Fungal Genetics and Biology 45 (2008) 1265–1276

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier .com/locate /yfgbi

A CRY-DASH-type photolyase/cryptochrome from Sclerotinia sclerotiorummediates minor UV-A-specific effects on development

Selvakumar Veluchamy, Jeffrey A. Rollins *

Department of Plant Pathology, University of Florida, 1453 Fifield Hall, Gainesville, FL 32611-0680, USA

a r t i c l e i n f o a b s t r a c t

Article history:Received 5 March 2008Accepted 9 June 2008Available online 27 June 2008

Keywords:CRY-DASHDevelopmentPhotomorphogenesisPhotolyaseSclerotinia sclerotiorumUV-ACryptochromeFungusPathogenApothecium

1087-1845/$ - see front matter � 2008 Elsevier Inc. Adoi:10.1016/j.fgb.2008.06.004

Abbreviations: HPH, hygromycin phosphotransfeprotein; ORF, open reading frame; TBE, tris–borateacid; UV-A, ultraviolet-A.

* Corresponding author. Fax: +1 352 392 6532.E-mail address: rollinsj@ufl.edu (J.A. Rollins).

Apothecial development is the multicellular, sexual reproduction phase in the developmental life cycle ofSclerotinia sclerotiorum. This development begins within the sclerotium, a compact aggregation ofvegetative hyphae contained within a melanized rind layer. Upon germination from the sclerotium,the apothecial stipe requires exposure to UV-A wavelengths of light to develop a fertile disc. We haveidentified a gene, cry1 from S. sclerotiorum that is most closely related to photolyase/cryptochrome pro-teins in the CRY-DASH family. We characterized this CRY-DASH ortholog from S. sclerotiorum andobserved significant transcript accumulation only after exposure to UV-A and not in response to otherwavelengths of light. Tissue-specific expression studies revealed that cry1 transcripts accumulate tolow levels in vegetative mycelia and to higher levels in all light-exposed stages of apothecia development.Maximal cry1 transcript accumulation occurs in stipes between 2 and 6 h of continuous UV-A exposure.Mutant strains carrying a deletion of cry1 exhibited a decrease in sclerotial mass and displayed greaternumbers of pigmented hyphal projections on apothecial stipes under UV-A treatment but are otherwisedevelopmentally normal. Tissue level localization of Cry1-GFP protein accumulation expressed from thenative cry1 promoter was consistent with transcript localization. This study suggests that cry1 may have afunction during UV exposure but is not essential for completing the developmental life cycle under lab-oratory conditions.

� 2008 Elsevier Inc. All rights reserved.

1. Introduction

Sclerotinia sclerotiorum (Lib.) de Bary is one of the most non-spe-cific, and ubiquitous fungal plant pathogens affecting agriculturecrops. Long-term survival of this filamentous fungus requires theformation of sclerotia composed of compact masses of hardenedfilamentous hyphae containing nutrient reserve materials. The pig-mented, multihyphal sclerotia are capable of survival in the soil forat least 8 years (Chet and Henis, 1975; Adams and Ayers, 1979;Willets and Wong, 1980; Willets and Bullock, 1992). The sclerotiaserve as a supporting structure for germination, resulting in theproduction of apothecia (the sexual fruiting body) that producemillions of airborne ascospores. These spores, which are forciblydischarged from the apothecial surface, are the primary source ofinoculum in most Sclerotinia diseases and are critical for the sur-vival and spread of the disease in the field (Steadman, 1979). Thus,apothecial disc development is an essential process in the infec-

ll rights reserved.

rase; GFP, green fluorescent–ethylenediaminetetraacetic

tious lifecycle. The combined effects of light, temperature, andmoisture are considered the most important factors conditioningcarpogenic germination of sclerotia and subsequent apothecialdevelopment in S. sclerotiorum (Sun and Yang, 2000).

The study of light perception mechanisms and components of thesignal transduction pathways in fungal models such as Neurosporacrassa (Linden et al., 1997; Schwerdtfeger and Linden, 2000; Idnurmand, Heitman, 2005), Phycomyces blakesleeanus (Cerdá-Olmedo,2001; Corrochano, 2007) and Mucor circinelloides (Navarro et al.,2001) has been the focus of intensive investigation. Specifically,the UV-A to blue region of the spectrum (320–500 nm) inducesvarious morphogenetic responses in fungi such as germination ofspores, carotenogenesis, positive and negative phototropism, inhi-bition and stimulation of conidiogenesis, and aggregation of hyphae(Gressel and Rau, 1983; Islam et al., 1988; Corrochano andCerdá-Olmedo, 1991; Galland, 1992; Horwitz and Berrocal, 1997).At the molecular level N. crassa (an ascomycete) is the best under-stood, based on the functions of the blue light receptor white collar1 (WC-1) and the WC-1-interacting protein WC-2 that form thelight-responsive white collar complex (WCC) and other proteinsfunctioning in the light-responsive signaling pathway (Taloraet al., 1999; Cerdá-Olmedo, 2001; Liu et al., 2003; He and Liu,2005). Blue light regulates induction of carotenoid pigment

1266 S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276

production, and protoperithecia (sexual fruiting body) formation,perithecial beak phototropism, and circadian rhythm, all of whichare abolished by mutations in wc-1 or wc-2 (Linden et al., 1997). InN. crassa, wc-1 and wc-2 encode proteins with PAS (Per-ARNT-Sim)domains and a C4-type zinc finger DNA-binding domain (Lindenet al., 1997; Ballario et al., 1998; Cheng et al., 2003; Crosson et al.,2003). WC-1 also contains a LOV (light, oxygen, and voltage) domainthat is responsible for chromophore binding and blue light sensingby proteins present in bacteria, plants and fungi (Crosson et al.,2003). The small LOV-domain protein VIVID (VVD) also absorbs bluelight through a LOV-domain-bound chromophore and modulatesN. crassa responses to changing light conditions and adaptation toconstant light exposure (Shrode et al., 2001; Schwerdtfeger and Lin-den, 2003). Information regarding photoreceptors and regulatorygenes involved in numerous and varied light-regulated biologicalprocesses in fungi is accumulating rapidly (Purschwitz et al., 2006;Corrochano, 2007; Herrera-Estrella and Horwitz, 2007). To identifyUV-A photoreceptors mediating apothecial disc morphogenesis in S.sclerotiorum we are studying genes with homology to other knownphotoreceptors. We begin in this study with the characterizationof the cryptochrome family CRY-DASH ortholog cry1.

