RESEARCH ARTICLE

Defense Transcriptome Analysis of Sugarcaneand Colletotrichum falcatum Interaction UsingHost Suspension Cells and Pathogen Elicitor

P. R. Rahul • V. Ganesh Kumar • R. Viswanathan • A. Ramesh Sundar •

P. Malathi • C. Naveen Prasanth • P. T. Pratima

Received: 7 August 2014 / Accepted: 5 November 2014

� Society for Sugar Research & Promotion 2014

Abstract Red rot, a stalk disease in sugarcane caused by

Colletotrichum falcatum an ascomycete fungus is a serious

production constraint in many Asian countries. However,

very limited studies at molecular level exist of the mech-

anisms related to interaction between sugarcane and the

fungal pathogen C. falcatum (Cf). In the conventional

system of pathogen inoculation, disease development is

influenced by prevailing environmental conditions in the

field. Hence an attempt was made to standardize an in vitro

system of using sugarcane suspension cells and crude

elicitor of Cf for transcriptome analysis and identifying

defense related genes. Suspension cells of sugarcane cv Co

93009 was treated with Cf-elicitor at 60 glucose equiva-

lents and transcriptome profile was monitored 30 min and

3 h later by differential display RT-PCR. From the

experiment 241 transcripts were found to be differentially

expressed and finally 75 of them were cloned and

sequenced. Among the up-regulated transcripts, about

37 % were found to be defense related and which was

followed by transcription and post transcription (13 %),

general metabolism (11 %), transport (9 %), cell structure/

growth/division (9 %) and signal transduction (5 %). The

down regulated transcript group constituted *27 % of the

differentially expressed transcripts and the grouping pat-

tern was different. Overall, the results revealed up regula-

tion of many potential defense related transcripts like

putative chitinase, glycine rich protein, 14-3-3-like protein,

xylanase inhibitor protein, calmodulin related protein,

Myb-related transcription factor CBM2-like, basal layer

antifungal peptide etc. Further by adopting RACE-PCR

approach, complete gene sequences of 14-3-3-like protein

and xylanase inhibitor were identified and the genes were

characterized to domain level. Our results demonstrate that

the transcript profile in in vitro system of sugarcane sus-

pension cells and Cf-elicitor is close to the cane tissue

challenged with the pathogen and useful to identify defense

related traits in sugarcane against Cf.

Keywords Differential display RT-PCR �Colletotrichum falcatum � Elicitor �Molecular interactions � Transcriptome analysis

Introduction

Sugarcane is a major commercial crop cultivated in more

than 20 million hectares in tropical and subtropical regions

of the world, producing up to 1.3 billion metric tons of

crushable stalks and accounts for nearly 60 % of the total

sugar produced in the world (www.faostat.org). Stalks are

the economically important part in sugarcane and on

mature internodes sucrose can accumulate up to 15 %

concentration. Sugarcane cultivation contributes substan-

tially to the agricultural GDP in India, as every year *300

million tonnes of cane are produced in the country, which

in turn are used by more than 500 sugar mills and thou-

sands of jaggery/khandsari units in different states (Nair

2008). In addition, the by-products molasses and bagasse,

serve as the raw material for ethanol production and power,

respectively. The potential ethanol production has been

realised from sugarcane, with Brazil at the forefront in

utilizing it as a bio-fuel (http://sugarcane.org). This calls

P. R. Rahul � V. Ganesh Kumar � R. Viswanathan (&) �A. Ramesh Sundar � P. Malathi � C. Naveen Prasanth �P. T. Pratima

Division of Crop Protection, Sugarcane Breeding Institute,

Indian Council of Agricultural Research, 641007 Coimbatore,

India

e-mail: rasaviswanathan@yahoo.co.in

123

Sugar Tech

DOI 10.1007/s12355-014-0356-8

for different approaches to supplement the present efforts

of increasing the yield using good agricultural practices as

well as developing new means of managing different biotic

and abiotic stress conditions.

Among the various diseases, red rot caused by Collet-

otrichum falcatum Went (Teleomorph: Glomerella tucu-

manensis [Speg.] Arx and Muller) has been implicated as a

cause for a nation-wide loss of 5–10 % in cane yield,

making it the most serious threat among the biotic stresses

in India and other south Asian countries. However, much

higher yield losses of up to 100 % from India has been

reported when the disease occurred in epidemic form

during different decades and many popular varieties like

Co 419, Co 997, Co 1148, Co 6304, CoC 671, CoC 85061,

CoC 92061, and CoJ 64 etc. were removed from cultivation

(Viswanathan 2010; Viswanathan and Samiyappan 1999).

Since red rot has been a serious constraint to sugarcane

cultivation, incorporating red rot resistance in sugarcane

has become an integrated part of the varietal development

programme. However, due to genetic complexities of

sugarcane genome, inheritance of red rot resistance was not

established. Earlier through pathogenesis-related (PR)

proteins and 3-deoxyanthocyanidin phytoalexins, bio-

chemical basis of red rot resistance has been established

(Malathi et al. 2008; Viswanathan et al. 1996, 2003, 2005).

However, only limited information on the molecular

aspects i.e. on the expression of various resistance/defense

genes during the sugarcane—C. falcatum interaction is

available. The large genome size of sugarcane implies that

genome sequencing is currently not viable and this has led

many researchers to work on expressed sequence tags

(ESTs).

Currently, a large number of sugarcane EST sequences

are available in public databases; however these databases

are lacking information on C. falcatum induced transcripts.

In our previous studies, transcript level changes in sugar-

cane stalk tissues were assessed after C. falcatum inocu-

lation. In these assays matured canes were challenged with

the pathogen under field conditions (Prathima et al. 2013;

Viswanathan 2010). Usually such inoculation is done

during monsoon season for conducive environment for

disease development and better phenotypic expression of

genotypes to the pathogen. The system depends on patho-

gen inoculation during specific crop stage and favourable

environment. If the environment is not conducive, pheno-

typic expression becomes skewed hence an alternative

system to study host-pathogen interaction for sugarcane-

C. falcatum was necessitated. At the cellular level, the

response of the host plant against a pathogen infection

requires complex changes in gene expression patterns. The

timing and activation of these defense responses after the

infection is the most important factor for the success of

host resistance. This activation of defense in the plant

system has been replicated in the suspension culture by the

use of elicitor isolated from the pathogen (Menard et al.

2004). In the present study, attempts were made to study

the defense related transcriptomes in an in vitro system of

sugarcane suspension cells and C. falcatum elicitor through

differential display (DD) RT-PCR approach. The study

identified several defense related transcripts and two of

them were characterized to domain level.

