A phosphoketolase Mpk1 of bacterial origin is adaptively required for full virulence in the...

A phosphoketolase Mpk1 of bacterial origin isadaptively required for full virulence in theinsect-pathogenic fungus Metarhizium anisopliaeemi_1961 2351..2360

Zhibing Duan, Yianfang Shang, Qiang Gao,Peng Zheng and Chengshu Wang*Institute of Plant Physiology and Ecology, ShanghaiInstitutes for Biological Sciences, Chinese Academy ofSciences, Shanghai 200032, China.

Summary

Pentose metabolism through the phosphoketolasepathway has been well characterized in bacteria. Inthis paper, we report the identification of a phospho-ketolase homologue Mpk1 in the insect-pathogenicfungus Metarhizium anisopliae. Phylogenetic analy-sis showed that fungal phosphoketolases are ofbacterial origin and diverged into two superfamilies.Frequent gene loss or lack of acquisition is evident inspecific fungal lineages or species. The mpk1 gene ishighly expressed when grown in trehalose-rich insecthaemolymph but poorly induced by insect cuticle orcarbohydrate-rich plant root exudate. In addition,mpk1 gene expression and enzyme activity could beupregulated by different sugars including xylose, tre-halose, glucose or sucrose. mpk1 null mutants gen-erated by homologous recombination grew similar tothe wild type of M. anisopliae on medium amendedwith xylose as a sole carbon source. However, insect(tobacco hornworm, Manduca sexta) bioassaysshowed significantly reduced virulence in Dmpk1.The results of this study suggest that the horizontallytransferred Mpk1 in M. anisopliae plays an importantniche adaptation role for fungal propagation in insecthaemocoel. Following the carbohydrate flux fromplants to plant-feeding insects and insect pathogenicfungi, a tritrophic relationship is discussed in asso-ciation with the requirement of fungal phosphoketo-lase pathway.

Introduction

The phosphoketolase pathway has been largely reportedin lactic acid bacteria and bifidobacteria for metabolization

of pentoses and hexoses (e.g. Meile et al., 2001; Post-huma et al., 2002). Until recently, a few studies havereported phosphoketolase pathway in filamentous fungi,Penicillium chrysogenum and Aspergillus nidulans(Thykaer and Nielsen, 2007; Panagiotou et al., 2007;2008; 2009). However, the pathway has been evident notpresent in yeast Saccharomyces cerevisiae (Sondereg-ger et al., 2004). Like numerous bacteria, filamentousfungi including plant pathogens and many saprophyticspecies that inhabit soils and can effectively consume liveplants or plant materials, which are abundant sources ofxylose-rich hemicelluloses. However, instead of xylose orglucose, the major blood sugar accumulated in plant-feeding insects is trehalose, e.g. up to more than 100 mMin tobacco hornworm Manduca sexta (Mullins, 1985;Thompson, 1999).

Insect fungi like Metarhizium anisopliae and Beauveriabassiana are being developed into promising biocontrolagents against various insect pests (de Faria and Wraight,2007; Wang and St Leger, 2007a). Fungal biocontrolagents infect hosts by penetration of the cuticle andgrowth in the insect haemocoel. To improve their cost-effective control efficacy, the mechanisms of fungalpathogenesis have to be explored. Previous efforts tounderstand the entomopathogenicity of M. anisopliaehave identified virulence genes functioning from surfaceadhesion (Wang and St Leger, 2007b), breaching of thecuticle (Wang and St Leger, 2007c), haemocoel osmoticpressure adaptation (Wang et al., 2008) and evasionof the insect immune responses (Wang and St Leger,2006). A case of horizontal gene transfer (HGT) of achymotrypsin-encoding gene from bacteria has also beenreported in M. anisopliae (Screen and St Leger, 2000). Inorder to respond to different ecological and physiologicalniches, insect pathogenic fungi have evolved ways ofmonitoring their immediate environments and upregulat-ing genes required for survival.

Our previous study identified a M. anisopliae transcript(CN808491) that was highly expressed (1.4% of totalsequenced clones) in insect haemolymph (Wang et al.,2005). A BLAST search revealed that it showed high simi-larity (E = 0) to bacterial xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (XpkA, EC 4.1.2.9, EC4.1.2.22). In this study, full sequence of the gene was

Received 15 March, 2009; accepted 4 May, 2009. *For corre-spondence. E-mail [email protected]; Tel. (+86) 21 5492 4157;Fax (+86) 21 5492 4015.

Environmental Microbiology (2009) 11(9), 2351–2360 doi:10.1111/j.1462-2920.2009.01961.x

© 2009 Society for Applied Microbiology and Blackwell Publishing Ltd

mailto:[email protected]

obtained and the gene designated as mpk1 (for Metarhi-zium phosphoketolase, GenBank accession: FJ790496).A survey of fungal genomic databases revealed a sto-chastic distribution of phosphoketolase homologues indifferent fungal lineages and phylogenetic analyses indi-cated that the most probable origin of mpk1 is bacterial.Gene deletion studies demonstrated that Mpk1 is adaptedto insect haemolymph and required for full virulence inM. anisopliae against insect host M. sexta.