Cryptochromes are members of the photolyase/cryptochromefamily of flavoproteins widely distributed in eubacteria, archaeaand eukaryotes (Sancar, 1994, 2003; Cashmore et al., 1999). Cryp-tochromes do not exhibit photorepair activity but do exhibitultraviolet A (UV-A)/blue light photoreceptor activity. Based onmolecular phylogenetic and functional analyses, the photolyase/cryptochrome family can be classified into five distinct classes(1) Class I cyclobutane pyrimidine dimer (CPD) photolyase, (2)Class II CPD photolyase, (3) plant cryptochrome (CRY), (4) animalCRY including (6–4) photolyases, and the (5) CRY-DASH family(Cashmore et al., 1999; Lin and Todo, 2005). The first crypto-chrome gene was identified in Arabidopsis, CRY1, (Ahmad andCashmore, 1993), but homologs have since been found in bacte-ria, plants and animals (Cashmore et al., 1999; Brudler et al.,2003), and their involvement in a variety of light responses hasbeen reported (Ahmad et al., 1998; Lin, 2002; Somers et al.,2004). A very recently identified subgroup of the CRY gene family,CRY-DASH (so-named for its presence in Drosophila, Arabidopsis,Synechocystis, and Homo), lacks the C-terminal extension foundin the plant and animal CRYs and does not exhibit double-stranded DNA photolyase activity. CRY-DASH is closely relatedto Cry3 from Arabidopsis thaliana (At-cry3) that is phylogeneticallydistinct from At-Cry1 and At-Cry2 (Brudler et al., 2003; Kleine etal., 2003; Selby and Sancar, 2006). Except for CRY-DASH, mostcryptochrome proteins are composed of two domains, an ami-no-terminal photolyase-related (PHR) region and a carboxy-terminal domain (DAS) of variable length that share short, yetdistinct sequence motifs (Lin and Shalitin, 2003). The crystalstructure of A. thaliana CRY-DASH (At-Cry3) was reported recently(Huang et al., 2006). At-Cry3 (At5g24850) has no carboxy-termi-nal extension but has a transient peptide sequence, suggestingtargeting to both chloroplasts and mitochondria (Kleine et al.,2003). Both structural and functional studies suggest that CRY-DASH proteins function as transcriptional repressors in Arabidop-sis and Synechocystis, (Brudler et al., 2003; Daiyasu et al., 2004).Recent reports have demonstrated that the Arabidopsis At-Cry3exhibits single-stranded DNA photolyase activity (Selby and San-car, 2006), however, the biological role of this protein in the lifecycle is not known. The main focus of this study was to eliminateCry1 activity through targeted gene deletion to determine its rolein various growth and developmental stages of S. sclerotiorum.Based on its UV-A-specific transcriptional pattern in apotheciaand potential for transcriptionally regulating other genes, wehypothesize that Cry1 may play role in UV-A-dependant apothe-cial morphogenesis.

2. Materials and methods

2.1. Fungal strains and growth conditions

The wild-type (WT) S. sclerotiorum isolate 1980 (Godoy et al.,1990) was used to derive all strains in this study. Cultures wereroutinely grown on potato dextrose agar (PDA) (Difco, Detroit,MI, USA). Transformants were cultured on PDA supplemented witheither 100 lg/ml hygromycin B (EMD Biosciences, USA) or 10 lg/ml bialaphos (Phyto Technology Laboratories, Shawnee Mission,Kansas). Permanent stocks were maintained as desiccated myce-lia-colonized filter paper and sclerotia at �20 �C. Apothecia wereinduced from PDA culture-derived sclerotia as previously de-scribed by Russo et al. (1982) or from autoclaved potato piecesamended with 1.5% agar (Difco Agar, BD, USA).

2.2. Isolation and manipulation of nucleic acids

Total genomic DNA was extracted from ambient light (GE Eco-lux F32T8 SP41 fluorescent bulbs, ca. 2.8 lmol m�2 s�1, 12 h/day)grown liquid shake cultures in YPSuc medium (4 g/l yeast extract(Difco, Detroit, MI) + 15 g/l sucrose + 1 g/l K2HPO4 + 0.5 g/l MgSO4,pH 6.5) cultured as previously described (Rollins and Dickman,2001). Mycelia from liquid cultures were flash frozen in liquidnitrogen, lyophilized and stored at �80 �C. Lyophilized myceliawere used to isolate genomic DNA as described by Yelton et al.(1984). These cultures also served as the source for ‘‘vegetativemycelia” in Fig. 1A. Five chronological stages of sclerotia tissuewere obtained from sclerotia developing on PDA plates underambient light conditions. These stages included (1) sclerotial ini-tials (tufts of aerial hyphae forming near the edge of the fully col-onized plate); (2) non-pigmented hyphal aggregates with liquidexudate on the surface; (3) buff-colored hyphal aggregates with li-quid exudate; (4) black-colored aggregates with liquid exudate; (5)hyphal aggregates fully delimited by a black rind layer with noliquid exudate. Five chronological stages of apothecia wereobtained from cultures grown under continuous illumination(35 lmol m�2 s�1) provided by fluorescent lighting (Sylvania,F20T12/DSGN 50, Canada). Stage (1) apothecia were apothecial sti-pes germinated in the light but exhibiting no macroscopic signs ofdisc differentiation; stage (2) apothecia were stipes that had aninvagination in the center of the tip obvious by direct examination;the tips of stage (3) apothecia were early expanding discs; stage (4)apothecia were expanding discs; and stage (5) apothecia were fullyexpanded discs. Total RNA was extracted from lyophilized mycelia,sclerotia and apothecia (including stipe tissue) using Trizol reagent(Gibco BRL, Rockville, MD) according to the manufacturer’s instruc-tions. RNA electrophoresis was conducted as previously describedby Rollins and Dickman (2001).

