ORIGINAL PAPER

Assessing genetic variation and population structureof invasive North American beaver (Castor CanadensisKuhl, 1820) in Tierra Del Fuego (Argentina)

Marta Susana Lizarralde Æ Graciela Bailliet ÆSebastian Poljak Æ Mariana Fasanella ÆCecilia Giulivi

Received: 8 August 2007 / Accepted: 10 August 2007

� Springer Science+Business Media B.V. 2007

Abstract The North American beaver (Castor

Canadensis) was introduced into Isla Grande de

Tierra del Fuego, Argentina in 1946 as a potential

source of wild fur. The species showed high growth

potential, reaching close to 100,000 individuals from

an original founding stock of 25 females and 25

males. Beavers adapted rapidly to their new environ-

ment and became invasive, providing an excellent

model of successful adaptation of introduced popu-

lations to a new habitat. In this study, we used

polymorphic mitochondrial (mt) DNA to evaluate

genetic variation in the introduced beaver population

from Tierra del Fuego. Nucleotide variation in partial

sequences of Cytochrome b (500 bp) and 12S rRNA

(421 bp) genes and the main non-coding D-loop

region (521 bp) were analyzed. Our study allowed to

identify 10 different mtDNA lineages in the invasive

population, none of them shared among the source

populations. The pattern observed is a consequence

of cessation of gene flow following expansion of the

founding beaver population since the time of its

introduction. This approach contributes to the under-

standing of effects of genetic changes on survival

ability and reproductive success of invasive species.

It also has important management implications to

invasive species.

Keywords Castor Canadensis � Control region �Cytochrome b � D-loop � Genetic variation �Haplotype � Invasive population �Mitochondrial marker � 12S rRNA �Tierra del Fuego

Introduction

The management of biological invasions requires

establishing general principles to predict the perfor-

mance of a species in a new locality. Consideration of

population genetics, with explicit analyses of the

genetic structure of invasive species, may allow more

effective management of invasive species. Examples

of potential applications of population genetics in

studies of invasive species include predicting inva-

siveness to reduce occurrence of new invasions,

M. S. Lizarralde (&) � S. Poljak � M. Fasanella

Centro Regional de Estudios Genomicos, Universidad

Nacional de La Plata, Av. Calchaquı km 23.5 Piso 4,

CP 1888 Florencio Varela, Buenos Aires, Argentina

e-mail: mlizarralde@creg.org.ar

M. S. Lizarralde � S. Poljak

Centro Austral de Investigaciones Cientıficas, CADIC-

CONICET, Ushuaia 9410 Tierra del Fuego, Argentina

G. Bailliet

Instituto Multidisciplinario de Biologıa Celular,

IMBICE, La Plata 1900, Argentina

C. Giulivi

Department of Molecular Biosciences, School

of Veterinary Medicine, University of California,

Davis, CA 95616, USA

123

Biol Invasions

DOI 10.1007/s10530-007-9161-6

predicting the efficacy of alternative control efforts,

and improving management of invasive species

within native communities (Sakai et al. 2001).

In 1946, 25 breeding pairs of North American

beaver, Castor canadensis Kuhl, 1820, were released

in the central region of Isla Grande, the largest island

of Tierra del Fuego Archipelago (Fig. 1). Since this

introduction, the beaver population has rapidly grown

and spread from Isla Grande to other islands of the

archipelago (Lizarralde 1993), thus becoming invad-

ers (Moorman 2007; Anderson et al. 2006a;

Lizarralde et al. 2004; Jasick et al. 2002).

Castor canadensis is native to North America

where it is widely distributed, and it has been

introduced in several Eurasian localities where it

competes with the European species C. fiber (Jenkins

and Busher 1979). The introduction of beavers into

Tierra del Fuego Archipelago dramatically affected

this sub-Antarctic ecosystem. Given that the combi-

nation of insular conditions and Antarctic influence

determines an extreme climate in the archipelago that

provides only marginal possibilities for the develop-

ment of many native species, any alteration—such as

introduction of exotic fauna—represents a significant

modification (Lizarralde and Escobar 2000). The

establishment of beavers induced irreversible changes

to the structure and function of biological communi-

ties (Lizarralde et al. 1996, 2004).

Castor canadensis has adapted successfully to sub-

Antarctic ecosystems as a geographically isolated

invasive species (Lizarralde 2006; Lizarralde et al.

2004). During its expansion, the dispersal rate of the

species has ranged from 2 to 6 linear kilometers per

year along different watercourses. As a result,

beavers occur at present throughout most of Isla

Grande de Tierra del Fuego in both the Chilean and

Argentinean sectors. The latest census of Isla Grande

and other islands in the Beagle Channel indicate that

the beaver population is near the maximum carrying

capacity of the area (Lizarralde et al. 2004). Esti-

mated population density is 0.7 beaver colonies per

km2, with more than 100,000 animals in a geograph-

ical range of approximately 70,000 km2. Physical

changes caused by the beavers have become an

integral part of the southern landscape. At present,

beavers have colonized all watersheds and streams of

Isla Grande and other islands of the Archipelago,

causing several modifications of the forest ecosystem,

such as (a) expansion of wetlands, (b) higher water

table levels and (c) alteration of the biochemical

composition of the water, sediments and soils of

riparian areas by accumulation of organic phospho-

rus, carbon and nitrogen (Lizarralde et al.1996;

Coronato et al. 2003). These changes have had

important consequences for the flora and fauna of

the region (Anderson et al. 2006b; Martinez Pastur

et al. 2006; Moorman et al. 2006).