Results

Protein structure

The full open reading frame of mpk1 encodes a proteinwith 820 amino acids and a theoretical molecular weightof 92.5 kDa (pI = 6.4). The protein does not contain asignal peptide. BLAST searches and motif scanningreveal that Metarhizium Mpk1 has a high similarity (E = 0)with bacterial xylulose-5-phosphate/fructose-6-phosphatephosphoketolases (XpkAs). Similar to bacterial XpkAs(e.g. Meile et al., 2001), the N-terminal of Mpk1 containsa typical thiamine pyrophosphate binding module(TPP_K, 99–325 aa) (Fig. 1A). Hydropathicity analysisindicated that Mpk1 protein contains multiple hydrophobicregions (Fig. 1B).

Bacterial origin of fungal phosphoketolase

A survey of 17 bacterial and 39 fungal phosphoketolasesestablished a phylogenetic tree where fungal proteinsbranched off into two groups, i.e. subfamily (SF) I andSF II (Fig. 2). Fungal SF I proteins which include Mpk1were first grouped with bacterial phosphoketolases(AAU92125, BAC08738 and BAA18808) with a highsupport value (99% of 1000 bootstrap replicates), impli-cating bacterial origin of this fungal phosphoketolases.The paralogues grouped into SF II clade, however,

diverged from the bacterial and SF I clade (Fig. 2).Average length of the fungal SF I is larger in size (c.21 aa) than bacterial phosphoketolases while the proteinsof fungal SF II group are, on average, smaller and withgreater size variation (779.95 � 86.83) ranging from529 aa (XP_001219335, Chaetomium globosum) to893 aa (XP_759561, Ustilago maydis) (Table 1).

Codon usage bias is an indicator of the forces drivinggene or genome evolution (Carbone et al., 2003). Tofurther verify a bacterial origin of fungal phosphoketo-lases, codon adaptation indices (CAIs) were calculated byreferencing against Escherichia coli and S. cerevisiaewhole genome gene sets. The results indicated that theCAIs of fungal SF I and SF II proteins calculated via abacterium gene set were much higher (> 2-fold) thanagainst a yeast gene reference, and it also correlated withGC content that similar to a high level of GC contentin bacterial phosphoketolases (55.76%), fungal SF I(53.65%) and SF II (51.76%) protein genes contain > 50%GC (Table 1). These analyses strongly suggest a bacterialorigin of fungal phosphoketolases.

A fungal phylogenetic tree was established using 13conserved proteins. The branched clades of asco-mycetes, basidiomycetes, chytrid, zygomycetes andmicrosporidia were supported by high bootstrap values(Fig. 3). Frequent loss or lack of acquisition of phospho-ketolases in different fungal species or lineages wasobserved (Fig. 3). Most fungal species do not have a SFI gene. Of all examined fungal species, however, only theascomycetous wheat pathogen, Phaeosphaeria nodorumdoes not contain a SF II phosphoketolase gene. Interest-ingly in the aspergilli, the homologue of SF I phosphoke-tolases is absent in Aspergillus nidulans but present inother species (A. terreus, A. oryzae, A. niger, A. fumiga-tus and A. clavatus). Complete losses or lacks of acqui-sition of phosphoketolase are verified in the subphylum ofSaccharomycotina (S. cerevisiae and Candida albicans)

Fig. 1. Protein structure and characteristics.A. Schematic map of Mpk1. TPP_K(99–325 aa), thiamine pyrophosphate (TPP)family, phosphoketolase (PK) subfamily,TPP-binding module; XFP_N, XFP(xylulose-5-phosphate/fructose-6-phosphate)phosphoketolase N-terminal domain(21–399 aa); XFP, phosphoketolase domain(411–590 aa); XFP_C, XFP C-terminal domain(601–802 aa). Numbers in parenthesis showE-values for corresponding domains.B. Hydropathicity analysis of Mpk1, scaled bythe algorithm of Kyte and Doolittle.

2352 Z. Duan et al.

© 2009 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 11, 2351–2360

Fig. 2. Phylogenetic analysis of bacterial and fungal phosphoketolases. Relationships are inferred from Neighbor joining analysis and thebootstrap values > 50% from 1000 replicates are shown as numbers at each supported branch. The accession numbers of the sequences areshown along with the names of fungal species. *, indicates that a single copy of phosphoketolase gene is present in the given fungal genome.

Metarhizium anisopliae phosphoketolase 2353


and the phyla of Chytridiomycota (Batrachochytrium den-drobatidis), Zygomycota (Rhizopus oryzae and Phycomy-ces blakesleeanus) and Microsporida (Encephalitozooncuniculi). Of the examined basidiomycetes, a completeloss was observed in the symbiotic mushroom Laccariabicolor (Fig. 3). Given that fungal phosphoketolases are ofbacterial origin, one can assume that gene evolution is notcongruent with fungal speciation. To test this, a partitionhomogeneity test was conducted and significantly hetero-geneous relationships were verified for the pairing treetopologies, i.e. between fungal speciation and SF Iphosphoketolase tree (P = 0.001) and between fungal

speciation and SF II tree (P = 0.001) respectively.Thus, an HGT event was further evident for fungalphosphoketolases.