Escherichia coli strain DH5a was used to propagate all plasmidDNAs. Plasmid isolations, agarose gel electrophoresis, DNA restric-tion digests, ligation reactions and E. coli transformations wereconducted using standard procedures (Sambrook and Russell,2001). All PCR products and gel fragments were purified withGeneclean spin kits (MP Biomedicals, LLC, OH 44139, USA). South-ern and northern blot analyses were carried out as previously de-scribed (Jurick and Rollins, 2007). As a loading control fornorthern hybridizations, rRNA bands transferred to the mem-branes were stained with methylene blue as described (Di Pietroand Roncero, 1998). Hybridization probes were labeled with[a-32P]dCTP using random Primers DNA Labeling System (Invitro-gen Life Technologies, Carlsbad, CA) as per the manufacturer’sinstructions. A 600 bp amplicon designed from the open readingframe of the cry1 gene using primers FP-50-ATGTCAGATTCTAA-GATCTTG-30 and RP-50-TGTAAGAACGTACTCATCGA-30 was used toprobe DNA and RNA blots. The probe for swc1 hybridization was

Fig. 1. Northern analysis of putative photoreceptor transcripts during growth anddevelopment. Five micrograms of total RNA was loaded in each lane. Methyleneblue-stained rRNA is shown as a loading control. (A) swc1, swc2, and cry1 geneexpression in vegetative mycelia and various sclerotium and apothecium develop-mental stages. (B) cry1 transcript accumulation in developing apothecia underdifferent light qualities. Etiolated stipes kept in constant dark (D) or exposed towhite light (>400 nm; WL), red (>580 nm; R), green and red (p > 500 nm; GR), green(465–650 nm; G), blue (400–530 nm; B) or ultraviolet-A (320–400 nm; UV-A) for75 h. (C) Transcript accumulation in developing apothecia kept in constant darkness(D), constant white light (WL) for 14 days or treated with UV-A (3.5 lmol m2 s�1)light for the indicated times.

S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276 1267

derived from the coding sequence of SS1G_11953 (AccessionXM_001586874) using primer swc1-FP: CCAATTGTCATACCAAAAGCAC and swc1-RP: TTTAGAAGTGCGCGAAGATATG. The probefor swc2 hybridization was derived from the coding sequence ofSS1G_12238 (Accession XM_001587158) using primer swc2-FP:GATTAAGGATTTTATGCACGTA and swc2-RP: TCCAGAGTACCTTATCAAATG. Hybridizations were done overnight at 65 �C under highstringency condition defined by Ausubel et al. (1991).

2.3. Construction of the Dcry1 strains

Gene deletion mutants of the cry1 locus were obtained usingsplit-marker (Catlett et al., 2003) fragments using a cloningstrategy previously described for the S. sclerotiorum sac1 gene(Jurick and Rollins, 2007). A pair of gene-specific primers cry1-5’FP (50-AATATGCGGTACTCCACATCTTG-30) and cry1-50 + AscI-RP(50-AGGCGCGCCTAGGATGAAAGCATCTTCGTCTG-30) was used toamplify �1.2 kb of sequence upstream of the cry1 translation startsite. An introduced AscI site is underlined. The 1.2 kb amplicon wascloned using the pGEMT-easy cloning kit (Promega, Madison, WI).This clone was designated pCry1-50.

Primers cry1-30FP + AscI (50-AGGCGCGCCTCAACTTACACAACCCGATTGAT-30) and cry1-30RP-(50-TTGTTTCACTGACTGACCATCTG-30) were designed to amplify 1.2 kb of sequence downstreamof the cry1 coding sequence. This product was also cloned usingpGEMT-easy cloning Kit and designated pCry1-30.

The cry1 gene replacement vector was constructed from thesetwo clones by first joining the pCry1-50 vector with the cry1-30 se-quences through a shared AscI site and vector-based NotI sites.Second a hygromycin phosphotransferase (hph) cassette contain-ing the trpC promoter and terminator with flanking AscI restrictionenzyme recognition sites (Hutchens, 2005) was ligated into theAscI site to create a clone with the following ordered sequences:50UTRcry1-hph-30UTRcry1. This 6.4 kb vector was used as a tem-plate to produce two cry1-hph hybrid split marker PCR products(Fig. 2A). Primers CRY-50 FP (50-AATATGCGGTACTCCACATCTTG-30)and HY (50-AAATTGCCGTCAACCAAGCTCTGATAG-30) were ampli-fied with cDNA polymerase (BD Biosciences, Palo Alto, CA) PCRreactions to produce the 2.5 kb 50-cry1-50-hph fragment. Primerscry1-30 RP (50-TTGTTTCACTGACTGACCATCTG-30) and YG (50-TTTCAGCTTCGATGTAGGAGGGCG-30) were used as above to producethe 30-cry1-30-hph fragment. These two split marker fragments,50UTR-50hph and 30UTR-30hph were gel purified, quantified, mixed(5 lg of each) and used to transform wild-type protoplasts as pre-viously described (Rollins, 2003).