Materials and Methods

Plant and fungal material used: the sugarcane cultivar Co

93009, highly resistant to red rot was used for the experi-

ments throughout the study. The plants were raised and

maintained under field conditions as per the recommended

agronomic practices at the Institute in Coimbatore (Sund-

ara 1998). C. falcatum pathotype Cf 671 (isolated from the

cv CoC 671) maintained at the red rot culture collection of

the institute was used for isolation of the crude elicitor for

treatment in cell suspension culture. The pathogen was

multiplied on oatmeal agar (oatmeal 40 g, agar 10 g, water

1 l) for 7 days and conidial suspension (106 conidia ml-1)

prepared in sterile water. For the isolation of elicitor, the

monoconidial culture of the fungus was inoculated on

oatmeal broth and incubated under room temperature

(28 ± 2 �C) for 12 days.

Isolation of Elicitor from C. falcatum

The elicitor was isolated from the mycelial cell wall of the

fungus, following the method of Anderson-Prouty and

Albersheim (1975). The mycelial mats were harvested

from oat meal broth culture by filtering through two layers

of muslin cloth. The harvested mycelial mat was rinsed

with sterile distilled water three times and homogenized to

powder using liquid nitrogen in a pestle and mortar. 5 ml

of water was added per gram wet weight of mycelia to the

powdered mycelial mat and was further ground for a few

minutes. The homogenate was filtered through two layers

of muslin cloth and the residue was homogenized thrice in

water, once in a mixture of chloroform and methanol (1:1)

and finally in acetone. This preparation, when air-dried,

represents the fraction referred to as the mycelial walls.

Elicitors were extracted from the mycelial walls by sus-

pending 1 g of walls in 100 ml of distilled water and

autoclaving for 20 min at 120 �C. The autoclaved sus-

pension was filtered and the filtrate was clarified by cen-

trifugation and then concentrated to 1/10th v/v in a freeze

drier (Labconco, MO, USA). This preparation is termed as

the crude elicitor.

Sugar Tech

123

Establishment of Cell Suspension Culture

Murashige and Skoog (1962) nutrient agar (MS) medium

was used for initial induction of callus from the inner leaf

whorls of sugarcane variety Co 93009. 100 ml coconut water

(liquid endosperm) per one litre of MS medium was added to

the media prior to pH adjustment. The medium was sup-

plemented with 4 mg l-1 concentration of 2, 4-D for initial

callus induction and for subcultures, reduced concentrations

of 2 mg l-1 and 1 mg l-1 were used. pH of the medium was

adjusted to 5.8 ± 0.2 prior to sterilization. The medium was

solidified using agar at 0.8 % (w/v) and sterilized at 121 �C,

15 lbs for 20 min in an autoclave. The liquid MS medium for

suspension culture was prepared similarly without addition

of agar and 2,4-D being replaced with IAA at 1 mg l-1. Inner

leaf whorls of the cv Co 93009 were excised under aseptic

conditions, cut into several small pieces and cultured on MS

agar medium supplemented with 4 mg l-1 concentration of

2,4-D. The rapidly growing embryogenic suspension-cul-

tured cells were established by transferring friable calli

(Fig. 1) to 100 ml conical flasks containing 30 ml MS liquid

medium and agitated on an incubated rotary shaker at 40 rpm

at 25 �C under continuous darkness. The friable embryo-

genic calli were sub-cultured by transferring the callus into a

fresh medium at every 7 days interval and used for the

studies on priming suspension cells with fungal elicitor.

Cf-elicitor Response Study

The elicitor activity of Cf-elicitor was measured in terms of

accumulation of phenolic content in the sugarcane suspen-

sion cells and in leaf bioassays (cv Co 93009) upon treat-

ment using different concentrations of elicitor (30–200 and

20–100 lg of glucose equivalents, respectively). The crude

elicitor was filter sterilized prior to addition to the suspen-

sion culture and later grown in MS liquid medium. After

adding different concentrations of elicitor to respective

100 ml conical flasks containing 30 ml suspension cells

grown in MS liquid medium, the flasks were incubated in a

rotary shaker at 150 rpm at 25 �C under continuous dark-

ness. The suspension cells were harvested 12 h after elicitor

treatment and phenolic content of the cells was estimated

(Zieslin and Ben-Zaken 1993). One gram of harvested cells

were homogenized in 10 ml of 80 % methanol and agitated

for 15 min at 70 �C. 1 ml of the methanolic extract was

added to 5 ml of distilled water and 250 ml of Folin–Cio-

calteau reagent (1 N) and the solution was kept at 25 �C for

3 min. 1 ml of Na2CO3 (saturated solution) and 1 ml of

distilled water were added and the reaction mixture was

incubated for 1 h at 25 �C. The absorption of the developed

blue colour was measured at 650 nm in a UV spectropho-

tometer (T80? , PG Instruments, UK).

Total RNA Extraction

Total RNA was extracted from control, 30 min and 3 h

elicitor treated samples of cv Co 93009 using TRI reagent

(Sigma, USA). 500 mg of sample tissue was ground to a

fine powder using liquid nitrogen, transferred to 30 ml

DEPC treated sterile centrifuge tubes and added 7 ml of

TRI Reagent. It was mixed vigorously by rapid shaking and

it was kept at 4 �C until all the samples were homogenized.

Fig. 1 Schematic representation of development of sugarcane sus-

pension culture a embryogenic callus, the induced calli developed as

embryogenic calli and transferred on to a fresh medium for further

growth and proliferation; b suspension cultured cells, suspension cells

raised from the friable calli in liquid MS medium

Sugar Tech

123

Differential Display

The DD protocols were followed as per manufacturer’s

instructions with certain modifications (RNA image� kit,

GenHunter, USA). The method involved the generation of

three subsets of mRNAs by reverse transcription with

anchor oligo-dT primers followed by PCR with combina-

tions of respective anchor oligo-dT and eight random

primers in presence of a radiolabelled dNTP and subse-

quently displayed the cDNA produced on a polyacrylamide

gel matrix and visualization by autoradiography (Liang and

Pardee 1992; Liang et al. 1995, 2007).

Reverse Transcription of mRNA

Three reverse transcription reactions for each RNA sample

were setup on ice in separate 0.2 ll thin walled PCR tubes.

The anchor oligo-dT was designed with the following

sequence 50-AAGCTTTTTTTTTTTX-30 where a Hind III

restriction site was provided at the 50 end to facilitate the

cloning and X denotes either A/G/C in their respective

anchor primers. Reverse transcription was done in total

volume of 20 ll containing 200 ng of freshly diluted RNA,

125 mM Tris–HCl, pH 8.3, 188 mM KCl, 7.5 mM MgCl2,

25 mM DTT, 250 mM dNTPs and 2 mM of HT11X

(where X may be G, A or C). RNA was initially heated at

65 �C for 5 min to unfold any secondary RNA structures

and then the temperature was brought down to 37 �C,

followed by addition of 1 ll MMLV reverse transcriptase

(100 U/ll) and incubated at 37 �C for 60 min. After the

first strand cDNA synthesis, the reaction mix was incu-

bated at 75 �C for 5 min to destroy the reverse transcrip-

tase activity and finally held at 4 �C.