Likewise, beaver specimens have been repeat-

edly recorded in the continental sector of Chile’s

Brunswick Peninsula since 1994, a fact that con-

firms the entrance of the species into that sector of

continental Patagonia (Skewes et al. 2006; Ander-

son et al. 2006b). Consequently, detailed and

systematized information about beaver invasion

processes at regional level is extremely relevant.

Data such as behavior of the species in other areas

of the world, ecological characteristics of their

original geographical distribution, age of the pop-

ulation in the new environment, extent of the

invasion, and knowledge of genetic aspects may

represent key information when it comes to plan-

ning management strategies.

Fig. 1 Isla Grande de

Tierra del Fuego. Location

of the study area within

Tierra del Fuego National

Park according to Martinez

Pastur et al. (2006)

M. S. Lizarralde et al.

123

The analysis of the genetic attributes of invasive

species suggests that their adaptive success involves

genetic traits that are determinant enough to ensure

rapid expansion in a new environment (Nei 1975;

Roughgarden 1979; Sakai et al. 2001). Of particular

interest is the concept that biological invasions allow

species to alter their own genetic pattern (Wright

1955; Carson 1987) and exhibit an extremely wide

range of evolutionary patterns (Brown and Marshall

1986). In addition, recent awareness of the loss of

genetic variability due to inbreeding and founder

effects in invaders (Sakai et al. 2001) and their

significance for the preservation of these species

warrants an extensive study of the Tierra del Fuego

beaver population.

Relatively low genetic variability has been

observed in several natural populations, such as

muskrat Ondatra zibethicus introduced in Finland, or

beaver C. fiber in Europe (Ellegreen et al. 1993;

Durka et al. 2005) and it has been attributed to

extensive population bottleneck phenomena. In the

case of C. canadensis introduced in Tierra del Fuego,

the impressive growth of this population suggests that

its viability and fertility were not drastically affected

by genetic founder effect. But, until now, genetic

structure of the introduced beaver population was

unknown.

The goals of this work were to evaluate genetic

diversity within this invasive beaver population and

test the current population structure, based on the

following considerations: (i) Tierra del Fuego bea-

vers are geographically isolated from other

populations of C. canadensis; (ii) they represent an

interesting model case to study the consequences of

population founder events initiated by the introduc-

tion of a small number of animals, and (iii) the

North American beaver established in Isla Grande

de Tierra del Fuego is also an informative case for

studying invasion processes. To address these goals,

we analyzed a hypervariable partial sequence of the

mitochondrial DNA (mtDNA) D-loop (or control

region), which has already proved to be suitable for

investigations at the population level in several

mammalian species (Ducroz et al. 2005; Durka

et al. 2005; Reyes et al. 2003; Matson and Baker

2001; Matsuhashi et al. 1999, Douzery and Randi

1997; Brown et al. 1986). We also analyzed

segments of cytochrome b and 12S rRNA as sources

of complementary information about the genetic

structure of the population. This study was per-

formed on a population from the southern area of

Isla Grande de Tierra del Fuego located within

Tierra del Fuego National Park (Fig. 1), and its

results are particularly important for the planifica-

tion of future management programs in this and

other areas with similar problems.

Finally, the genetic information obtained from

this work is especially significant to monitor the

present advance of this population onto newly

invaded areas of the archipelago, such as Brunswick

Peninsula in Chile, and to be used in future control

programs, both to assess the integrity of genetically

different units and to ensure successful control

actions that take advantage of the negative impacts

of inbreeding.

Materials and methods

Tissues and specimens analyzed

A total of 30 C. canadensis specimens from water-

courses (Cruz, Negro, Los Castores, Lapataia and

Ensenada creeks) located within 75 km2 Tierra del

Fuego National Park study area (54� 50’ 32.4’’ SL, 68�32’ 11.5’’ WL), 15 km west of Ushuaia city (Fig. 1),

were analyzed. DNA was extracted from samples of

fresh tissue (liver, spleen, muscle) of specimens

collected by park guards (Table 1). In addition, samples

of fixed tissues (liver and muscle) of 5 specimens from a

source population (Admiralty Island, Alaska, USA)

were included as outgroup for the analysis. Three sets of

mt-DNA (cytochrome b, D-loop and 12S rRNA)

C. canadensis and C. fiber sequences obtained from

GenBank database (accession numbers AF293348,

AF155878, AF155879, CF1389529, AY623644-6,

AY623642-3, DQ088702-3, AY012111 and U67297)

were also used for the comparisons.

Skulls and mandibles of the specimens analyzed

were deposited in the mammal collection of Museo de

Ciencias Naturales de La Plata, Argentina. Tissues and

other data associated with each specimen are refer-

enced directly to each voucher specimen and stored

along with a field catalog number in the following

laboratory collections: Centro Regional de Estudios

Genomicos, Florencio Varela, Argentina (Pcc) and US

Forest Service, Juneau, Alaska, USA (JB02).

Genetic structure of invasive beaver population in Tierra del Fuego

123

A detailed list of specimens sequenced per sam-

pling site is given below.