2.4. Construction of complementation strains

To complement the cry1 deletion mutant, the pBARKS1 vectorcontaining the bar gene cassette (Pall and Brunelli, 1993) was di-gested with NotI restriction enzyme (New England Biolabs; USA)and treated with shrimp alkaline phosphatase according to the man-ufacturer’s instructions (Promega, Madison, WI). A pair of gene-spe-cific primers cry1-Comp-FP-0.5 kb 50UTR (50-ATGCGGCCGCTACTTTCATCCTAAGGTACGGCCAT-30) and cry1-Comp-RP-0.3 kb 30UTR(50-AATGCGGCCGCTATTCCGTCACATTAATAATAAGAGT-30) were de-signed to the 50 and 30 flanking genomic regions of the cry1 geneand used to amplify the cry1 locus from 100 ng of wild-type genomicDNA. Introduced NotI sites are underlined. PCR was carried out usinga high fidelity cDNA polymerase (BD Biosciences, Palo Alto, CA) andyielded a 2.8 kb product which contained the�2.0 kb cry1 coding se-quence and �0.5 kb of 50 and �0.3 kb of 30 untranslated region. The2.8 kb cry1 amplicon was cloned into the pGEMT-easy vector andsubsequently digested with NotI restriction enzyme and purified.The NotI-digested cry1 fragment was ligated into the 4.5 kb NotI-lin-earized pBARKS1 vector which gave rise to a 7.3 kb plasmid desig-nated cry1-pBARKS1.

2.5. Transformation and screening of transformant strains

Sclerotinia sclerotiorum protoplasts from wild-type and cry1deletion strains were prepared and transformed as described byRollins (2003). The cry1 deletion strain was complemented withcircular cry1-pBARKS1 plasmid and transformants were selectedon RM medium containing 10 lg/ml bialaphos. All transformantswere hyphal-tip transferred a minimum of three times. Southernblot hybridization was used to screen integration events and ge-netic purity in all transformants. PvuII-digested genomic DNAwas run on a 0.8% TBE-buffered agarose gel and transferred ontoa positively charged nylon membrane overnight (Chomczynski,1992). The membranes were probed with the 30UTR probe andthe �600 bp cry1 coding sequence.

2.6. Construction of cry1-GFP fusion

We obtained the GFP vectors pCT73 and pCT74 (Lorang et al.,2001) from L. Ciuffetti, Oregon State University. Vector pCT73

Fig. 2. Gene disruption strategy and analysis. (A) Diagram of the cry1 locus and the homologous recombination gene replacement strategy to generate Dcry1 mutants (D1—Dcry1-3.8; D2—Dcry1-3.10). (B) Southern analysis of genomic DNA digested with PvuII. The upper panel blot was hybridized with the 30UTR region of cry1 (probe-1) WT(wild-type); D1 and D2 (Deletion, Dcry1 mutants); H1, H2, H3 (Heterokaryons); E1, E2 (Ectopic strains) and O1, O2 (similar to WT). The lower panel was hybridized with the�600 bp coding sequence of cry1 (probe-2). (C) Northern blot analysis of wild-type (WT), Dcry1 mutants and restored strains in mycelia (M), mature apothecia (A) and 1 hUV-A treated stipes (S). The blot was hybridized with the 600 bp cry1 coding sequence.

1268 S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276

containing the sGFP under the control of the ToxA promoter andnos terminator was digested with SalI and NcoI to removethe ToxA promoter. We used the forward primer Cry1-GFP-FP(50-Gggtcgacacaacacaacatcagcttc-30) to introduce a 50 SalI siteto the cry1 promoter sequences (�0.8 kb). The reverseprimer cry1-GFP-RP (50-TATCATGAATGACCTCTGCCTCTGTATCCTC-30) introduced a BspH1 site to the 30-terminal end of codingsequences of cry1 (�2.0 kb). PCR was performed on �25 ng ofwild-type genomic DNA in a 50 ll reaction under standard PCRreaction conditions with a 65 �C annealing temperature. Theamplification product was ligated into pGEMTT-easy. This con-struct was digested with SalI and NcoI to release an �2.8 kb frag-ment of the native promoter and cry1 open reading frame (ORF)which was then inserted into pCT73 vector DNA that had beenalso digested with SalI and NcoI and purified to remove the ToxApromoter. The resulting construct contains the �800 bp cry1 pro-moter region, the 2.0 kb cry1 coding sequence in frame with theGFP coding sequence followed by a nos terminator. The vectorwas then digested with SalI and ligated with an �1.6 kb SalIhygromycin resistance cassette fragment (Carroll et al., 1994) from

pCT74 to produce pCry1-pCT74 vector. The orientation of thehph cassette was confirmed by restriction enzyme digestionanalysis.

2.7. Screening for GFP expression and microscopy

GFP expression was initially detected in Cry1-GFP transfor-mants by microscopic screening using an epifluorescent LeicaDMR microscope (Leica Microsystems Wetzlar GmbH, Germany)with a GFP long pass filter set (450–490 nm excitation,495LP nm dichroic, and 500LP nm emission). Samples were sec-tioned using a Cryostat microtome (International Cryostat, IEC,Model CTI, MA, USA). Further images were obtained on a LSM5 PASCAL laser scanning confocal microscope (LSCM) with LSM5 PASCAL software (Carl Zeiss) using excitation 488 nm and505 nm emission wavelengths. Images were analyzed in theICBR microscopy core at University of Florida using Zeiss LSMImage software. The microscope was equipped with detectorsand filter sets for monitoring of GFP fluorescence, DIC andmerged images.