Gene expression profiling

Metarhizium anisopliae was grown in various media tostudy the induction of mpk1. Consistent with our previousEST study (Wang et al., 2005), RT-PCR analysis demon-strated a strong expression of mpk1 when the fungus wasgrown in insect haemolymph but not in nutrient-poormedia or on insect cuticle. Metarhizium anisopliae is afacultative pathogen that can not only infect insects butalso demonstrate plant root rhizosphere competence(Hu and St Leger, 2002; St Leger, 2008). However, thebean root exudate failed to induce the expression of mpk1(Fig. 4A). A time-course study showed that mpk1 tran-scripts accumulated to a high level 4 h post inoculation ofthe fungus in insect haemolymph (Fig. 4B). Phosphoke-tolase has been largely reported function in pentosecatabolism (e.g. Sonderegger et al., 2004). The inductionwith different sugars indicated that the transcription ofmpk1 could be upregulated by xylose, hexose sugars(glucose and galactose) or disaccharides (sucrose andtrehalose) but not by mannitol, sorbose or sorbitol(Fig. 4C).

Mpk1 gene deletion and enzyme activity assay

Mpk1 null mutants were generated by homologousreplacement (Fig. 5A) and verified by PCR (Fig. 5B) andRT-PCR (Fig. 5C). Colony phenotypes were similarbetween the wild type and mutant when grown on potatodextrose agar or on minimal medium supplemented with1% xylose for up to 7 days (Fig. 5D). Both the wild typeand Dmpk1 produced conidia with equal facility on testedmedia. To investigate physiological alterations, enzymeactivities were assayed in parallel for the wild type andmutants. Under five induction conditions, the wild-typefungus had highest enzymatic activity in 1% trehalosemedium, c. 1.5-fold higher than that in 1% xylose(Fig. 4D). The enzyme activity was comparatively lowerwhen the fungus was grown in insect haemolymph(Fig. 4D), largely because of the increase of total protein

Table 1. Characteristics of bacterial and fungal phosphoketolase proteins and genes.

Group Numbers Average protein Length (aa � SD) (G + C)% CAIE CAIS

Bacteria 17 798 � 10.72 55.76 � 8.59 0.25 � 0.05 0.07 � 0.04Fungal SF I 16 820.1 � 8.16 53.65 � 3.96 0.25 � 0.03 0.12 � 0.02Fungal SF II 23 789.61 � 84.32 51.76 � 4.97 0.24 � 0.03 0.11 � 0.03

CAIE, codon adaptation index estimated using Escherichia coli whole genome gene sets as reference; CAIS, codon adaptation index estimatedusing Saccharomyces cerevisiae gene sets as reference.

Fig. 3. Phylogenetic analysis of fungal species. *, indicating theloss of fungal superfamily I phosphoketolase; **, indicating the lossof superfamily II phosphoketolase. Dash line shows a completeloss of phosphoketolase in the corresponding fungal species orlineage.

2354 Z. Duan et al.


constituents (c. > 2-fold when compared with the proteinamounts produced by the fungus grown in artificial media,data not shown). The deletion of mpk1 in M. anisopliaeresulted in a sharply reduced enzyme activity under allexamined conditions, i.e. > 2-fold reduction in trehalosemedium and > 4-fold in insect haemolymph. The data

imply that like other fungi (Fig. 2), the M. anisopliaegenome contains a SFII paralogous gene of mpk1 whichcould be induced with glucose (Fig. 4D).

mpk1 required for fungal full virulence

To study whether Mpk1 is required by the fungus for fullvirulence against insect hosts, the wild type and mutantswere bioassay against the fifth instar larvae of M. sexta.The results revealed a significant reduction of mortalityand speed of kill by Dmpk1 as compared with the wildtype. The mutant achieved c. 50% mortality but the wildtype killed more 95% insects before they pupated (Fig. 6).In addition, in comparison with the wild type (medianlethal time LT50 = 4.3 � 0.18), Dmpk1 took significantlonger time (LT50 = 5.8 � 0.36) to reach 50% mortality(c2 = 6.14, P = 0.013), indicating that Mpk1 is required bythe fungus to function fully as an insect pathogen.

Discussion

Filamentous fungi are prominent consumers of xylose,thus show promising commercial potential for bioenergyproduction from abundant reproducible plant materials(Panagiotou et al., 2008). Bacterial pentose catabolismthrough the phosphoketolase pathway has been wellstudied (e.g. reviewed by Zaunmuller et al., 2006), butthere is a paucity of information reporting fungal phospho-ketolase. Here, we identified a phosphoketolase Mpk1 inan insect-pathogenic fungus, M. anisopliae and provideevidence that the gene was horizontally transferred from abacterium and physiologically adapted for fungal viru-lence against insect hosts.

Horizontal gene transfer (also known as lateral genetransfer) plays an important role in genome evolution andhas been reported to occur from prokaryote to eukaryote,from eukaryote to eukaryote or from eukaryote to prokary-ote (reviewed by Keeling and Palmer, 2008). In fungi,HGT events could be substantive, for example inaspergilli, the A. oryzae genome is > 20% larger than thatof A. nidulans and > 30% larger than that of A. fumigatus(Galagan et al., 2005). Approximately one-third of thatadditional genome in A. oryzae has been horizontallytransferred from Sordariomycete species (Khaldi andWolfe, 2008). In insect-pathogenic fungus M. anisopliae,a chymotrypsin gene was first reported to be of bacterialorigin and involve in digestion of insect cuticle (Screenand St Leger, 2000). In this study, the mpk1 was evidentto be horizontally transferred from bacteria and contributeto sugar metabolism when the fungus was grown in insectblood. Providing that the insect fungi like M. anisopliaeshow complex life styles in nature (Wang et al., 2005),more HGT events could be expected to have occurred infungal evolutionary history.