Polymerase Chain Reaction

The PCR was carried out for three subsets of cDNA sam-

ples using the combination of the respective anchor oligo

dT primer along with an arbitrary primer (from among

eight) (Table 1). In total, for each sample 24 PCR reactions

were performed. These arbitrary primers were designed to

have Hind III restriction sites at the 50 ends and the rest of

sequences were designed for maximising the coverage of

genes that might be expressed at the given point of time.

From the RT reaction, 2 ll of cDNA was added to 1.6 ll

dNTP (25 lM), 2 ll 109 Taq polymerase buffer, 2 ll

anchor oligo dT primer (2 lM), 2 ll H-AP primer (H-AP1-

8) (2 lM), 0.2 ll [33P] dATP (0.2 mCi) (BARC, Mum-

bai), 0.2 ll Taq polymerase enzyme (5 U/ll) (Qiagen,

Germany) in a final volume of 20 ll DEPC treated water.

The PCR cycling condition involved an initial denaturation

for 2 min at 94 �C followed by 40 cycles of denaturation

for 30 s at 94 �C, annealing at 40 �C for 2 min and

extension at 72 �C for 1 min. The final extension was

carried out for 10 min at 72 �C.

PAGE and Re-amplification of Differential Bands

The amplified products from the DD-RT-PCR reactions

were resolved on a 6 % urea polyacrylamide gel (Sam-

brook et al. 1989) cast on a sequencing gel unit (Sequi-Gen

GT Sequencing Cell, Bio-Rad, USA). The bands were

compared between the control and elicitor treated samples

in the autoradiogram. The differentially displayed bands

were cut out from the gel using the autoradiogram as a

template. The x-ray sheet was aligned with the gel using

the incisions made when exposing the film and was

clamped together using paper clips/cellophane tape. Pin

pricks were made on the edges of bands through the x-ray

film on to the gel sheet. The differential bands that were

marked as pin pricks were carefully excised, soaked in

100 ll of sterile water for 10 min, boiled for 15 min and

cooled. Supernatant containing the DNA fragment was

collected after centrifugation and was stored at -20 �C

until re-amplification.

Re-amplification was carried out in a 40 ll reaction

volume containing 0.5 ll of template, 4 ll 109 PCR

buffer, 3.2 ll dNTP (250 lM), 4 ll of respective anchor

and arbitrary primers (2 lM), 0.4 ll of Taq polymerase

(5 U/ll) and the reaction volume was made up to 40 ll

with water. The PCR cycling conditions were the same as

those during differential display. The products were then

electrophoresed on a 1.8 % agarose gel along with a

100 bp DNA ladder. The gel was visualised under UV

trans illuminator and approximate size of the fragments

was determined. The bands were then carefully excised and

used for further processing by elution, cloning and

sequencing.

Rapid Amplification of cDNA Ends

Rapid amplification of 50 cDNA ends (50-RACE) was

carried out to isolate full length gene sequences from the

partial sequences of transcripts specifically induced during

cell suspension-C. falcatum elicitor interaction. The RNA

ligase mediated-RACE (RLM-RACE) technique was per-

formed using GeneRacerTM kit (Invitrogen, USA). The

method involved designing of two gene specific primers

(i.e. GSP1, GSP2) to carry out 50 RACE. FastPCR primer

designing software was used for primer designing with

parameters like 50–70 % GC content, high annealing

temperature ([72 �C), 23–28 nucleotides length, GC con-

tent at 30 ends and no self-complementary sequences within

the primer or to the primers supplied in the kit. The

Sugar Tech

123

protocol for RACE was followed according to the recom-

mendations of GeneRacer kit (Invitrogen, USA). Total

RNA from 12 h treated sample was used for the RACE-

PCR. The procedure had the following steps calf intestinal

phosphatase (CIP) treatment of RNA samples, RNA pre-

cipitation by phenol: chloroform method, in which the final

pellet was suspended in 8 ll of DEPC water and 1 ll was

run on 1.8 % agarose gel to check the quality, removal m-

RNA cap structure from full length mRNA in the sample

by treatment with tobacco acid phosphatase enzyme (TAP)

and RNA precipitation and isolation by phenol chloroform

method, ligation of RNA oligos and reverse transcription of

mRNA by SuperscriptTM III. The following reaction was

set up for this step in a PCR tube: 1 ll of gene specific

primer 1 (GSP1) primer (10 lM), 1 ll of dNTP mix, 1 ll

DEPC water. The tube was incubated at 65 �C for 10 min

followed by snap cooling on ice for 5 min. This was fol-

lowed by addition of following components to the reaction

mixture; 4 ll 59 first strand synthesis buffer, 1 ll of 0.1 M

DTT, 1 ll of RNaseout (40 U/ll) and 1 ll of Super-

ScriptTM III enzyme (200 U). This reaction mix was

incubated at 55 �C for 1 h followed by 15 min incubation

at 70 �C and finally on ice for 10 min. This was followed

by addition of 1 ll of RNase H (2 U) and incubation at

37 �C for 20 min and finally the cDNA was stored at

-20 �C till being used for PCR reactions.

The PCR reaction mixture contained 35.5 ll sterile

milliQ water, 3 ll of GeneRacer 50 primer, 1 ll of gene

specific primer 1 (GSP1), 0.5 ll of cDNA template, 5 ll

of 109 XT-PCR buffer, 4 ll dNTP (2.5 mM each) and

1 ll (3 U/ll) of XT-5 Taq DNA polymerase enzyme

(Merck, India). The reaction condition followed was

94 �C for 2 min for 1 cycle followed by 94 �C 30 s,

72 �C for 2 min for 5 cycles followed by 94 �C 30 s,

70 �C for 2 min for 5 cycles followed by 94 �C 30 s,

65 �C for 30 s, 72 �C for 2 min for 20 cycles followed by

final extension at 72 �C for 15 min. Nested PCR was

carried out in the same manner replacing GSP1 with

GSP2 in the above reaction using different dilutions of

first round PCR products as template. The gene products

were run on 1.5 % agarose gel and the visualized pro-

ducts were cloned and sequenced.

Results

Establishment of Cell Suspension Culture

The callus was initiated from the inner leaf whorls of the

sugarcane cv Co 93009. After two weeks of callus initia-

tion, the calli were separated from leaf whorl and sub-

cultured on a fresh MS medium. The friable calli were

formed and were transferred to fresh medium for further

growth and proliferation. A suspension cells were raised

from the friable calli in liquid MS medium (Fig. 1).