Specimens examined

Castor canadensis 1 (Pcc240) male (M) Los Castores

creek, Tierra del Fuego National Park, TFNP, Argen-

tina; 2 (Pcc229) M Los Castores creek, TDFNP; 3

(Pcc226) female (F) Negro creek TDFNP; 4 (Pcc239)

M Cruz creek TDFNP; 5 (Pcc227) M Negro creek

TDFNP; 6 (Pcc228) F Los Castores creek TDFNP; 7

(Pcc210) F Cruz creek TDFNP; 8 (Pcc235) F Cruz

creek; 9 (Pcc 224) F Cruz creek TDFNP; 10 (Pcc 218) F

Ensenada TDFNP; 11 (Pcc99) F Lapataia TDFNP; 12

(Pcc204) F Ensenada TDFNP; 13 (Pcc225) F Los

Castores creek TDFNP; 14 (Pcc87) F Lapataia

TDFNP, 15 (Pcc89) F Lapataia TDFNP, 16 (Pcc90)

F Lapataia TDFNP, 17 (Pcc91) M Lapataia TDFNP, 18

(Pcc100) F Los Castores creek TDFNP, 19 (Pcc 123) F

Los Castores creek TDFNP, 20 (Pcc165) M Cruz creek

TDFNP, 21 (Pcc200) M Negro creek TDFNP, 22

(Pcc201) M Negro creek TDFNP, 23 (Pcc203) F

Ensenada TDFNP, 24 (Pcc204) F Ensenada TDFNP,

25 (Pcc209) M Cruz creek TDFNP, 26 (Pcc211) F

Negro creek TDFNP, 27 (Pcc217) M Ensenada

TDFNP, 28 (Pcc213) M Cruz creek TDFNP, 29

(Pcc214) M Los Castors creek TDFNP, 30 (Pcc215)

F Los Castores Creek TDFNP, 31 (JB02-01) M Mile

2.8 Greens Cr. Rd Admiralty Island (GCRAI), Alaska

USA; 32 (JB02-02) F Mile 4.8 GCRAI; 33 (JB02-04) F

Mile 3.8 GCRAI; 34 (JB02-05) M Mile 3.8 GCRAI; 35

(JB02-06) F Mile 2.6 GCRAI.

DNA extraction, amplification and sequence

analyses

DNA was extracted from fresh and fixed liver, kidney

and muscle tissue following the sodium duodecyl

sulfate-proteinase K/phenol/RNase method (Sam-

brock et al. 1989). Samples were concentrated by

ethanol precipitation. Amplified sequences were

cytochrome b gene (approximately 600 bp), 12

SrRNA (approx. 400 bp) gene and D-loop or control

region (approx. 500 bp).

Primer sequences

The letters L and H in the following sequences denote

light and heavy strands, respectively; the number

indicates position of the 30 base of the primer in the

complete mouse mtDNA sequence (Bibb et al. 1981).

Cytochrome b gene was amplified using a combina-

tion of primers MVZ 05 - L14115 (50-CGAAGCTTG

ATATGAAAAACCATCGTTG-30) and MVZ14 -

H15825 (50-GGTCTTCATCTYHGGYTTACAAGA

C-30) (Smith and Patton 1993), 12S rRNA gene with

L1091 (50- AAAAAGCTTCAAACTGGGATTAGA

Table 1 Castor canadensis examined for the sequence variation of mitochondrial DNA fragments of Cytochrome b, D-loop and 12

rRNA (12S)

Haplotype Frequency Base pairs Accesion number Sampling site locations

Cytb A 0.38 500 AY793641 East (Cruz) and West (Lapataia, Los Castores )

Cytb B 0.19 500 AY793642 East (Ensenada) and West (Los Castores, Negro)

Cytb C 0.12 500 AY793643 East (Cruz) and West (Negro, Lapataia)

Cytb D 0.31 500 AY793644 Admiralty Island (Alaska, USA)

DLoop A 0.18 503 AY787822 East (Cruz, Ensenada)

DLoop B 0.12 503 AY787823 West (Negro, Los Castores)

DLoop C 0.06 503 AY787824 West (Negro, Lapataia)

DLoop D 0.12 503 AY787825 East (Cruz, Ensenada)

DLoop E 0.12 503 AY787826 East (Cruz, Ensenada)

DLoop F 0.06 503 AY787827 West (Lapataia, Negro, Los Castores)

DLoop G 0.31 521 AY968083 Admiralty Island (Alaska, USA)

12SrRNA 1.00 421 AY787828 West and East TDFNP sites, Admiralty Island (USA)

Individuals are arranged according to their, type of haplotype, deposited number and geographical location origin: Tierra del Fuego

National Park (Western and East), Argentina and Admiralty Island (AIUSA), Alaska, USA

M. S. Lizarralde et al.

123

TACCCCACTAT-30) and H1478 (50- TGACTGCA-

GAGGGTGACGGGCGGTGTGT- 30) described by

Kocher et al. (1989). Hypervariable domain I (HVI)

(Saccone et al. 1987) of the control region (D-loop)

was amplified using the following universal primers:

Thr-L15926 (50-CAATTCCCCGGTCTTGTAAACC-

30) located in the neighboring tRNA-pro gene and

DL-H16340 (50-CCTGAAGTAGGAACCAGATG-

30) (Vila et al. 1999; Ducroz et al. 2005; Durka et al.

2005).