Fig. 4. Gene expression and enzyme activity assays.A. RT-PCR analysis of mpk1 expression by the wild-typeMetarhizium anisopliae transferred from Sabouraud dextrose broth(SDB) cultures to water, minimum medium (MM), 0.1% bean rootexudates (RE), 1% Manduca sexta larval cuticle (Cut) or cell freehaemolymph (HE) for 6 h.B. Time-course study of mpk1 expression in M. sexta haemolymphfor different time as indicated.C. RT-PCR analysis after growing the fungus in MM supplementedwith 1% (w/v) of different sugars: Glu, glucose; Mal, maltose; Man,mannitol; Sor, sorbitol; Suc, sucrose; Sob, sorbose; Raf, raffinose;Gal, galactose; Tre, Trehalose; Xyl, xylose.D. Phosphoketolase activity of the wild type (WT) and mpk1 nullmutant cultured in different media. Glu, the minimum mediumsupplemented with 1% glucose; Tre, MM + 1% trehalose; Xyl,MM + 1% xylose; Hem, insect haemolymph. **, t-test differencelevel at P < 0.01 between the WT and mutant for each treatment;*, t-test difference level at P < 0.05. The letters in the same colourcolumns represent the difference at a = 0.01 level tested by DucanANOVA analysis for WT (black) and Dmpk1 (white) respectively. Thesame letter means there is no significant difference betweentreatments.



Fungal phosphoketolases of probable bacterial originshow a patchy distribution pattern in fungal lineages andare evolutionarily divergent into two superfamilies(Fig. 2). Horizontal gene transfer and subsequentlineage-specific gene loss and duplication frequentlyoccur as tightly linked phenomena and, in some cases,difficult to distinguish from each other (Keeling andPalmer, 2008). Our reconstruction of the fungal phyloge-

netic tree with 13 conserved proteins is generally con-gruent with previous fungal speciation studies (e.g.James et al., 2006). For example, the tree is rooted bymicrosporida and A. nidulans is an early divergentspecies in the aspergilli lineage (Fig. 3). Thus, the well-supported tree is helpful for tracing gene transfer, loss orduplication events. The absence of phosphoketolase inthe phyla of Microsporida, Chytridiomycota and Zygomy-cota could be suggestive that fungal acquisition ofbacterial phosphoketolase had occurred before the diver-gence of basidiomycetes. Supporting this speculation,the phosphoketolase gene is also absent in the genomesof oomycetes Phytophthora sojae and P. ramorum, nowclassified as protists (data not shown). The absence ofan Mpk1 orthologue or paralogue in Saccharomycotina(including C. albicans and S. cerevisiae) and in thebasidiomycete Laccaria bicolor could be a loss-after-gainevent. Fungal SF II phosphoketolase could have possiblyarisen from earlier acquired SF I gene by duplication.Intriguingly, this may demonstrate a biased distributionbecause most of the examined fungal species onlycontain a SF II paralogue. This is especially true in theaspergilli where A. nidulans only contains an SF II phos-phoketolase but its closely related species have both(Figs 2 and 3), further supporting the gain-and-losshypothesis of fungal phosphoketolases.

Fig. 5. Gene deletion and fungal growthtests.A. Schematic map for mpk1 gene knock out.B. PCR verification of gene deletion.C. RT-PCR verification of gene deletion.D. Inoculation of the wild type (WT) andDmpk1 on potato dextrose agar (PDA, left)and minimum medium (MM, right) amendedwith 1% xylose for 7 days. WT, wild type; PL,plasmid for gene deletion shown in A; Bar,1 cm.

Fig. 6. The survival of Manduca sexta larvae after infection withthe wild type (WT) or Dmpk1 conidia. The insects were immersedin 2 ¥ 107 conidia ml-1 suspensions of WT or Dmpk1 strains, controlinsects were treated in water.

2356 Z. Duan et al.


Reflecting differences between fungal and bacterialphosphoketolases, Mpk1 transcription was induced withglucose in M. anisopliae (Fig. 4D) while bacterial XpkAexpression was repressed by glucose (Posthuma et al.,2002). The phosphoketolase pathway was also activatedby glucose in A. nidulans and overexpression of a phos-phoketolase (XP_662517, included in the phylogeneticanalysis in this study) resulted in pleiotropic effectswhere more than 1000 gene transcripts were altered.The authors concluded from their transcriptome analysisthat A. nidulans is not evolutionarily adapted for growthon xylose, glycerol and ethanol (Panagiotou et al., 2008).We found that XP_662517 is the sole SF II phosphoke-tolase in A. nidulans. Our phylogenetic and enzymeactivity analyses suggest that M. anisopliae contains aSF II paralogue. When mpk1 (SF I) was deleted inM. anisopliae, the wild-type as well as the mutant couldgrow on xylose medium but more poorly than they did onpotato dextrose agar (Fig. 1D), a similar observation asshown in A. nidulans (Panagiotou et al., 2008). To installa phosphoketolase pathway for anaerobic reoxidationof the cofactor NADH in yeast by engineering with abifidobacterium phosphoketolase enabled S. cerevisiaeto ferment xylose for ethanol production (Sondereggeret al., 2004).