S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276 1269

2.8. Light treatment experiments

For light wavelength and duration expression studies (Fig 1Band C) sclerotia were conditioned for carpogenic germination bythe method of Russo et al. (1982) and incubated at 15 �C for 4–5weeks. When germination first appeared, sclerotia were treatedwith UV-A (3.5 lmol m�2 s�1) for an hour and then incubated indark for 14 days at room temperature. Resulting etiolated stipeswere illuminated under UV-A (320–400 nm; 3.5 lmol m�2 s�1)and white light (>400 nm; 35 lmol m�2 s�1) for the timesindicated. Wavelengths of transmitted light were controlled usingpetri dish chambers covered with deep-dyed Roscolux polyesterfilters and UV-block filters (Gam products Inc., Los Angels, CA)illuminated with a fluorescent lamp (Sylvania, F20T12/DSGN 50,Canada). Fluence rates were 8 lmol m2 s�1 for wavelengthsenriched in blue light (400–530 nm), 21 lmol m2 s�1 for wave-lengths enriched in green light (465–650 nm), 22 lmol m2 s�1

for wavelengths enriched in green and red light (>500 nm)and 19 lmol m2 s�1 for wavelengths enriched in red light(>580 nm). Filter transmission spectra were obtained with aspectroradiometer (EPP 2000C spectrometer, Model #SPEC-1021,Instruments, Inc.).

2.9. Ascospore germination assay

Ascospores were harvested from apothecia and a stock of5 � 106 spores/mL in 30% glycerol were prepared. The suspensionswere spread on Petri dishes containing PDA. Plates were uncoveredand illuminated with UV-C (germicidal lamp) for differenttime intervals. Following UV-C treatment, plates were transferredto either constant dark or continuous UV-A treatment (3.5 lmolm2 s�1) for 3 days (BLB Sylvania fluorescent bulbs). Control platesdid not receive UV-C light but did receive the constant dark orUV-A treatment.

3. Results

3.1. Identification and characterization of S. sclerotiorumcryptochrome DASH (cry1) gene

A number of putative photoreceptors are encoded by the S. scle-rotiorum genome (Broad Institute, http://www.broad.mit.edu/annotation/genome/sclerotinia_sclerotiorum/Home.html). Toinvestigate ultraviolet-A (UV-A) photoreceptors with potentialroles in S. sclerotiorum photoresponses, we used BLAST to searchfor cryptochrome sequence homologs. The protein encoded by lo-cus SS1G_05163 was identified as a putative cryptochrome. Thisprotein is annotated as a hypothetical protein in the S. sclerotiorumgenome database but shared significant sequence identity withphotolyases and cryptochromes from fungi and other organisms.Greatest sequences identity was with other unannotated proteinsand proteins identified as belonging to the CRY-DASH class of pho-tolyases. We designated this gene cry1 and the encoded amino acidsequences (Cry1) were aligned with CRY-DASH protein sequencesfrom Arabidopsis, Synechosystis, Xenopus, Zebrafish, and the filamen-tous fungi Botrytis cinerea, Neurospora crassa, Magnaporthe grisea,and Fusarium graminearum to determine the putative start and stopcodons and locations of intron/exon junctions. Based on this analy-sis, the cry1 gene contains two exons, one intron and the predictedjoined open reading frame yields a 2008 bp sequence that encodes652 amino acids. This predicted gene structure is the same as thatannotated in the S. sclerotiorum genome database. Introns were ver-ified by sequencing a �2.0 kb RT-PCR fragment. BLAST sequencequeries indicated that the N-terminal region of the encoded Cry1contains a conserved DNA photolyase domain (Pfam00875) and

the C-terminus encodes a FAD-binding domain (Pfam03441). Aphylogram using Bootstrap N-J was constructed using all of theamino acid sequences of the photolyase/cryptochrome familymembers as described by Daiyasu et al., 2004. In addition, weincluded homologous fungal sequences obtained from the BroadInstitute fungal genome database identified through blastpand blastx queries. The resulting phylogram (SupplementalFig. 1) revealed that Cry1 formed a monophyletic clade withmembers of the CRY-DASH proteins described from plant, animaland bacteria and with putative CRY-DASH proteins encoded byB. cinerea (BC1G_08145; Accession No. XP_001553315), M. grisea(MGG_03002.5; Accession No. XP_366926), N. crassa(NCU00582.2; Accession No. XP_965722), Stagonospora nodorum(SNU07712.1; Accession No. EAT85178), F. graminearum(FG08852.1; Accession No. XP_389028), and Ustilago maydis(UM059171; Accession No. XP_762064). A S. sclerotiorum geneencoding a Class I CPD photolyase (SS1G_12076) was also identifiedby this analysis but no animal-Cry/(6–4) photolyase familymembers were identified from S. sclerotiorum although theywere present in other phytopathogenic fungi represented in theBroad Institute fungal genome databases (https://www.broad.mit.edu/annotation/fgi/; F. graminearum: FG06765.1; M. grisea:MGG020715; S. nodorum: SNU11687.1 and U. maydis: UM02144.1).