Cf-elicitor Purification and Dose Response

Glucose equivalents and protein content in the C. falcatum

crude elicitor purified from the fungal mycelial wall were

estimated to be 3.7 and 1.2 lg/ll, respectively. The activity

of the crude elicitor was measured in terms of accumula-

tion of phenolics in the sugarcane suspension cells (cv Co

93009). It was found that 60 lg of glucose equivalents

induced maximum activity in terms of phenol accumula-

tion and it was reduced at elicitor concentrations of more

than 80 lg of glucose equivalents. Similarly elicitor

activity of Cf-elicitor was confirmed on sugarcane leaves

(cv Co 93009) and the study also indicated that 60 lg of

glucose equivalent to maximum activity at level of elicitor

(Fig. 2). Based on these assays, 60 lg of glucose equiva-

lents per 30 ml suspension culture was used in the further

studies for the induction of defense response.

Downstream Processing of Differentially Expressed

Transcripts

About 241 transcripts were found to be differentially

expressed in DD images and from the DD-RT-PCR gel,

about 75 fragments were re-isolated followed by re-

amplification from the gel matrix using the same primer

pairs as in the DD-RT-PCR. These differential transcripts

were reamplified, cloned into pTZ57R/T plasmid vector

and sequenced (Genbank Acc.no. HO 209116-209182)

(Fig. 3, 4). Transcripts of less than 100 bp were not

processed.

Table 1 Sequences of arbitrary

primers used in differential

display

List of arbitrary primers Forward Reverse

H-AP 1 & 2 50-AAGCTTCATTGCC-30 50-AAGCTTCGACTGT-30

H-AP 3 & 4 50-AAGCTTTGGTCAG-30 50-AAGCTTCTCAACG-30

H-AP 5 & 6 50-AAGCTTAGTAGGC-30 50-AAGCTTGCACCAT-30

H-AP 7 & 8 50-AAGCTTAACGAGG-30 50-AAGCTTTTACCGC-30

Sugar Tech

123

Sequence Analysis

Blast in NCBI/SUCEST/TIGR databases revealed many

potential defense-related fragments like putative chitinase,

glycine-rich protein, 14-3-3-like protein, xylanase inhibitor

protein, calmodulin-related protein, Myb-related tran-

scription factor LBM2-like, non-symbiotic haemoglobin

and T-snare like protein to be differentially regulated upon

elicitor treatment (Table 2). Of the 75 differential tran-

scripts isolated, 73 and 27 % were up-regulated and down-

regulated transcripts, respectively. ESTs with matches in

the databases were categorized into six groups, primarily

based on putative functions. Among the known proteins,

the defense protein included the highest percentage (37 %)

of up-regulated sequences, followed by transcription and

post-transcription (13 %), general metabolism (11 %),

transport (9 %), cell structure/growth/division (9 %) and

signal transduction (5 %). Among the down-regulated

transcripts, cell structure/growth/division and transcription/

post transcription group included the highest percentage

(20 % each), followed by transport (15 %), defense

(10 %), general metabolism and signal transduction (5 %

each) (Fig. 5).

Full Length Sequence Isolation of DD-RT-PCR

Transcripts by RACE-PCR

In this technique compatible gene specific primers were

designed at the 30 end using the identified partial sequence

information (Table 3). The full length sequences of 14-3-3

like protein and xylanase inhibitor were successfully

amplified, cloned and sequenced. The *1.1 kb fragment

of 14-3-3 like protein transcript was successfully cloned,

sequenced and has been characterized using bioinformatics

Fig. 2 Dosage optimization

study of Cf-elicitor in terms of

accumulation of phenolics. The

elicitor activity of Cf-elicitor

estimated in terms of

accumulation of phenolic

content (cv Co 93009) using

a suspension cells (12 h) and

b sugarcane leaves (24 h)

Sugar Tech

123

tools (Genbank Acc.no. HO222097). The CDD search in

the NCBI database revealed the presence of conserved 14-

3-3 superfamily domain. The open reading frame in the

cloned full length sequence was identified using the ORF

Finder tool from the NCBI website. The information

revealed the presence of 50-UTR (1–86 bp), ORF (87–

857 bp) and 30-UTR (858–1094 bp) in the full length

sequence of 1,094 bp. The gene product had 256 amino

acids in length and the calculated molecular weight was

found to be 28.8 kDa. A 1.1 kb fragment encoding xy-

lanase inhibitor cDNA was amplified, sequenced (Genbank

Acc. no. HO222096) and had 301 amino acids in the

translated protein sequence. Conserved domain analysis by

CDD search algorithm revealed the presence of active site

flap and inhibitor binding site as part of xylanase inhibitor I

(XIP-I) like protein.

Discussion

The new approach to study interaction between sugarcane

and C. falcatum has allowed identification of many

Fig. 4 Representative gel

indicating reamplified

fragments from differential

display-RT-PCR gels (Lane 1–

10 and12–20 are reamplified

fragments, lane 11:100 bp DNA

ladder)

Fig. 3 Autoradiography image

of differential display pattern of

sugarcane cv Co 93009 (elicitor

treated cell suspension)

amplified using 30. Anchor

primers H-T11 (A/C/G) and

eight Arbitrary primers 13-mer

random primers (HAP-1-8)

Sugar Tech

123

Table 2 Differential transcripts identified from sugarcane suspension cells and Colletotrichum falcatum elicitor interaction by differential

display

No. Clone Sequence homology Organism Accession No. Identity

(%)