Amplification of the double-stranded product was

performed in 25 ll or 50 ll total reaction volume

with two polymerase chain reaction (PCR) thermal

profiles using Thermus aquaticus DNA-polymerase

in a MJ thermocycler. About 25 ll of PCR mix

contained 1.25 U of Platinum Taq DNA polymerase

(InvitrogenTM), 2.5 ll of 10 · Tag polymerase buffer

with (NH4) SO4, 1.5 mM of MgCl2, 200 lM of

DNTP’s and 5 pmol of each primer. Thermal profiles

of cytochrome b and D-Loop consisted of denatur-

ation for 1 min at 94�C, annealing for 1.5 min at

55�C and extension for 2–6 min at 72�C; the cycle

was repeated 40 times. Thermal profile of 12 S rRNA

consisted of denaturation for 2 min at 94�C, anneal-

ing for 1 min at 65�C and extension for 1–3 min at

73�C; the cycle was repeated 30 times.

Double-stranded PCR products were purified with

Qiaquik PCR Purification Kit (QiagenTM), eluted in

water following the manufacturer’s indications, and

directly sequenced in both directions using the same

primers for amplifications. Sequencing was con-

ducted using ABI Prism Automated 377 and 3100

Genetic Analyzer Sequencers (Applied Biosys-

temsTM), at the Division of Sequencing Services of

Universidad Nacional de San Martın (Buenos Aires,

Argentina) and the Advanced Genetic Analysis

Center of University of Minnesota (Minnesota,

USA) respectively. Sequences for both strands were

determined.

The sequences were visually edited, managed and

aligned using Biology WorkBench 3.2 (http://work

bench.sdsc.edu) or Chromas 2.3 (Technelysium Pty.

Ltd. 1998–2004 http://www.technelysium.com.au)

and the computer software CLUSTAL W (Thompson

et al. 1994). Alignments were then optimized manu-

ally. To evaluate sequence divergence analyses

between groups, we clustered populations from study

area of 75 km2 Tierra del Fuego National Park of

using Phylip 3.57 (Felsenstein 2004) into two groups:

West (Los Castores, Negro and Lapataia creeks) and

East (Ensenada and Cruz creeks) (Table 1).

Sequences were deposited in GenBank under

accession numbers AY793641 to AY793644,

AY787822 to AY787827, AY968083, and AY787828.

A median-joining network (MJ) (Bandell et al.

1999) was constructed using Network 4 (http://www.

fluxus-engineering.com) to visualize relationships

among haplotypes. Haplotype diversity (h) and pair-

wise divergence (Nei 1987; Tajima 1993) were

computed using ARLEQUIN version 3.01 (http://

cmpg.unibe.ch/software/arlequin3) (Excoffier et al.

2006). Analysis of genetic diversity was performed as

described in Nei (1987). Pairwise differences among

haplotypes were used as measurement of molecular

distance (Nei 1987, Tajima 1993, Excoffier 2004).

Mismatch distribution analysis followed Schenider

and Ecoffier (1999). Correlation of genetic and geo-

graphical distances was tested by a Mantel test

between the pairwise Fst values and mean net number

of pairwise differences (Tajima 1993; Fu 1997). All

computation analysis were performed as implemented

in ARLEQUIN (1,000 permutations).

Results

Sequence analysis of a total number of 35 specimens

analyzed in this study revealed 12 new haplotypes.

These new Castor canadensis mt-DNA haplotypes

are available from GenBank under numbers

AY793641-44 (cytochrome b), AY 787822 to AY

787827 and AY968083 (D-loop), and AY787828

(12S rRNA). The sequences are not complete and

have the standard gene order of mammals. The 12

new haplotypes reported here represent a data set

with 18 mt-DNA genomes (GenBank database

http://www.ncbi.nlm.nih.gov/Genbank) from distinct

C. canadensis populations in the Northern and

Southern Hemispheres.

Cytochrome b sequences

Sequence divergence

Cytochrome b sequences of 500 base pairs were

available. Sequence data for 3 new haplotypes (CytbA,

CytbB and CytbC) were detected and also deposited in

Genetic structure of invasive beaver population in Tierra del Fuego

123

GenBank (Accession numbers AY793641-44).

Sequence analysis of the 5 C. canadensis samples

from the source population revealed another new

different haplotype (CytbD) also deposited in Gen-

Bank (Accession number AY793644). Gene diversity

obtained was 0.7583 ± 0.0603 (mean ± SD).

Nucleotide sequence variation within the 500 bp

of cytochrome b consisted of 3 variable sites located

at positions 208, 327 and 330. All substitutions were

A/T transitions. Table 2 shows the distribution of

variable sites among C. canadensis haplotypes in the

500 bp alignment analysis. Heteroplasmy was not

detected in the nucleotide sequence of the fragment.

Haplotype CytbA was dominant and shared among

the sites studied. Frequency of haplotypes ranged

from 0.12 to 0.38 (Table 1). Nucleotide diversity (p)

was 0.49 ± 0.35.

The new 4 C canadensis sequences differed from

previously reported sequences (Kuehn et al. 2000;

Montgelard et al. 2002; Ducroz et al. 2005). Haplo-

type CytbD from the source population also differed

by 3 point mutations from that of the invasive TFNP

population. Sequence analysis comparisons with

C. fiber as outgroup revealed 98 variable sites, 77

of them phylogenetically informative. Transitions of

sites 144 (A/G) and 147 (T/C) discriminated between

beaver species, as well as inversions at sites 258–259

and 265–267 occurring in the first 306 bp (GenBank

accession numbers C. canadensis AY793641-46,

AY793373-75-76, AF293348, AF155878 vs. C. fiber

AF155879, AJ389529).