3.2. Tissue-specific expression of cry1

To determine whether expression of putative photoreceptorsencoded by the white collar orthologs swc1 (SS1G_11953) andswc2 (SS1G_12238) and cry1 is regulated at different stages ofgrowth and development, we examined transcript accumulationby northern hybridization. As shown in Fig. 1A, swc1 transcriptswere detected in vegetative hyphae, early stages of sclerotiumdevelopment and late stages of apothecium development. swc2transcripts were obvious in all examined stages of growth anddevelopment and were particularly abundant during late stagesof apothecial development. In stage 5 sclerotia (mature sclerotia),the detected swc2 transcript was smaller than the transcript de-tected in all other stages possibly due to alternative mRNA splicingor an alternative transcript start site in this tissue. cry1 transcriptswere detected in all examined stages of apothecial developmentwith particularly high accumulation in the late stages. Accumula-tion of cry1 was also detected at a relatively low level and as aslightly smaller transcript in vegetative hyphae. Transcripts ofcry1 were not detected in any stage of sclerotial development.These results suggest that cry1 transcript is specifically inducedin apothecia but also present in an alternative form at low levelsin hyphae whereas swc1 and swc2 transcripts could be detectedfrom at least one stage of sclerotium and apothecium developmentin addition to vegetative hyphae.

3.3. The expression of cry1 is induced by UV-A

Fungi exhibit photoresponses to near UV, Blue, Red and Far-Redwavelengths through specific photoreceptors. To date functionalphotoreceptors for near UV/blue light (Ballario et al., 1996; He etal., 2002) and red-far red light (Blumenstein et al., 2005) responseshave been identified (see Corrochano, 2007; Herrera-Estrella andHorwitz, 2007 for reviews). The near UV/blue light photoreceptorsbelong to the PAS domain-containing WC-1 family of proteins. Todetermine if cry1 expression is correlated with these active wave-lengths, we examined cry1 transcript accumulation in apothecialstipes exposed to various wavelengths of light. Stipes were ex-posed for 75 h to white light (>400 nm) and wavelengths enrichedfor red (>580 nm), green and red (>500 nm), green (465–650 nm),blue (400–530 nm), and UV-A (320–400 nm) light. Constant darkincubation served as a control. As shown in Fig. 1B the expression

Fig. 3. The Dcry1 strains show a reduction in sclerotial mass when developing in thepresence of UV-A. (A) Sclerotia morphology of wild-type (WT), cry1 deletion strains(Dcry1-3.8 and Dcry1-3.10), hph ectopic (Ect.) and restored (Dcry1-3.8-restored)strains grown on PDA for 8 days under continuous UV-A (3.5 lmol m�2 s�1). (B)Measurement of sclerotial mass from cultures grown in constant dark (CD), whitelight (>400 nm; WL) and UV-A (320–400 nm) conditions. Vertical bars indicate meannumber of sclerotia per plate ± SE of three separate experiments with three replicateseach.

1270 S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276

of cry1 was substantially induced by UV-A with low, but observa-ble transcript accumulation in stipes exposed to wavelengths inthe 400–580 nm range.

The kinetics of cry1 transcript accumulation were investigatedwith time course experiments under UV-A exposure (3.5 lmolm2 s�1). For these experiments, etiolated stipes were exposed toUV-A for 15, 30 min and 1, 2, 6, 12, 24, 48, and 75 h, and steady statetranscript levels were examined by northern hybridization analysis.As shown in Fig. 1C, expression of cry1 does not occur in dark or WLtreated stipes, but accumulates by 30 min of UV-A exposure andpeaks by between 2 and 6 h. cry1 transcripts were detectable up to75 h under continuous UV-A treatment at which time the earliestsign of disc morphogenesis (tip invagination) was evident and theexperiment was stopped. UV-A appears to be specific, rapid and sus-tainable inducer of cry1 gene expression.

3.4. cry1 gene replacement

The strategy to delete the cry1 locus with a cry1-hph genereplacement construct is described in Section 2 and is shown inFig. 2A. The gene replacement construct was used as a PCR tem-plate to produce split-marker fragments (Catlett et al., 2003) totransform wild-type protoplasts. Twenty-five transformants wereobtained and purified by three rounds of hyphal tip transfer.Homologous recombinants were identified by PCR screening (datanot shown) and by Southern blot analysis (Fig. 2A and B). Twogenetically pure and independent cry1 deletion mutants (Dcry1-3.8 and Dcry1-3.10) were identified (D1 and D2). Five additionaltransformants had undergone correct homologous recombinationat the cry1 locus, but Southern hybridization and PCR analysis(data not shown) indicated that they were heterokaryons (H1–H5). Two transformants produced hybridization patterns consis-tent with ectopic integration (E1 and E2) and two transformants(O1–O2) appear to be untransformed escapes. Hybridization usingthe 30 cry1 sequence yielded 3.6 and 6.7 kb bands for WT, 3.6 and4.3 kb bands for Dcry1 mutants, and the wild-type bands plusone or more additional bands for ectopic transformants. To confirmthat the absence of the 6.7 kb band was due to the replacement ofthe cry1 gene, genomic DNA from all transformants was hybridizedwith the �600 bp cry1 coding sequence probe (probe-2). As ex-pected, probe-2 yielded a 6.7 kb band for WT and ectopic strainsand did not hybridize to the Dcry1-3.8 and Dcry1-3.10 strains(Fig. 2B). These two mutant strains were genetically identical andmorphologically indistinguishable. Knockout strain Dcry1-3.8 waschosen for genetic complementation tests. This strain was trans-formed with the cry1 complementation vector and ten randomlychosen bialaphos-resistant transformants were screened by PCRusing cry1 coding sequence primers followed by RNA transcriptanalysis from one complemented strain. Northern hybridizationusing cry1 coding sequence as a probe revealed that the WT andthe complemented strain possessed the �2.0 kb cry1 transcript inhyphae, mature apothecia and UV-A exposed stipes, while theknockout strains Dcry1-3.8 and Dcry1-3.10 lacked the transcriptas expected for a gene deletion strain (Fig. 2C).