Function

1 U1 Putative class III chitinase S. officinarum TA36375 90 PR-protein

2 U2 Class III chitinase S. officinarum TC139607 86 PR-protein

3 U3 Non-symbiotic haemoglobin S. officinarum CO373684 96 Nitric oxide signalling

4 U4 Putative xylanase inhibitor S. officinarum CA294642 98 Inhibition of microbial xylanases

5 U5 Xylanase inhibitor S. officinarum CA134685 96 Inhibition of microbial xylanases

6 U6 Putative class III chitinase Zea mays CA264825 90 PR-protein

7 U7 Putative CTV.22 S. officinarum TA28316 63 Transcription cofactor

8 U8 Eukaryotic initiation factor 4A-8 S. officinarum CA280838 60 Translational initiation factor

9 U9 Myb-related transcription factor LBM2-like S. officinarum TC152417 92 Transcription factor for

defense related genes

10 U10 UDP-glucose pyrophosphorylase S. officinarum TA26045 95 Biosynthesis of polysaccharides

11 U11 Carbonic anhydrase S. officinarum TA31757 70 Involved in photosynthesis

12 U12 NADH ubiquinone oxidoreductase subunit S. officinarum TC116208 95 Electron transport chain

13 U13 Phosphoenolpyruvate carboxylase S. officinarum CA174542 67 CO2 fixation/n metabolism

14 U14 14-3-3-like protein S. officinarum TC143247 98 Signalling

15 U15 14-3-3-like protein S. officinarum TC138037 95 Signalling

16 U16 PHD finger protein-like S. officinarum CA079908 97 Epigenetics and chromatin-

mediated transcriptional regulation

17 U17 Leucine rich repeat family protein S. officinarum CA262024 90 Signalling

18 U18 Phosphatidylinositol-4-phosphate 5-kinase S. officinarum CA274716 60 Signalling and in membrane traffic

19 U19 Calmodulin-related protein S. officinarum CA186211 92 Ca2? signal transduction

20 U20 Proline-rich protein S. officinarum TC138513 59 Structural function

21 U21 MSI type nucleosome/chromatin

assembly factor C

S. officinarum TA31492 97 Nuclear assembly

22 U22 Glycine-rich protein S. officinarum CA279589 60 Structural function

23 U23 Os11g0112300 protein S. officinarum TC134956 98 Unknown

24 U24 OSJNBa0008A08.11 protein Sorghum bicolor TA30115 85 Unknown

25 U25 BAC22218.1 hypothetical protein Oryza sativa NP657646 69 Unknown

26 U26 UniRef100_Q7XDP3.Rep: Expressed protein S. officinarum TC138202 93 Unknown

27 U27 Hypothetical protein Sorghum bicolor XM002436389 93 Unknown

28 U28 Hypothetical protein Sorghum bicolor XM002466510 93 Unknown

29 U29 Putative hydroxyproline-rich glycoprotein S. officinarum TA26639 98 Structural protein

30 U30 Putative actin-depolymerizing factor S. officinarum TA28888 97 Actin dynamics

31 D1 Senescence-associated protein-like S. officinarum CA267854 100 Senescence

32 D2 T-snare S. officinarum TC132900 92 Vesicle-mediated transport

33 D3 Actin-7 S. officinarum CA083832 59 Structural function

34 D4 Chromosome undetermined scaffold_183 S. officinarum TC134078 97 Unknown

35 D5 SWIB/MDM2 domain containing

protein mRNA

Zea mays EU958069 68 Unknown

36 D6 Hypothetical protein P0705A05.114 S. officinarum TA33537 98 Unknown

37 D7 Expressed protein Oryza sativa TC458006 84 Unknown

38 D8 VIP1 protein S. officinarum TC133534 97 Brassicosteroid

signalling pathway

39 D9 Putative serine carboxypeptidase II S. officinarum CF570413 91 Proteolysis

40 D10 Putative EBNA1-binding protein homolog S. officinarum CA281884 98 Pre-rRNA processing

41 D11 Putative polyprotein S. officinarum CA206145 83 Unknown

42 D12 Putative histidine amino acid transporter Sorghum bicolor TA24413 90 Amino acid transport

43 D13 Gamma-tubulin interacting protein-like Oryza sativa TA58812 69 Microtubule assembly

Sugar Tech

123

differentially regulated genes. A significant proportion of

these genes resembled genes described as being involved

directly in plant defense. Other high proportion of genes

showed a similarity to genes encoding LRR receptor-like

proteins, signal transduction protein kinases and tran-

scription factors from different species described to be

related with the signaling mechanism leading to plant

defense against pathogen infections (Table 2). Differences

in gene expression between sugarcane tissues upon infec-

tion with C. falcatum and differences in gene expression

between sugarcane suspension cells upon infection with C.

falcatum elicitor were found to be similar. Previous DD

studies with cane tissue and C. falcatum also revealed

major composition of defense, stress and signal transcripts

among differentially expressed transcripts (Prathima et al.

2013).

Differences in gene expression pattern between tissues

and suspension cells of the same plant can be considered as

a result of both innate differences in plant tissue architec-

ture and composition and the pathogen attack strategy. The

pathogen’s primary strategy can be easily based on down

regulation of those plant genes whose products are partic-

ularly dangerous (acting as a first line of defense) to the

growth and development of conidia, appressorium and

other pathogen structural components to establish a suc-

cessful infection (Casado-Dıaz et al. 2006). In other words,

pathogens must first be able to disable plant defenses to

enable them to grow. Because of differences in structural

components, chemical and biological composition of plant

tissues, this pathogen strategy can proceed quicker and be

successful in some plant tissues rather than in others.

Furthermore, these results suggest that a set of these gene

expression profiles can be valuable as a biotechnological

tool because they open the possibility of exploiting them as

‘molecular signatures’ to identify host resistance to C.

falcatum.

Earlier Ramesh Sundar et al. (2002) reported isolation of

a high molecular weight elicitor from the mycelial walls of

C. falcatum. It was characterized as a glycoprotein and the

activity of elicitor resides in the carbohydrate moiety. The

partially purified elicitor induced phenolics accumulation

and the activities of phenylalanine ammonia-lyase (PAL)

and peroxidase (POX) in both sugarcane leaves and sus-

pension- cultured cells. The suspension cells responded to

the elicitor similar to sugarcane leaves in inducing defence

responses. When Cf-elicitor was compared with C. lind-

emuthianum—a non-pathogen elicitor, differential induc-

tion of POX isoforms in suspension-cultured cells of

sugarcane cv. CoC 671 was found (Ramesh Sundar and

Vidhyasekaran 2003a). For studying the defense gene

activation in sugarcane, the intact plant-pathogen system

may not be ideal because the time course of pathogen

infection along with the concomitant accumulation of host

defense could not be monitored precisely. Cell cultures and

elicitors instead of whole plants and live pathogens

respectively are found to be suitable models to study the

defense gene activation in bean, tobacco, rice and in many

other plants because of their high degree of reproducibility

and rapid experimental cycles (Bradley et al. 1992, Brisson

et al. 1994, Chappell et al. 1997, Cordelier et al. 2003,

Janisch and Schempp 2004, Kieffer et al. 2000, Ndimba

et al, 2003, Yamaguchi et al. 2000). Further, the homog-

enous cell suspension is uniformly exposed to the elicitor

preparation and hence the response of cells is relatively

uniform.

Studies of Ramesh Sundar and Vidhyasekaran (2003a,

b) confirmed that the elicitor molecules from C. falcatum

are responsible for specific recognition of the pathogen by

the host and resistance is determined by the rapidity of the

downward signalling of defense pathway. Probably varia-

tion in initiation of signalling process between the resistant

and susceptible genotype determines the pathogen coloni-

zation and disease development in host resistance. The

present study is in continuation of this study to further

explore the molecular interaction of the pathogen elicitor

with sugarcane. The genetic differences in terms of resis-

tance among different varieties could be due to variations

in the synthesis, transport and breakdown of PR-proteins,

other metabolites, reception or signal transduction of hor-

mones (Viswanathan et al. 1996, 2005). At this juncture

concerted efforts are required to isolate and characterize

such specific genes for disease resistance/pathogen recog-

nition in cultivated sugarcane varieties/germplasm. This is

first of its kind in a host pathogen relationship involving

sugarcane and a fungal pathogen. However this approach

was followed in many other plant systems like rice,

tobacco, tomato, French bean, Arabidopsis, soybean etc.