Horizontal gene transfer is essential for niche adapta-tion by different organisms (Keeling and Palmer, 2008).Requirement of an HGT gene (or gene cluster) has beenreported in various fungi for the synthesis of secondarymetabolites or for pathogenicity (e.g. Walton, 2000; vander Does et al., 2008). Our insect bioassay results indi-cated that Mpk1 is a necessary constituent for insectvirulence in M. anisopliae. It is postulated that Mpk1 isessential for a tritrophic relationship which includesplants, plant-feeding insects and insect pathogenic fungi.Plant cell walls contain pentose-rich hemicellulose,mainly in the form of xylan. Plant-feeding insectsconsume live plants or dead plant remains to accumu-late blood sugars, mainly the trehalose (Thompson,1999). Insects achieve this with the assistance of sym-biotic gut microbes (bacteria and yeasts) which hydrol-yse xylan into xylose for further catabolism intotrehalose through a pentose phosphate pathway andfinally assimilated into insect blood (Suh et al., 2003;Nguyen et al., 2006). In insect fat body or haemolymph,synthesis of trehalose can be additionally achievedeither from ingested amino acids or stored glycogen(Becker et al., 1996; Thompson and Borchardt, 2003;Thompson et al., 2003). When insects infected by patho-genic fungi, available blood glucose would be firstdeprived by fungal hyphae and thus, insect trehalaseswill be activated to catalyse the trehalose into two mol-ecules of glucose to maintain the homeostasis (Beckeret al., 1996). In M. anisopliae, the neutral or acid tre-

halases have been cloned and demonstrated to showtrehalose-hydrolysing activities (Xia et al., 2002; Zhaoet al., 2006). However, our massive survey of transcriptsexpressed by M. anisopliae grown in insect blood failedto identify any trehalase gene but the highly expressedphosphoketolase (Wang et al., 2005). This wouldsuggest that M. anisopliae utilize either available insectblood pentoses or fructose-6-phosphate probablyisomerized from glucose-6-phosphate by activation ofphosphoketolase pathway. The upregulation of Mpk1 bythe fungus in insect blood could be additionally deter-mined by the poor oxygen level in the specific niche,insect haemocoel. After breaching insect cuticle, patho-genic fungi switch from filamentous growth to yeast-typebudding in haemocoel, a strategy for quick occupationand colonization of insect body (Kershaw et al., 1999;Wang and St Leger, 2006). Thus, the soluble oxygen ininsect blood would be competitively consumed by thefungi and hosts. To maintain redox balance, the fungilike M. anisopliae would turn on the phosphoketolasepathway for anaerobic reoxidation of NADH, the strategysimilarly employed to engineer yeast for pentose catabo-lism (Sonderegger et al., 2004).

In conclusion, we found that fungal phosphoketolase isof bacterial origin and the gene has diverged into twosuperfamilies by showing patchy distribution in fungal lin-eages or species. Further studies are still required toelucidate the irregular distribution of fungal phosphoketo-lase and to well establish the regulation mechanism offungal pentose metabolization pathway, which are nowshowing great potential for bioethanol production fromabundant plant materials. The bacterial phosphoketolasescan catabolize either xylulose-5-phosphate or fructose-6-phosphate; therefore, the substrate preferences of fungalSF I and SF II phosphoketolases are needed to be verifiedfor high efficient fermentation of pentoses. For insectfungi, in particular, further experiments including to feedinsects with radiolabelled xylan are needed to help eluci-date the carbon (sugar) fluxes from plants to plant-feedinginsects and then to insect pathogenic fungi. The exactfactor(s), e.g. the types of sugars and or the oxygen levelin insect blood, involved to trigger the phosphoketolasepathway also remain to be determined to better under-stand fungal propagation in insect haemocoel and thusthe virulence.

Experimental procedures

Gene cloning and deletion

In order to study the evolutionary history and potential func-tion of Mpk1, the full cDNA sequence was acquired by primerwalking. To determine the contributions of Mpk1 to fungalvirulence, we deleted mpk1 through homologous replace-ment following the procedure described before (Wang and



St Leger, 2006; 2007c). Briefly, the 5′ and 3′ regions of thetarget mpk1 gene were amplified using the primer pairsMpk1U (GACTAGT GTCCCCGAATGCCAATTTCT, 4) andMpk1L (GACTAGT TTCGATTCCGTTTCGTCTGG, 1533)and Mpk2U (ATTTGCGGCCGC CTTCGAGGAAGACGCCAATG, 1585) and Mpk2L (ATTTGCGGCCGC TGCCACCTTGCAACGTATTG, 2753) respectively. The restriction sites ofSpeI and NotI (underlined) were introduced and the digestedfragments were ligated into the plasmid pGPS3Bar using twosteps subcloning to generate the gene deletion cassettepBarMpk1 (Fig. 5A) for protoplast transformation (Wang andSt Leger, 2006). Complete deletion mutants were confirmedby PCR and RT-PCR respectively.