3.5. Dcry1 phenotype

When grown under constant dark or white light conditions onpotato dextrose agar (PDA), the colony growth of the Dcry1 mutantstrains were equivalent to wild-type, ectopic and complementedstrains. Growth under UV-A light however, resulted in an approx-imately 30% reduction in sclerotial mass when measured as freshweight (Fig. 3A and B). The functional capacity of these sclerotiahowever appeared unaffected as sclerotia produced by the Dcry1mutant strains were capable of both myceliogenic and carpogenicgermination under standard conditions. Apothecial morphology of

the Dcry1 strains was indistinguishable from WT when developedin full spectrum light (white plus UV-A). Apothecia that developedexclusively in UV-A light (3.5 lmol m2 s�1) for 15 days, howeverdeveloped greater numbers of dark hyphal projections on the sti-pes (Fig. 4A). The wild-type produced projections but only aboutone fifth as many as observed in the mutants. Wild-type phenotypewas restored in the complemented strain (Fig. 4A).

3.6. Ascospore germination assay

If the cry1 is a functional photolyase, we suspect Dcry1 mutantswould have a defect in photoreactivated-mediated DNA repair. Totest this hypothesis, ascospores were harvested from wt and Dcry1apothecia, suspended in aqueous solution and spread on PDA med-ium. Open plates were treated with germicidal UV-C for differenttime intervals and immediately placed under constant dark or un-der UV-A illumination. After 3 days, plates were scored for asco-spore germination. Treatments with UV-C for 2.5 and 3 min weresufficient to completely inhibit germination of both wt and mutantascospores following incubation in constant dark or UV-A, respec-tively. Percent spore germination was normalized against controlplates which received no UV-C treatment prior to constant darkor UV-A incubation. Fig. 4C shows that there was a significant dif-ference in spore germination between constant dark and UV-Atreatments at all UV-C treatments. This indicates that photoacti-vated DNA repair occurs in the WT and the Dcry1 mutant underthese conditions. However, there was no significant differencebetween wt and Dcry1 ascospore germination in constant dark orUV-A following UV-C treatment suggesting that cry1 does not en-

Fig. 4. Dcry1 apothecial development. (A) Wild-type (Wt), Dcry1-3.8, and Dcry1-3.8-restored sclerotia were germinated and apothecia developed in constant UV-A light(3.5 lmol m2 s-1). Arrow indicates hyphal projections on stipes. (B) Quantification of observed hyphal projections was made on 90 apothecia from each strain. Vertical barsindicate means ± SE of three separate experiments with three replicates each. (C) Ascospores germination assay. Ascospores of WT and Dcry1-3.8 were spread on PDA mediaand illuminated with UV-C for different time intervals followed by a 3-day incubation in constant dark or UV-A (3.5 lmol m2 s�1). Germination of ascospore was scored after3 days. The control plates (Con) did not receive UV-C.

S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276 1271

code the major photolyases activity observed under theseconditions.

3.7. Host–pathogen interaction

To determine whether cry1 is required for pathogenicity or vir-ulence, we inoculated mycelial plugs colonized with hyphae of theWT, mutants, ectopic and complemented strains onto A. thalianaplants and also on detached tomato leaflets kept under white lightor UV-A at room temperature. Host tissues were equally colonizedby all strains indicating that cry1 does not play an essential role ina compatible host–pathogen interaction (data not shown).

3.8. Cry1-GFP expression in vegetative mycelia and apothecial disc

To study tissue localization of the Cry1 protein, we generated anamino-terminal fusion of sGFP to the carboxy-terminus of Cry1.Expression was driven by the native �0.8 kb sequence upstreamof the cry1 start codon. The resultant construct was transformedinto the wild-type S. sclerotiorum and five transformants were cho-sen for Southern blot analysis (data not shown). One transformantwith a single Cry1-GFP integration was chosen and observed forfluorescence via epifluorescence or confocal microscopy. Theseobservations indicated that the native promoter successfully droveexpression of the Cry1-GFP protein in vegetative mycelia (Fig. 5Dand G) grown under ambient full spectrum lighting (ca.2.8 lmol m�2 s�1) and in apothecia (Fig. 6D, G, and J) that devel-oped under continuous full spectrum lighting (35 lmol m�2 s�1).As expected, based on the transcript accumulation results, therewas no fluorescence observed in the WT controls, and GFP wasnot detected in sclerotia that developed under ambient full spec-trum lighting (ca. 2.8 lmol m�2 s�1) (Fig. 5A, J, and M). Cry1-GFPwas observed throughout the cytoplasm of vegetative mycelia

but excluded from the vacuoles (Fig. 5D and G). Sclerotia producedby the Cry1-GFP strains were capable of both myceliogenic andcarpogenic germination. Apothecia developed from the sclerotia(Fig. 6D) exhibited fluorescence in the apical region of the earlydeveloping apothecial discs and in the hymenium of expandingapothecial discs. Less intense fluorescence was observed in theapothecial stipes (Fig. 6G–I).

4. Discussion

Fungi perceive and respond to the light environment to regu-late numerous biological processes including protection againstmolecular and cellular damage, circadian rhythm, directedgrowth, metabolism and morphogenesis. Identifying specificreceptors that mediate these responses is a key step towardsunderstanding how these processes are regulated and appropri-ate responses coordinated. In this study, we investigated the roleof a CRY-DASH ortholog (Cry1) from S. sclerotiorum to determineif it plays a role in photomorphogenesis. cry1 transcript accumu-lation was detected marginally in vegetative mycelia and prefer-entially in all apothecial developmental stages exposed to UV-A.Transcript accumulation was not detected in any stage of sclero-tial development. These results are consistent with a role forCry1 during apothecial development as previous findings havedemonstrated that a narrow range of UV wavelengths regulateapothecial disc development in S. sclerotiorum (Thaning andNilsson., 2000; Rollins unpublished data). Moreover, by natureof their bound chromophores, cryptochromes have action spectrawith a broad band in the UV-A region and a second band in theblue region and are known to mediate a number of near UV/bluelight photoresponses (Briggs and Huala, 1999; Lin, 2002). Therelatively low levels of cry1 transcript accumulation detectedwhen apothecial stipes are exposed to other wavelengths of light