(Wasternack, and Kombrink 2010).

Table 2 continued

No. Clone Sequence homology Organism Accession No. Identity

(%)

Function

44 D14 Auxin efflux carrier protein-like Sorghum bicolor TA28620 88 Auxin specific membrane transport

45 D15 Putative secretory carrier membrane protein Sorghum bicolor TA28044 95 Membrane trafficking

46 D16 Putative ubiquinone oxidoreductase S. officinarum CA271223 97 Electron transport chain

Sugar Tech

123

The use of suspension cells for the study instead of field

samples has eliminated the possibility of other environ-

mental factors to influence the results. The controlled con-

dition has provided a suitable platform for understanding the

recognition of the elicitor moiety by the host system. How-

ever, only few differentially expressed transcripts were

identified when 50 primers targeting defense related and

signaling transcripts through genome scanning (Viswana-

than, Unpublished). In a similar work carried out using same

set of primers in the cane tissues showed differential

expression for six transcripts. These included chitinase,

metallothionein, resistance protein R30, receptor protein

kinase, reversibly glycosylated protein and signal sequence

hydrophobic region (Viswanathan et al. 2009). This neces-

sitated the use of a technique that could inclusively identify

all the possible transcripts that are differential in a given

treatment/tissue. The DD-RT-PCR is an ideal technique

satisfying this criterion. So far there are no reports on works

carried out in sugarcane in this regard and suspension culture

was not used to study transcriptomics in sugarcane. This

makes the data from DD-RT-PCR all the more important, as

it is able to reveal large number of transcripts as differential

Fig. 5 Relative abundance of

differential display transcripts

categorized based on putative

functions (cell suspension)

Sugar Tech

123

in the autoradiograph in contrast to the selected genes used in

the semi quantitative RT-PCR study (Data not shown).

The study of resistance response of any host plant

against a pathogen infection requires understanding the

complex changes in gene expression patterns. This is

mediated by the recognition of specific moiety (elicitor/

avirulence factors) derived from pathogen. Cell surfaces

are believed to play a key role in early interactions between

plants and microorganisms. This was the reason for

choosing the cell suspension as the material that can be

treated with elicitor from C. falcatum. Ayers et al. (1976)

applied this hypothesis who reported that fungal cell walls

contain active fragments that elicit defense responses in

plants. Many elicitors have been isolated since then from

fungi. Fungal elicitors may originate from the cell wall or

may be secreted into the extra cellular space of the

mycelium. Cell wall elicitors are best demonstrated by the

b-1,3-glucans from Phytophthora sojae that are released

from the mycelial cell wall (Hahlbrock et al. 1995) and a

34 kDa protein elicitor from Phytophthora nicotianae

(Delmas et al. 1997). Secreted molecules have also been

purified from few fungi (Joosten et al. 1994; Kamoun et al.

1998). Among them, the peptide elicitors of Cladosporium

fulvum and Rynchosporium secalis and elicitins of Phy-

tophthora spp. are particularly interesting, because they

have been shown to be the products of avirulence genes

(Joosten et al. 1994; Kamoun et al. 1998). Knowledge of

these peptides and the corresponding genes, notably the

avr4 and avr9 genes of C. fulvum, and the INF1 of P.

infestans have greatly contributed to the understanding of

race-cultivar specificity at the molecular level. Several

protein elicitors were isolated from Magnaporthe grisea,

Alternaria spp., Rhizoctonia solani, Aspergillus spp,

Botrytis spp, Penicillium spp. and Trichoderma spp (Qiu,

2004, 2005).

The timing and activation of the defense response after

pathogen recognition is the most important factor for the

success of host resistance. After the pathogen recognition

has been addressed by the host system, downstream pro-

cess of signalling and cascade of events is unleashed. This

may take effect in different forms. For example, glyco-

protein elicitor CSBI from hyphal cell walls of M. grisea

induced defense related enzymes in rice (Li et al. 2004).

These glycoproteins activated plant defense system and

promoted plant disease resistance, representing a potential

tool to engineer disease resistance against broad spectrum

of pathogens. In order to target the genes involved in these

downstream events of host system, primers were designed

from such defense pathways. Interestingly they were the

same transcripts that were identified as differentially

expressed in both the studies (Fig. 5) This means that a

common mode of action is predominantly active in both the

systems i.e. cane tissue vs pathogen and cell suspension vs

elicitor. The results clearly indicated that defense related

transcripts were the major group that was up-regulated

considerably in response to elicitor treatment in suspension

culture in contrast to cane tissue. This may be due to better

accessibility of the cells in suspension to elicitor, leading to

a rapid response with lesser time needed for signal

transduction.

Earlier (Borras-Hidalgo et al. 2005) applied amplified

fragment length polymorphism (AFLP) analyses of cDNA

to identify differentially expressed genes in disease resis-

tant but not in susceptible somaclones of sugarcane in

response to inoculation with either Sporosorium scitami-

neum or Bipolaris sacchari causing smut and eye spot,

respectively. They identified 62 differentially regulated

genes, of which 52 were induced and 10 were down reg-

ulated and most of the induced transcripts were related to

defense or signaling. Similarly the same approach has been

used to identify genes from sugarcane somaclones

expressed during the interaction with another fungal path-

ogen Puccinia melanocepahala causing brown rust (Car-

mona et al. 2004). This study also revealed expression of

transcripts mostly of defense, disease resistance, cell rescue

and signal transduction. Oberschmidta et al. (2003) used

DD technique to study a F2 population of sugar beet that

segregated for Heterodera schachtii resistance. A novel

cDNA Bp23 was isolated by comparing resistant and sus-

ceptible sugar beets in this study.