Population relationships

The median-joining (MJ) network showed haplotype

CytbB as a central cluster connected mainly by short

branches to haplotypes CytbA and CytbC, while

haplotype CytbD (source population) formed a cluster

connected by relatively long branches to the rest

(Fig. 2a). Mean number of pairwise differences was

1.48 ± 0.94. Fu’s Fs test of selective neutrality

(original number of alleles k = 4) was Fs = 0.65;

Mean Theta (Pi) = 0.99 ± 0.47. Expected number of

alleles was 4.17. Pairwise divergence (p distance)

ranged from zero to 3 (Fig. 3). The pattern of

pairwise nucleotide differences showed a trimodal

distribution.

D-loop sequences

Sequence divergence

Six haplotypes were detected within D-loop

sequences (D-LoopA, D-LoopB, D-LoopC, DLoopD,

D-LoopE and D-LoopF) (Table 1). The amplified

fragment was 503 bp long. After alignment, the

haplotypes differed by 6 point mutations. The 5

C. canadensis sequences from the source population

differed by 7 point mutations and showed another

different haplotype (D-LoopG) that was markedly

longer (521 bp) than those from invasive population.

Table 2 Condensed matrix diaplaying variable sites of the

500 bp alignment of the Cytochrome b for 4 haplotypes found

in C. canadensis. Haplotype names are given on the left and

nucleotide positions are showed at the top

Haplotype 208 327 330

Cytb A_ AY793641 G G G

Cytb B_ AY793642 A � �Cytb C_ AY793643 A � A

Cytb D_ AY793644 A A A

Fig. 2 Median joining (MJ) network for C. canadensis (a)

Cytochrome b and (b) DLoop haplotypes (Table 1). Circle

areas are proportional to haplotype frequencies

M. S. Lizarralde et al.

123

All haplotypes were deposited in GenBank (accession

numbers AY 787822 to AY 787827 and AY968083

respectively). Gene diversity was 0.87 (SD 0.06).

With all haplotypes included, total alignment

length was 521 bp, and sequence variation consisted

of variable sites at positions 67, 142, 156, 229, 240,

250 and 264 (Table 3). All the polymorphic sites

exhibited single substitutions only, all of which were

transitions with a bias toward C-T type transitions.

No heteroplasmy was detected in the nucleotide

sequence of the fragment. The majority of variable

sites were located at the 30-end of the amplified

fragment, downstream from the tandem repeats

region (ETA’s) of the control region (Sbiza et al.

1997). Table 3 shows the distribution of variable sites

among C. canadensis haplotypes for the 521 bp

alignment analysis.

Haplotypes were shared among study sites (Table 1)

with frequencies ranging from 0.1 to 0.3 (SD 0.1).

Nucleotide diversity (p) was 0.322619 ± 0.209556.

Pairwise divergence (p distance) ranged from 0 to 4.

The new 7 sequences of C. canadensis given here

differed by 7 point mutations from those reported by

Ducroz et al (2005) (GeneBank accession numbers

AY623644–46). The new C. canadensis haplotypes

also differed from those of the outgroup C. fiber

(Durka et al. 2005) by 140 variable sites, 126 of

which were phylogenetically informative.

Population relationships

The median-joining (MJ) network showed that hapl-

otypes from western and eastern sites were close to

each other, whereas haplotype G formed a cluster in

the opposite end of the network, connected to the rest

by relatively long branches (Fig. 2b).

Mean number of pairwise differences was

2.258333 (SD 1.309607). Fu’s Fs test of selective

neutrality (original number of alleles k = 7) was Fs =

–1.34863 and Mean Theta (Pi) was 1.92639 ±

0.88916.

The pattern of pairwise nucleotide differences

showed bimodal distribution (Fig. 3).

Fig. 3 Mismatch distributions for cytochrome b (a) and

D-loop (b) Castor canadensis haplotypes

Table 3 Condensed matrix

diaplaying variable sites of

the 521 bp alignment of the

D-loop for 7 haplotypes

found in C. canadensis.

Haplotype names are given

on the left and nucleotide

positions are showed at the

top

HAPLOTYPE 67 142 156 229 240 250 264

D-loop A_AY787822 A C C G T C G

D-loop B_AY787823 � � � � � � A

D-loop C_AY787824 G � � � � � �D-loop D_AY787825 � � T A � � A

D-loop E_AY787826 � � T A � � �D-loop F_AY787827 � T � A C � �D-loop G_AY968083 A C C A T T A

Genetic structure of invasive beaver population in Tierra del Fuego

123

12 S rRNA Sequences

Sequence divergence

Mitochondrial 12S rRNA sequence data for 421 base

pairs were also available. A unique haplotype was

detected in all sampled specimens and deposited in

GeneBank (accession number AY787828) (Table 1).

This sequence was compared with GenBank

sequences (Accession numbers AY012111 and

U67297). Nucleotide sequence revealed 1 point

mutation (transition A/G) within the 421 bp.

Discussion

The exotic North American beaver C. canadensis had

adapted successfully to the sub-Antarctic ecosystems

as a geographically isolated invasive species. After

the initial introduction, beavers spread throughout the

entire Tierra del Fuego Archipelago and colonized all

the islands located between the Atlantic and Pacific

oceans; recently, they have also invaded new areas in

the Chilean sector of continental Patagonia. Their

rapid population growth, which has led to a current

population size of about 100,000 individuals from 25

founding pairs, indicates that the initial population

collapse did not have any drastic effects on the

viability or fertility of the individuals. Thus, this

exotic beaver population represents an informative

model for the study of genetic consequences of

invasion processes, including possible founder effects

caused by introduction of a small number of animals.