Phylogenetic analysis

BLAST search first identified that Mpk1 showed high similari-ties with bacterial phosphoketolases. To infer the evolutionaryhistory of Mpk1, the phosphoketolases from bacteria andfungi were retrieved from GenBank and aligned with Clustal X2.0. A bootstapped (1000 replicates) Neighbor-Joining (NJ)tree was constructed using pairwise deletion of alignmentgaps and a substitution model of Poisson correction with theprogram MEGA 4.0 (Tamura et al., 2007).

To construct fungal phylogenetic tree, 13 conserved pro-teins from M. anisopliae were selected for BLASTP searchesagainst GenBank, Broad Institute fungal genomic databaseand DOE Joint Genome Institute database. These includedthe adenylate cyclase (CAB64345), cAMP-dependentprotein kinase catalytic subunit (PKA, AAD17221), MAP1mitogen-activated protein kinase (AAP93199), recQ familyhelicase (AAL13172), neutral trehalase (CAC17620), trans-lation elongation factor 1 alpha(AAR16425), and thoseidentified in this study of TH14-3-3 (DQ393573), G proteinbeta subunit (DQ393574), a tubulin (DQ393576), b tubulin(DQ393577), polyubiquitin (DQ393578), HSP70(DQ393579) and HSP90 (DQ393580). The match with thehighest E-value for each fungal species were selected forsequence alignments using Clustal X and the concatenatedamino acid sequences (11 725 amino acid residues in total)were used for bootstrapped (1000 replicates) NJ phyloge-netic reconstruction with the program MEGA 4.0 (Tamuraet al., 2007).

A Partition homogeneity test was also conducted toexamine the topological congruence between the phospho-ketolase protein phylogenetic tree and fungal speciation treeusing PAUP (v4.0 b10a; Swofford, 2001).

Analysis of codon usage bias

In addition to the phylogenetic congruence analysis, the G +C content and CAI are also used to support the gene hori-zontal transfer hypothesis (Ochman et al., 2005). To conductthese analyses, the coding nucleotide sequences of fungaland representative bacterial phosphoketolase genes wereextracted from the databases. The CAI was calculated usinga CAI Calculator 2 (Wu et al., 2005). The whole genome genesets of E. coli (4289 CDs) and S. cerevvisiae (6305 CDs)were used as bacterial and fungal codon references respec-tively. The CAI values vary from 0 to 1.0, the higher the value,

the more similar the codon usage bias is to the referencegenes (Carbone et al., 2003).

Gene expression and enzyme activity analysis

To determine the inductive effects of different growth condi-tions, fungal cultures were harvested 36 h post incubation inSabouraud dextrose broth (SDB, Difco), washed twice andequal amounts (0.2 g wet weight) of mycelia inoculated into10 ml of minimal medium (NaNO3 6 g l-1, KCl 0.52 g l-1,MgSO4.7H2O 0.52 g l-1, KH2PO4 0.25 g l-1), SDB, sterilewater, 0.1% bean root exudates, 1% locust cuticle or M. sextahaemolymph for 6 h (Wang and St Leger, 2006). The rootexudates, locust cuticle and M. sexta haemolymph were pre-pared as described (Wang et al., 2005). To determine theinduction effects by different sugars, the minimal mediumwas amended with 1% (w/v) of pentose (D-xylose), hexoses(glucose and b-galactose), ketoses (sorbose), disaccharides(trehalose, sucrose and maltose), trisaccharide (raffinose),mannitol and sorbitol (all from Sigma) to grow the 36 h SDBfungal mycelia for another 6 h. The RNA was extracted usinga Qiagen RNeasy Plant Mini Kit plus the treatment withDNase I and 1 mg was converted into single strand cDNAusing an anchored oligo-dT primer (ABgene). RT-PCR wasconduced using the primer pairs MpkF (GGCTGGGAGCCCTTCTTTGT) and MpkR (CCACCATTGGCGTCTTCCTC).

Enzyme activity was assayed by using the substratefructose-6-phosphate based on the production of acetatefrom acetyl-phosphate by reaction with phosphoketolase(Sanchez et al., 2004). Both the wild type and Dmpk1 mutantwere grown in SDB for 36 h and the mycelia were collectedand washed twice with the sterile distilled water. Equalamounts (0.2 g wet weight) of mycelia were transferred into10 ml of SDB, insect haemolymph and the minimal mediumamended with 1% (w/v) of glucose, trehalose and xyloserespectively. After incubation at 25°C, 200 r.p.m. for 12 h, thecultures were collected and homogenized with a Fastprep-24system (MP Biomedicals) in 500 ml of cell lysis buffer contain-ing 50 mM histidine-HCl, 20 mM KH2PO4-Na2HPO4, 2 mMdithiothreitol and 1 mM MgSO4 (pH 7.0) (Sonderegger et al.,2004). The tubes were centrifuged at 20 000 g and 4°C for5 min and the supernatants were alloquated and used forenzyme activity assay and protein quantification respectively.A standard curve was generated with a series of acetylphosphate. Specific activity was expressed as units per mgprotein, where 1 U was defined as the formation of 1 nmol ofacetate per min (Sanchez et al., 2004).

Insect bioassays

To test the effect of mpk1 on fungal virulence, insect bioas-says were conducted using conidia of the wild type andmutants against the newly emerged fifth instar larvae ofM. sexta (Wang and St Leger, 2006). Conidia were appliedtopically by immersing larvae for 20 s in an aqueous suspen-sion containing 2 ¥ 107 conidia ml-1. Each treatment hadthree replicates with 10 insects each and the experimentswere repeated twice. Mortality was recorded every 12 h. Themedian lethal time (LT50) was estimated and compared usingKaplan-Meier analysis with the program SPSS (Ver. 13.0)(Wang and St Leger, 2007a).