Table 3 - List of gene specific primers used for 50-RACE-PCR

Sl. no Gene name Primer name Sequence (50–30) Size

(bp)

GC (%) Tm (�C)

1 Xylanase Inhibitor GSP1 GCCTCACTTTATTCTTGCACACGCAC 26 50 78

2 GSP2 CATTGAATGGCGTAGCTGCTGTAGTTG 27 48 80

3 14-3-3 like protein GSP1 AGAGGCTCAGCTCGTTAAACCGC 23 57 72

4 GSP2 GCTAGAGCGACCACAGACATGC 22 59 70

5 GSP3 AGTTTCAGGATGCCATCACAGATGTTGC 28 46 82

6 GeneRacer 50 primer – CGACTGGAGCACGAGGACACTGA 23 61 74

7 GeneRacer 50 nested primer – GGACACTGACATGGACTGAAGGAGTA 26 50 78

Sugar Tech

123

Among the 21 screened transcripts by reverse northern

blot seven transcripts viz., 14-3-3-like protein, xylanase

inhibitor protein 1 precursor, chitinase, leucine rich repeat

family protein, basal layer antifungal peptide, actin depo-

lymerizing factor, putative hydroxyproline-rich glycopro-

tein were identified as differential transcripts. Subsequently

full length sequences of 14-3-3 like protein and xylanase

inhibitor were sequenced and characterized using various

bioinformatics tools. Chitinase gene was characterized as

class IV of family 19 glycosyl hydrolases based on 3D

structure prediction through transcriptomic and bioinfor-

matics tools (Rahul et al. 2013). Further characterization of

these genes functions in relation to disease resistance

would serve as potential candidate genes to understand red

rot resistance in sugarcane. The study on sugarcane—C.

falcatum interaction using DD-RT-PCR represents the first

such attempt to understand the activation of sugarcane

genes by using crude elicitor in suspension cell culture.

The identification of transcripts expressed during elicitor

treatment of suspension cell using DD-RT-PCR has given a

better understanding of the interaction at molecular level.

The study has been able to throw light on the different

categories of transcripts that were activated during the

sugarcane—C. falcatum interaction. The full length char-

acterization of DD derived transcripts will help in their

application in sugarcane transgenic and further character-

ization in terms of their exact role during pathogenesis. To

conclude, the DD-RT-PCR technique has been successfully

used to identify 75 potential candidate genes induced in

sugarcane suspension culture upon elicitor treatment. The

differential expression was confirmed by the reverse

northern study and the full length sequence of the potential

differential transcripts were identified by RACE technique.

Acknowledgments The authors are grateful for Dr. N.V. Nair for

the encouragement and providing facilities. The work was supported

by Department of Biotechnology, New Delhi (BT/PR4970/NDB/51/

051/2004).

References

Anderson-Prouty, A.J., and P. Albersheim. 1975. Isolation of a

pathogen-synthesized fraction rich in glucan that elicits a

defense response in the pathogen’s host. Plant Physiology 56:

286–291.

Ayers, A.R., J. Ebel, B. Valent, and P. Albersheim. 1976. Host-

pathogen interactions: X. fractionation and biological activity

of an elicitor isolated from the mycelial walls of Phytophthora

megasperma var. sojae. Plant Physiology 57: 760–765.

Borras-Hidalgo, O., B.P.H.J. Thomma, E. Carmona, C.J. Borroto, M.

Pujol, A. Arencibia, and J. Lopez. 2005. Identification of

sugarcane genes induced in disease-resistant somaclones upon

inoculation with Ustilago scitaminea or Bipolaris sacchari.

Plant Physiology and Biochemistry 43: 1115–1121.

Bradley, D.J., P. Kjellbom, and C.J. Lamb. 1992. Elicitor and wound-

induced oxidative cross-linking of a proline-rich plant cell wall

protein: A novel, rapid defense response. Cell 70: 21–30.

Brisson, L.F., R. Tenhaken, and C. Lamb. 1994. Function of oxidative

cross-linking of cell wall structural proteins in plant disease

resistance. Plant Cell 6: 1703–1712.

Carmona, E., D. Vargas, C.J. Borroto, J. Lopez, A.I. Fernandez, A.

Arencibia, and O. Borras-Hidalgo. 2004. cDNA-AFLP analysis

of differential gene expression during the interaction between

sugarcane and Puccinia melanocephala. Plant Breeding 123:

499–501.

Casado-Dıaz, A., S. Encinas-Villarejo, B.D.L. Santos, E. Schiliro, E.-

M. Yubero-Serrano, F. Amil-Ruız, and J.-L. Caballero. 2006.

Analysis of strawberry genes differentially expressed in response

to Colletotrichum infection. Physiologia Plantarum 128: 633–

650.

Chappell, J., A. Levine, R. Tenhaken, M. Lusso, and C. Lamb. 1997.

Characterization of a diffusible signal capable of inducing

defense gene expression in tobacco. Plant Physiology 113: 621–

629.

Cordelier, S., P. de Ruffray, B. Fritig, and S. Kauffmann. 2003.

Biological and molecular comparison between localized and

systemic acquired resistance induced in tobacco by a Phytoph-

thora megasperma glycoprotein elicitin. Plant Molecular Biol-

ogy 51: 109–118.

Delmas, N.S., F.V. Mateos, A. Bottin, M. Rickauer, R. Dargent, and

M.T. Esquerre-Tugaye. 1997. Purification, elicitor activity and

cell wall localization of a glycoprotein from Phytophthora

parasitica var. nicotianae, a fungal pathogen of tobacco.

Phytopathology 87: 899–909.

Hahlbrock, K., D. Scheel, E. Logemann, T. Nurnberger, M. Parniske,

S. Reinold, W.R. Sacks, and E. Schmelzer. 1995. Oligopeptide

elicitor-mediated defense gene activation in cultured parsley

cells. Proceedings of National Academy of Sciences, USA 92:

4150–4157.

Janisch, K., and H. Schempp. 2004. Evaluation of the oxidative burst

in suspension cell culture of Phaseolus vulgaris. Zeitschrift fur

Naturforschung B 59: 849–855.

Joosten, M.H.A.J., T.J. Cozijinsen, and P.J.G.M. de Wit. 1994. Host

resistance to a fungal tomato pathogen lost by a single base pair

change in an avirulence gene. Nature 367: 384–386.

Kamoun, S., P. van West, V.G.A.A. Vleeshouwers, K.E. de Groot,

and F. Govers. 1998. Resistance of Nicotiana benthamiana to

Phytophthora infestans is mediated by the recognition of the

elicitor protein INF1. Plant Cell 10: 1413–1426.

Kieffer, F., J. Lherminier, F. Simon-Plas, M. Nicole, M. Paynot, T.

Elmayan, and J.P. Blein. 2000. The fungal elicitor cryptogein

induces cell wall modifications on tobacco cell suspension.

Journal of Experimental Botany 51: 1799–1811.

Li, Y.F., Z.Z. Wang, and X.L. Jia. 2004. Purification and character-

ization of an elicitor (GP66) from Magnaporthe grisea. Acta

Phytopathologia Sinica 34: 127–132.

Liang, P., and A.B. Pardee. 1992. Differential display of eukaryotic

messenger RNA by means of the polymerase chain reaction.

Science 257: 967–971.

Liang, P., L. Averboukh, and A.B. Pardee. 1993. Distribution and

cloning of eukaryotic mRNAs by means of differential display:

Refinements and optimization. Nucleic Acids Research 21:

3269–3275.

Liang, P., D. Bauer, L. Averboukh, P. Warhoe, M. Rohrwild, H.