Although partial sequences of different mtDNA

markers have been previously reported for C. canad-

ensis in separate works (Nedhal et al. 1996; Murphy

et al. 2001; Ducroz et al. 2005), the present investi-

gation is the first combination of cytochrome b, 12S

rRNA and D-loop sequence analysis. The C. canad-

ensis populations examined in this study display high

genetic divergence at intrapopulation level.

Our data revealed the existence of several lineages

in the invasive beaver population. As a preliminary

result, the new mitochondrial DNA sequences sug-

gest clear differences between South and North

American beaver populations; in particular, the

cytochrome b transition at site 327 (Table 2) allowed

discrimination between invasive and source popula-

tions of C. canadensis. Transversions in the D-loop

or control region were not detected in our samples,

possibly because these are rare events at the popu-

lation level, although they may occur at a few

consecutive sites (Wood and Phua 1996; Douzery and

Randi 1997).

One of the most remarkable results of our study is

the genetic structuring detected within the invasive

beaver population, which could also have been

present in the source population. It may be hypoth-

esized that, after the expansion of the introduced

beavers and establishment of their current range, the

invasive population evolved according to the isola-

tion-by-distance model, as in the case of C. fiber

populations (Durka et al. 2005). This study revealed

new haplotypes different from previously reported

ones. These elements, together with the close simi-

larity of the new haplotypes within sites, suggest that

the pattern observed is a consequence of cessation of

gene flow following expansion of the founder 50-

individual population (founding type) at some point

from the time of introduction. Thus, disappearance of

geographically intermediate populations by isolation

would have produced the genetic structuring pattern

showed by C. canadensis in Tierra del Fuego.

Alternatively, this pattern could be the result of

genetic structuring that was already present in the

founder population.

Beavers disperse along the rivers and watershed

network of Isla Grande, mainly by using larger fast-

flowing rivers, and gene flow between local beaver

populations could be restricted by features of these

fluvial systems. For example, in the case of European

beavers the watersheds of Eurasian rivers could have

functioned as effective barriers to gene flow (Durka

et al. 2005).

Low DNA variation has been repeatedly reported

in taxa that have undergone severe bottlenecks or

founder effects. The European beaver C. fiber seems

to be one of the mammals with lowest variability

levels, according to studies of mitochondrial DNA

and major histocompatibility complex (MHC)

(Ducroz et al. 2005, Milishnikov and Saveljev

2001; Ellegren et al. 1993). Whereas Scandinavian

beavers exhibit extremely low variation of multilocus

minisatellite fingerprinting and complete monomor-

phism at MHC class I and II loci, the populations

from the European sector of Russia show substantial

polymorphism at minisatellite but not at MHC loci

(Ellegren et al. 1993).

M. S. Lizarralde et al.

123

Even though the depth of the split between the

South (Tierra del Fuego Archipelago) and North

American beaver populations could not be clearly

determined from these preliminary data, the inter-

ruption of gene flow between both populations clearly

suggests possible fixation of the divergent new

haplotypes after severe drift in the archipelago

population. The extreme genetic variation showed

by cytochrome b and especially D-loop haplotypes is

probably a consequence of migration and reinvasion

processes between Chilean and Argentinean popula-

tions. Similar genetic variability has been observed

between several European and Eurasian beaver

populations thought to have undergone extensive

bottlenecks or founder effects (Ellegren et al. 1993,

1994; Ducroz et al. 2005; Durka et al. 2005).

These results give rise to new questions. What is

the magnitude of the genetic drift that occurred in the

invasive beaver population of 25 mating pairs from

North America that expanded into a population of

probably more than 100,000 animals? Will they

successfully invade new areas of continental southern

Patagonia or will they remain restricted to Tierra del

Fuego Archipelago? Have invasive beavers under-

gone extensive physiological changes in the process

of adaptation to the Southern Cone? These and many

other questions remain unanswered, and further

comparative analyses of mtDNA variation across

the range of this species in the Argentinean and

Chilean sectors of Tierra del Fuego Archipelago will

be required to address them. Comparisons with North

American populations will be helpful to distinguish

founder effects generated at the time of introduction

from preexisting genetic structuring. DNA typing of

beavers from different source areas by means of PCR

analysis could be another useful approach to assess

the status of polymorphisms prior to the founder

effect. Furthermore, studies using nuclear markers,

such as microsatellites and genes with likely adaptive

significance, will help to assess the extent of genetic

variation and provide a complement to this dataset.

Acknowledgements This study was supported by a grant

from Consejo Nacional de Investigaciones Cientıficas y

Tecnicas, CONICET, Argentina (PIP 4306/96) to ML and a

Diversity Initiative Grant (2002–2003) from the University of

Minnesota to CG. Special thanks to Mrs. Virginia Haynes

(UMD) for technical assistance in the sequencing process. We

thank Julio Escobar and Guillermo Deferrari (CADIC-

CONICET) for participation and assistance in the collection

of material used in this study; all the staff at Tierra del Fuego

National Park (TFNP), and especially Dr. Thomas Hanley (US

Forest Service, Juneau, Alaska, USA) for providing tissue

samples of North American specimens and for his special

collaboration. We also thank Dr. Claudio Bravi (IMBICE) for

his advice and comments.

