudodorsolateral pallium, corticoid plateCLCo caudolateral core nucleus of the

nidopalliumcsm corticoseptomesencephalic tract

Page 48 of 51

John Wiley & Sons


For Peer Review

(septopalliomesencephalic tract)

DGP dentate gyrus primordium

DPall dorsal pallium

EA extended amygdala

Ent entorhinal cortex

fi fimbria of the hippocampus

GrO granule cell layer of the olfactory bulb

HA apical hyperpallium

HD densocellular hyperpallium

HDcp densocellular hyperpallium, corticoid plate HDB nucleus of the horizonal limb of

the diagonal band

HI intmediate hyperpallium

Hi hippocampus

IHA intercalated hyperpallium area

InP intrapeduncular nucleus (central part of striatopallidal area)

lfb lateral forebrain bundle

LPall lateral pallium

LPA lateral preoptic area

MD mesopallium, dorsal part

MDCe mesopallium, dorsal part, central region

MDCo mesopalliaum, dorsal part, core nucleus

MDcp mesopallium, dorsal part, corticoid plate region

MDSh mesopallium, dorsal part, shell nucleus

MIF mesopallial island field

MPA medial preoptic area

Page 49 of 51

John Wiley & Sons


For Peer Review

MPall medial pallium

MS medial septal nucleus

MSt medial striatum

MV mesopallium, ventral part

MVCe mesopallium, ventral part, central region

MVCo mesopallium, ventral part, core nucleus

MVS mesopallium, ventral part, superficial region

NCCe nidopallium, caudal part, central region

NCcp nidopallium, caudal part, corticoid plate

NCIF nidopallium, caudal part, island field

NCS nidopallium, caudal part, superficial region

NFCe nidopallium, frontal part, central region

NICe nidopallium, intermediate part, central region

NIcp nidopallium, intermediate part, corticoid plate

NID nidopallium, intermediate part, dorsal field

NIF nidopallial island field

NIS nidopallium, intermediate part, superficial region

NIPe nidopallium, intermediate part, periventricular

OB olfactory bulb

Pal pallidum

PalE ectopic (intrastriatal) part of pallidum (globus

pallidus)

PalSe pallidoseptal transition area

PalV ventral part of pallidum (ventral pallidum)

PHiA parahippocampal area, apical part

Page 50 of 51

John Wiley & Sons


For Peer Review

PHiCL parahippocampal area, caudolateral part

PHiI parahippocampal area, intermediate part

PHiL parahippocampal area, lateral part

PHiM parahippocampal area, medial part

Pir piriform cortex

PPir prepiriform cortex

PThE prethalamic eminence

SHi septohippocampal nucleus

SPall subpallium

StAm strioamygdaloid transition area

StC striatal capsule

StPal striopallidal area

Tu olfactory tubercle,

vaf ventral amygdalofugal

val lateral vallecula

vam medial vallecula

VDB nucleus of the vertical limb of the diagonal band

VisCo visual nidopallial nucleus, core region

VisSh visual nidopallial nucleus, shell region

VPall ventral pallium

Page 51 of 51

John Wiley & Sons


Enc1 expression in the chick telencephalon at intermediate and late stages of development

Documents

Transcript of Enc1 expression in the chick telencephalon at intermediate and late stages of development