Miller, M. Strauss, and A.B. Pardee. 1995. Analysis of altered

gene expression by differential display. Methods in Enzymology

254: 304–321.

Liang, P., J.D. Meade, and A.B. Pardee. 2007. A protocol for

differential display of RNA expression using either fluorescent

or radioactive labelling. Nature Protocols 2: 457–470.

Sugar Tech

123

Malathi, P., R. Viswanathan, P. Padmanaban, D. Mohanraj, V.

Ganesh Kumar, and K.P. Salin. 2008. Differential accumulation

of 3-deoxy anthocyanidin phytoalexins in sugarcane varieties

varying in red rot resistance in response to Colletotrichum

falcatum infection. Sugar Tech 10: 154–157.

Menard, R., S. Alban, P. de Ruffray, F. Jamois, G. Franz, B. Fritig, J.

Yvin, and S. Kauffmann. 2004. b-1,3 Glucan sulfate, but not

beta-1,3 glucan, induces the salicylic acid signaling pathway in

tobacco and Arabidopsis. Plant Cell 16: 3020–3032.

Murashige, T., and F. Skoog. 1962. A revised medium for rapid

growth bioassays with tobacco tissue cultures. Plant Physiology

15: 473–497.

Nair, N.V. 2008. Sugarcane Breeding Institute, Coimbatore : A

perspective. Sugar Tech 10: 285–292.

Ndimba, B.K., S. Chivasa, J.M. Hamilton, W.J. Simon, and A.R.

Slabas. 2003. Proteomic analysis of changes in the extracellular

matrix of Arabidopsis cell suspension cultures induced by fungal

elicitors. Proteomics 3: 1047–1059.

Oberschmidta, O., F.M.W. Grundlerb, and M. Kleinec. 2003.

Identification of a putative cation transporter gene from sugar

beet (Beta vulgaris L.) by DDRT-PCR closely linked to the beet

cyst nematode resistance gene Hs1pro-1. Plant Science 165:

777–784.

Prathima, P.T., M. Raveendran, K.K. Kumar, P.R. Rahul, V. Ganesh

Kumar, R. Viswanathan, A. Ramesh Sundar, P. Malathi, D.

Sudhakar, and P. Balasubramaniam. 2013. Differential regula-

tion of defense-related gene expression in response to red rot

pathogen Colletotrichum falcatum infection in sugarcane.

Applied Biochemistry and Biotechnology 171: 488–503.

Qiu, D.W. 2004. Microbe protein pesticide and its prospect. Chinese

Journal of Biological Control 20: 91–94.

Qiu, D.W., Y.L. Xiao, Q. Yao, L. Li, and Z. Liu. 2005. Effect of

activator protein on cucumber growth and the activities of

dehydrogenase, peroxidase and phenylalanine ammonia lyase.

Chinese Journal of Biological Control 21: 41–44.

Rahul, P.R., V. Ganesh Kumar, M. Sathyabhama, R. Viswanathan, A.

Ramesh Sundar, and P. Malathi. 2013. Characterization and 3D

structure prediction of chitinase induced in sugarcane during

pathogenesis of Colletotrichum falcatum. Journal of Plant

Biochemistry and Biotechnology. doi:10.1007/s13562-013-

0226-6.

Ramesh Sundar, A., and P. Vidhyasekaran. 2003a. Differential

induction of phenylpropanoid metabolites in suspension-cultured

cells of sugarcane by fungal elicitors. Acta Phytopathologica

Entomologica et Hungarica 38: 29–42.

Ramesh Sundar, A., and P. Vidhyasekaran. 2003b. Induction of

defense-related biochemical changes by elicitors of red rot

pathogen and a non-pathogen in sugarcane cell culture. Indian

Phytopathology 56: 255–261.

Ramesh Sundar, A., R. Velazhahan, R. Viswanathan, and P.

Vidhyasekharan. 2002. Induction of active oxygen species

(AOS), lipoxygenase and lipid peroxidation in suspension-

cultured sugarcane cells by a glycoprotein elicitor from Collet-

otrichum falcatum. Journal of Plant Diseases and Protection

109: 441–451.

Sambrook, J.F., E.F. Fritschi, and T. Maniatis. 1989. Molecular

cloning: A laboratory manual, 18.86. New York: Cold Spring

Harbor Laboratory Press.

Sundara, B. 1998. Sugarcane cultivation, 1st ed, 392. New Delhi:

Vikas Publishing House Pvt Ltd.

Viswanathan, R. 2010. Plant disease: red rot of sugarcane, 306. New

Delhi: Anmol Publishers.

Viswanathan, R., P. Malathi, A. Ramesh Sundar, S. Aarthi, S.M.

Premkumari, and P. Padmanaban. 2005. Differential induction of

chitinases and thaumatin-like proteins in sugarcane in response

to infection by Colletotrichum falcatum causing red rot disease.

Journal of Plant Diseases and Protection 112: 537–542.

Viswanathan, R., D. Mohanraj, P. Padmanaban, and K.C. Alexander.

1996. Synthesis of phytoalexins in sugarcane in response to

infection by Colletotrichum falcatum Went. Acta Phytopatho-

logica et Entomologica Hungarica 31: 229–237.

Viswanathan, R., R. Nandakumar, and R. Samiyappan. 2003.

Involvement of pathogenesis-related proteins in Pseudomonas

spp. induced systemic resistance against Colletotrichum falca-

tum in sugarcane. Journal of Plant Diseases and Protection 110:

524–537.

Viswanathan, R., A. Ramesh Sundar, P. Malathi, P.R. Rahul, V.

Ganesh Kumar, R. Banumathy, P.T. Prathima, M. Raveendran,

K.K. Kumar, and P. Balasubramanian. 2009. Interaction between

sugarcane and Colletotrichum falcatum causing red rot: Under-

standing disease resistance at transcription level. Sugar Tech 11:

45–50.

Viswanathan, R., and R. Samiyappan. 1999. Red rot disease in

sugarcane: a major constraint for the Indian sugar industry.

Sugar Cane 17: 9–15.

Wasternack, C., and E. Kombrink. 2010. Jasmonates: Structural

requirements for lipid-derived signals active in plant stress

responses and development. ACS Chemistry Biology 5: 63–77.

doi:10.1021/cb900269u.

Yamaguchi, T., A. Yamada, N. Hong, T. Ogawa, T. Ishii, and N.

Shibuya. 2000. Differences in the recognition of glucan elicitor

signals between rice and soybean: b-glucan fragments from the

rice blast disease fungus Pyricularia oryzae that elicit phyto-

alexin biosynthesis in suspension-cultured rice cells. Plant Cell

12: 817–826.

Zieslin, N., and R. Ben-Zaken. 1993. Peroxidase activity and presence

of phenolic substances in peduncles of rose flowers. Plant

Physiology and Biochemistry 31: 333–339.

Sugar Tech

123