References

Anderson CB, Rozzi R, Torres-Mura JC, McGehee SM,

Sherriffs MF, Schuettler E, Rosemond AD (2006a) Exotic

vertebrate fauna in the remote and pristine sub-Antarctic

Cape Horn Archipelago region of Chile. Biodivers Con-

serv 10:3295–3313

Anderson C, Griffith C, Rosemond A, Rozzi R, Dollenz O

(2006b) The effects of Invasive North American beavers

on riparian plant communities in Cape Horn, Chile: do

exotic beavers engineer differently in sub-Antartic eco-

systems? Biol Conserv 128:467–474

Bandell HJ, Forster P, Rol A (1999) Median-Joining networks

for inferring intraspecific phylogenetics. Mol Ecol Evol

16:37–48

Bibb MJ, Van Etten RA, Wright CT, Walberg MW, Clayton

DA (1981) Sequence and gene organization of mouse

mitochondrial DNA. Cell 2:167–80

Brown G, Gadaleta G, Pepe C, Saccone C, Sbisa E (1986)

Structural conservation and variation in the D-loop con-

taining region of vertebrate mitochondrial DNA. J Mol

Biol 192:503–511

Brown AHD, Marshall DR (1986) Evolutionary changes

accompanying colonization in plants. In: Scudder GCE,

Reveal JL (eds) Evolution today. Carnegie-Mellon

University, Pittsburgh, PA, 351–363

Carson HL 1987 Colonization and speciation In: Gray AJ,

Crawley MJ, Edwards PJ (eds) Colonization, succession

and stability Oxford, Blackwell Scientific Publications

Coronato A, Escobar JM, Mallea C, Roig C, Lizarralde MS

(2003) Geomophorlogy characteristics of mountain rivers

colonized by Castor canadensis in Tierra del Fuego,

Argentina. Ecologıa Austral 13:15–26

Doyzery E, Randi E (1997) The mitochondrial control region

of cervidae: evolutionary patterns and phylogenetic con-

tent. Mol Biol Evol 14(11):1154–1166

Ducroz JF, Stubbe M, Saveljev AP, Heidecke D, Samjaa R,

Ulevicius A, Stubbe A, Durka W (2005) Genetic variation

and population structure of the Eurasian beaver Castorfiber in eastern Europe and Asia based on mtDNA

sequences. J Mammal 86:1059–1067

Durka W, Babik W, Ducroz JF, Heidecke D, Rosell F, Samjaa R,

Saveljev AP, Stubbe A, Ulevicius A, Stubbe M (2005)

Mitochondrial phylogeography of the Eurasian beaver

Castor fiber L. Mol Ecol 14:3843–3856

Ellegren H, Hartman G, Johansson M, Anderson L (1993)

Major histocompatibility complex monomorphism and

low levels of DNA fingerprinting variability in a reintro-

duced and rapidly expanding population of beavers. Proc

Natl Acad Sci USA 90:8150–8153

Ellegren H, Johansson M, Hartman G, Anderson L (1994)

DNA fingerprinting with the human 33.6 minisatellite

Genetic structure of invasive beaver population in Tierra del Fuego

123

probe identifies sex in beavers Castor fiber. Mol Ecol

3:273–274

Excoffier L, Laval G., Schneider S (2006) Arlequin ver. 3.01:

an integrated software package for population genetics

data analysis. Evol Bioinform Online 1:47–50

Excoffier L (2004) Patterns of DNA sequence diversity and

genetic structure after a range expansion: lessons from the

infinite-island model. Mole Ecol 13(4):853–864

Felsenstein J (2004) PHYLIP – phylogeny inference package

version 3.6. Department of Genetics, University of

Washington, Seattle

Fu Y-X (1997) Statistical tests of neutrality of mutations

against population growth, hitchhiking and backgroud

selection. Genetics 147:915–925

Jaksic FM, Iriarte JA, Jimenez JE, Martinez DR (2002)

Invaders without frontiers: cross-borders invasion of

exotic mammals. Biol Invasions 4:157–173

Jenkins SH, Busher PE (1979) Castor canadensis. Mamm

Species 120:1–8

Kotcher TD, Thomas WK, Meyer A, Edwards SV, Paabo S,

Villablanca FX, Wilson AC (1989) Dynamics of mito-

chondrial DNA evolution in animals: amplification and

sequencing with conserved primers. Proc Natl Acad Sci

USA 86:6196–6200

Kuehn R, Shwad G, Shroeder W, Rottmann O (2000) Differ-

entiation of Castor fiber and Castor Canadensis by

noninvasive molecular methods. Zoo Biol 19:511–515

Lizarralde MS (1993) Current status of the introduced beaver

population in Tierra del Fuego (Argentina). AMBIO

22(6):351-358

Lizarralde MS (2006) Control of invasive beaver in Archi-

pelago of Tierra del Fuego. Paper presented at the

International Workshop on the beaver problem in the

Southern Cone, Wildlife Conservation Society, Punta

Arenas, Chile, 6–8 December 2006

Lizarralde MS, Escobar JM (2000) Exotic mammals in Tierra

del Fuego, Argentina, Ciencia Hoy 10(56):52–63

Lizarralde MS, Deferrari GA, Alvarez SE, Escobar JM (1996)

Nutrient dynamic alterations induced by beaver (Castorcanadensis) on the southern beech forest (Nothofagus).