2358 Z. Duan et al.


Acknowledgements

The work was supported by the National Basic ResearchProgram of China (2009CB118904), the Knowledge Innova-tion Program of the Chinese Academy of Sciences (KSCX2-YW-G-037) and the program from Science and TechnologyCommission of Shanghai Municipality (07PJ14101). Theauthors also highly appreciate Prof Michael Bidochka forcritical reading of this paper.

References

Becker, A., Schlöder, P., Steele, J.E., and Wegener, G.(1996) The regulation of trehalose metabolism in insects.Experientia 52: 433–439.

Carbone, A., Zinovyev, A., and Kepes, F. (2003) Codonadaptation index as a measure of dominating codon bias.Bioinformatics 19: 2005–2015.

van der Does, H.C., Lievens, B., Claes, L., Houterman, P.M.,Cornelissen, B.J., and Rep, M. (2008) The presence of avirulence locus discriminates Fusarium oxysporum isolatescausing tomato wilt from other isolates. Environ Microbiol10: 1475–1485.

de Faria, M.R., and Wraight, S.P. (2007) Mycoinsecticidesand Mycoacaricides: a comprehensive list with worldwidecoverage and international classification of formulationtypes. Biol Control 43: 237–256.

Galagan, J.E., Calvo, S.E., Cuomo, C., Ma, L.J., Wortman,J.R., Batzoglou, S., et al. (2005) Sequencing of Aspergillusnidulans and comparative analysis with A. fumigatus andA. oryzae. Nature 438: 1105–1115.

Hu, G., and St Leger, R.J. (2002) Field studies using arecombinant mycoinsecticide (Metarhizium anisopliae)reveal that it is rhizosphere competent. Appl Environ Micro-biol 68: 6383–6387.

James, T.Y., Kauff, F., Schoch, C.L., Matheny, P.B., Hofstet-ter, V., Cox, C.J., et al. (2006) Reconstructing the earlyevolution of fungi using a six-gene phylogeny. Nature 443:818–822.

Keeling, P.J., and Palmer, J.D. (2008) Horizontal gene trans-fer in eukaryotic evolution. Nat Rev Genet 9: 605–618.

Kershaw, M.J., Moorhouse, E.R., Bateman, R., Reynolds,S.E., and Charnley, A.K. (1999) The role of destruxins inthe pathogenicity of Metarhizium anisopliae for threespecies of insect. J Invertebr Pathol 74: 213–223.

Khaldi, N., and Wolfe, K.H. (2008) Elusive origins of the extragenes in Aspergillus oryzae. PLoS ONE 3: e3036.

Meile, L., Rohr, L.M., Geissmann, T.A., Herensperger, M.,and Teuber, M. (2001) Characterization of the D-xylulose5-phosphate/D-fructose 6-phosphate phosphoketolasegene (xfp) from Bifidobacterium lactis. J Bacteriol 183:2929–2936.

Mullins, D.E. (1985) Chemistry and physiology of thehemolymph. In Comparative Physiology, Biochemistry andPharmacology, Vol. 3. Kerkut, G.A., and Gilbert, L.I. (eds).New York: Pergamon, pp. 355–400.

Nguyen, N.H., Suh, S.O., Marshall, C.J., and Blackwell, M.(2006) Morphological and ecological similarities: wood-boring beetles associated with novel xylose-fermentingyeasts, Spathaspora passalidarum gen. sp. nov. andCandida jeffriesii sp. nov. Mycol Res 110: 1232–1241.

Ochman, H., Lerat, E., and Daubin, V. (2005) Examiningbacterial species under the specter of gene transfer andexchange. Proc Natl Acad Sci USA 102: 6595–6599.

Panagiotou, G., Kouskoumvekaki, I., Jonsdottir, S.O., andOlsson, L. (2007) Monitoring novel metabolic pathwaysusing metabolomics and machine learning: induction of thephosphoketolase pathway in Aspergillus nidulans cultiva-tions. Metabolomics 3: 503–516.

Panagiotou, G., Andersen, M.R., Grotkjaer, T., Regueira,T.B., Hofmann, G., Nielsen, J., and Olsson, L. (2008)Systems analysis unfolds the relationship between thephosphoketolase pathway and growth in Aspergillus nidu-lans. PLoS ONE 3: e3847.

Panagiotou, G., Andersen, M.R., Grotkjaer, T., Regueira,T.B., Hofmann, G., Nielsen, J., and Olsson, L. (2009)Studies on the production of fungal polyketides in Aspergil-lus nidulans using systems biology tools. Appl EnvironMicrobiol 75: 2212–2220.

Posthuma, C.C., Bader, R., Engelmann, R., Postma, P.W.,Hengstenberg, W., and Pouwels, P.H. (2002) Expressionof the xylulose 5-phosphate phosphoketolase gene, xpkA,from Lactobacillus pentosus MD363 is induced by sugarsthat are fermented via the phosphoketolase pathway and isrepressed by glucose mediated by CcpA and the mannosephosphoenolpyruvate phosphotransferase system. ApplEnviron Microbiol 68: 831–837.