Austral Ecol 6:101–105

Lizarralde MS, Escobar JM, Deferrari GA (2004) Invader

species of Argentina: a review about beaver (Castorcanadensis) population situation on Tierra del Fuego

ecosystem. Interciencia 29(7):352–356

Martinez Pastur G, Lencinas V, Escobar J, Quiroga P,

Malmierca L, Lizarralde MS (2006) Understory succes-

sion in areas of Nothofagus forests in Tierra del Fuego

(Argentina) affected by Castor canadensis. J Appl Vegetat

Sci 9:143–154

Matson CW, Baker RJ (2001) DNA sequence variation in the

mitochondrial control region of red-backed voles

(Clethrionomys). Mol Biol Evol 18:1494–1501

Matsuhashi TR, Masuda R, Mano T, Yoshida MC (1999)

Microevolution of the mitochondrial DNA control region

in the Japanese brown bear (Ursus arctos) populations.

Mol Biol Evol 16:676–684

Montgelard C, Bentz S, Tirard C, Verneau O, Catzeflis FM

(2002) Molecular systematics of Sciurognathi (Rodentia):

the mitochondrial cytochrome b and 12S rRNA genes

support the Anomaluroidea (Pedetidae and Anomaluri-

dae). Mol Phylogenet Evol 22:220–233

Milishnikov AN, Saveljev AP (2001) Genetic divergence and

similarity of introduced populations of European beaver

(Castor fiber L.1758) from Kirov and Novosibinsk oblasts

of Russia. Russ J Genet 37:108–111

Moorman MC (2007) The conservation implications of inva-

sive beaver and trout on native freshwater fish in the Cape

Horn Biosphere Reserve, Chile. M.S. Thesis. Department

of Earth, Atmosphere and Marine Sciences, North Caro-

lina State University. Major Advisor: Dr. David Eggleston

Moorman MC, Anderson CB, Gutiirrez AG, Charlin R, Rozzi

R (2006) Watershed conservation and aquatic benthic

macroinvertebrate diversity in the Alberto D’Agostini

National Park, Tierra del Fuego, Chile. Anales del Insti-

tuto de la Patagonia 34:41–58

Murphy WJ, Eizirik E, Johnson WE, Zhang YP, Ryder OA,

OBrien SG (2001) Molecular phylogenetics and the ori-

gins of placental mammals. Nature 409(6820):614–618

Nedbal MA, Honeycutt RL, Schlitter DA (1996) Higher level

systematics of rodents (Mammalia, Rodentia): evidence

from the mitochondrial 12SrRNA gene. J Mamm Evol

3(3):201–237

Nei M (1987) Molecular evolutionary genetics. Columbia

University Press, New York, NY, USA

Nei M (1975) Molecular population genetics and evolution.

Elsevier Ed. New York

Reyes A, Nevo E, Saccone C (2003) DNA sequence variation

in the mitochondrial control region of subterranean mole

rats, Spalax ehrenbergi superspecies, in Israel. Mol Biol

Evol 20:622–632

Roughgarden J (1979) Theory of population genetics and

evolutionary ecology. Macmillan, New York

Saccone C, Attimonelli M, Sbisa E (1987) Structural elements

highly preserved during the evolution of the D-loop

containing region in vertebrate mitochondrial DNA. J Mol

Evol 26:205–211

Sakai AK, Allendorf FW, Holt JS, Lodge DM, Molfsky J, With

KA, Baughman S, Cabin RJ, Cohen JE, Ellstrand NC,

McCauley DE, O’Neil P, Parker IM, Thompson JN,

Weller SG (2001) The population biology of invasive

species. Annu Rev Ecol Syst 32:305–332

Skewes O, Gonzalez F, Olave R, Avila A, Vargas V, Paulsen P,

Kvnig HE (2006) Abundance and distribution of Ameri-

can beaver, Castor canadensis (Kuhl 1820), in Tierra del

Fuego and Navarino islands, Chile. Eur J Wildl Res

52:292–296

Sambrock J, Fritsch EF, Maniatis T (1989) Molecular cloning,

a laboratory manual. Cold Spring Harbor Laboratory

Press, New Cork

Sbiza E, Tanzariello F, Reyes A, Pesole G, Saccone C (1997)

Mammalian mitochondrial D-loop region structural analysis:

identification of new conserved sequences and their func-

tional and evolutionary implications. Gene 205:125–140

Smith MF, Patton JL (1993) Variation in mitochondrial cyto-

chrome b sequence in natural populations of South

American akodontine rodents (Muridae Sigmodontinae).

Mol Biol Evol 8(1):85–103

M. S. Lizarralde et al.

123

Tajima F (1993) Measurement of DNA polymorphism In:

Takahata N, Clark AG (eds) Mechanisms of molecular

evolution. introduction to molecular paleopopulation

biology, Japan Scientific Societies Press, Sinauer Asso-

ciates Inc., Tokyo, Sunderland, MA, pp 37–59

Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W:

improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, positions-specific

gap penalties and weight matrix choice. Nucleic Acids

Res 22:4673–4680

Vila C, Amorin IR, Leonard JA (1999) Mitochondrial DNA

phylogeography and population history of the grey Wolf

Canis lupus. Mol Ecol 8:2089–2103

Wood NJ, Phua SH (1996) Variation in the control region

sequence of the sheep mitochondrial genome. Anim Genet

27:25–33

Wright S (1955) Classification of the factors of evolution. Cold

Spring Harb Symp Quant Biol 20:16–24

Genetic structure of invasive beaver population in Tierra del Fuego

123