Sanchez, B., Noriega, L., Ruas-Madiedo, P., de losReyes-Gavilán, C.G., and Margolles, A. (2004) Acquiredresistance to bile increases fructose-6-phosphatephosphoketolase activity in Bifidobacterium. FEMS Micro-biol Lett 235: 35–341.

Screen, S.E., and St Leger, R.J. (2000) Cloning, expression,and substrate specificity of a fungal chymotrypsin.Evidence for lateral gene transfer from an actinomycetebacterium. J Biol Chem 275: 6689–6694.

Sonderegger, M., Schümperli, M., and Sauer, U. (2004)Metabolic engineering of a phosphoketolase pathway forpentose catabolism in Saccharomyces cerevisiae. ApplEnviron Microbiol 70: 2892–2897.

St Leger, R.J. (2008) Studies on adaptations of Metarhiziumanisopliae to life in the soil. J Invertebr Pathol 98: 271–276.

Suh, S.O., Marshall, C.J., McHugh, J.V., and Blackwell, M.(2003) Wood ingestion by passalid beetles in the presenceof xylose-fermenting gut yeasts. Mol Ecol 12: 3137–3145.

Swofford, D. (2001) PAUP (Phylogenetic Analysis Using Par-simony) V.4.0 B8a. Sunderland, MA: Sinauer.

Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007) Mega4:Molecular Evolutionary Genetics Analysis (MEGA) Soft-ware Version 4.0. Mol Biol Evol 24: 1596–1599.

Thompson, S.N. (1999) Blood sugar formation from dietarycarbohydrate is facilitated by the pentose phosphatepathway in an insect Manduca sexta Linnaeus. BiochimBiophys Acta 1472: 565–575.

Thompson, S.N., and Borchardt, D.B. (2003) Glucogenicblood sugar formation in an insect Manduca sexta L. asym-metric synthesis of trehalose from 13C enriched pyruvate.Comp Biochem Physiol B Biochem Mol Biol 135: 461–471.

Thompson, S.N., Borchardt, D.B., and Wang, L.W. (2003)Dietary nutrient levels regulate protein and carbohydrateintake, gluconeogenic/glycolytic flux and blood trehalose



level in the insect Manduca sexta L. J Comp Physiol [B]173: 149–163.

Thykaer, J., and Nielsen, J. (2007) Evidence, through C13-labelling analysis, of phosphoketolase activity in fungi.Proc Biochem 42: 1050–1055.

Walton, J.D. (2000) Horizontal gene transfer and the evolu-tion of secondary metabolite gene clusters in fungi: anhypothesis. Fungal Genet Biol 30: 167–171.

Wang, C.S., and St Leger, R.J. (2006) A collagenous protec-tive coat enables Metarhizium anisopliae to evade insectimmune responses. Proc Natl Acad Sci USA 103: 6647–6652.

Wang, C.S., and St Leger, R.J. (2007a) A scorpion neurotoxinincreases the potency of a fungal insecticide. Nat Biotech-nol 25: 1455–1456.

Wang, C.S., and St Leger, R.J. (2007b) The MAD1 adhesin ofMetarhizium anisopliae links adhesion with blastosporeproduction and virulence to insects, and the MAD2 adhesinenables attachment to plants. Eukaryot Cell 6: 808–816.

Wang, C.S., and St Leger, R.J. (2007c) The Metarhiziumanisopliae perilipin homolog MPL1 regulates lipid metabo-lism, appressorial turgor pressure, and virulence. J BiolChem 282: 21110–21115.

Wang, C.S., Hu, G., and St Leger, R.J. (2005) Differentialgene expression by Metarhizium anisopliae growing in root

exudate and host (Manduca sexta) cuticle or hemolymphreveals mechanisms of physiological adaptation. FungalGenet Biol 42: 704–718.

Wang, C.S., Duan, Z.B., and St Leger, R.J. (2008) MOS1osmosensor of Metarhizium anisopliae is required foradaptation to insect host hemolymph. Eukaryot Cell 7:302–309.

Wu, G., Culley, D.E., and Zhang, W. (2005) Predicted highlyexpressed genes in the genomes of Streptomyces coeli-color and Streptomyces avermitilis and the implications fortheir metabolism. Microbiology 151: 2175–2187.

Xia, Y.X., Gao, M., Clarkson, J., and Charnley, A. (2002)Molecular cloning, characterisation, and expression ofa neutral trehalase from the insect pathogenic fungusMetarhizium anisopliae. J Invertebr Pathol 80: 127–137.

Zaunmuller, T., Eichert, M., Richter, H., and Unden, G. (2006)Variations in the energy metabolism of biotechnologicallyrelevant heterofermentative lactic acid bacteria duringgrowth on sugars and organic acids. Appl Microbiol Bio-technol 72: 421–429.

Zhao, H., Charnley, A.K., Wang, Z., Yin, Y., Li, Z., Li, Y., et al.(2006) Identification of an extracellular acid trehalase andits gene involved in fungal pathogenesis of Metariziumanisopliae. J Biochem 140: 319–327.

2360 Z. Duan et al.


A phosphoketolase Mpk1 of bacterial origin is adaptively required for full virulence in the...

Documents

Transcript of A phosphoketolase Mpk1 of bacterial origin is adaptively required for full virulence in the...