Fig. 5. (A–O) Confocal microscope images of Cry1-GFP transformants. Apothecia developed under continuous full spectrum lighting (35 lmol m�2 s�1). All other stagesdeveloped under ambient full spectrum lighting (ca. 2.8 lmol m�2 s�1, 12 h/day). (A, D, G, J, and M) viewed using GFP filter set. (B, E, H, K, and N) viewed using DIC optics. (C,F, I, L, and O) merged images. (A, B, and C) Untransformed vegetative hyphae. (D, E, and F) Low magnification image showing vegetative hyphae expressing Cry1-GFP. (G, H,and I) High magnification image of vegetative mycelia expressing Cry1-GFP in S. sclerotiorum cytoplasm, with no GFP accumulation in vacuoles (arrows) (J, K, and L)Untransformed sclerotia. (M, N, and O) Cry1-GFP transformed sclerotia.

1272 S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276

(Fig. 1B) is likely due to a small amount of full spectrum lightleakage into the chambers. Low level transcriptional activationof cry1 through other light input pathways, however, remains apossibility as crosstalk between red and blue light gene regula-tion has been reported in at least one other fungal system(Rosales-Saavedra et al., 2006).

Results of our phylogenetic analysis (Supplemental Fig. 1) areconsistent with those of Daiyasu et al. (2004), wherein all CRY-DASH proteins including cry1 fall into one monophyletic groupcontaining fungal, plant and animal CRY-DASH proteins. The func-tions of CRY-DASH proteins in normal organismal physiology anddevelopment are still enigmatic. The earliest examinations of this

Fig. 6. (A–L): Expression of Cry1-GFP in apothecia developing under continuous full spectrum lighting (35 lmol m�2 s�1). (A, B, and C) Untransformed apothecia sectionviewed under confocal microscope. (D–L) Apothecia of Cry1-GFP transformants. (D–F) Early differentiating of stipe apex (ca. 24 h in the light). (G–I) Expanding apothecia disc(ca. 7 days in the light). (J–L) Apothecial disc hymenium (ca. 10 days in the light).

S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276 1273

class of photolyase-related proteins failed to observe significantphotolyase activity (Hitomi et al., 2000; Ng and Pakrasi, 2001;Worthington et al., 2003). Transcriptional repression activity how-ever, was suggested based on the light-dependent up-regulation ofgenes in a Synechocystis cry-DASH mutant (Brudler et al., 2003).More recently, Selby and Sancar (2006) demonstrated highly spe-cific ssDNA photolyase activity for CRY-DASH orthologs from bac-teria, plants and animals. As the authors of that study point out,this ssDNA photolyase activity is specific but it does not precludea function for CRY-DASH proteins in transcriptional regulation(Selby and Sancar, 2006). The CRY-DASH ortholog from N. crassahas been described to be light-inducible and under circadian regu-lation (Dunlap and Loros, 2005). Deletion of the Neurospora crygene, however, appears to have no effect on photoreactivationDNA repair (Dunlap and Loros, 2005). In A. thaliana, CRY-DASH(AT-Cry3) appears localized to chloroplast and mitochondria

(Kleine et al., 2003). Chloroplast localization has also beenconfirmed in Karenia brevis (Brunelle et al., 2007). Analysis of theSclerotinia CRY-DASH ortholog (Cry1) sequence using TargetP(Emanuelsson et al., 2000), and SignalP (Bendtsen et al., 2004)algorithms did not support mitochondrial localization.

Because cry1 is preferentially expressed in apothecia, dramati-cally UV-A inducible, and the function of this class of proteins isstill unknown, we hypothesized that cry1 loss-of-function mutantswould exhibit aberrant apothecial disc development. Apothecialdevelopment is a particularly important step in the developmentallife cycle of S. sclerotiorum, as each apothecium is capable of pro-ducing millions of ascospores and ascospores are the primarysource of initial inoculum in most Sclerotinia disease cycles. GFPexpression studies strongly supported the northern data showingthat cry1 transcription and translation occur in vegetative hyphaeand apothecia. We tested this hypothesis by deleting cry1 from

1274 S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276

the genome but failed to detect any apothecial disc developmentabnormalities in the loss-of-function mutants. The increase in darkpigmented hyphal projections on the mutant apothecial stipes maybe a stress response caused by UV light exposure in the absence ofCry1 activity or may indicate that Cry1 plays a role in the negativeregulation of these projections. The lack of an obvious effect on discdevelopment indicates that Cry1 is not a significant or is a redun-dant regulator of disc photomorphogenesis in S. sclerotiorum. Wealso found that loss of cry1 function did not affect mycelial growth,but a decrease in sclerotial mass was observed when the cultureswere grown under UV-A light conditions. This sclerotial mass phe-notype was restored by complementation with an intact copy ofthe wild-type cry1 gene. Since cry1 transcripts accumulate in veg-etative mycelia but not in sclerotia, we speculate that the decreasein sclerotia mass under UV-A may be the manifestation of animpaired stress response due to reduced ability to respond toUV-A-induced photoxidation or other effects of prolonged UV-Aexposure. Biochemical characterization of Cry1 activity and itsinteracting protein and nucleic acid partners may be required tounderstand its physiological role and underlying causes for theobserved phenotypes in Dcry1. Identification and characterizationof other light-regulated genes should allow us to determine if Cry1plays a role in the regulation of other genes and what photorecep-tors, perhaps including Cry1 itself, are responsible for light regula-tion of cry1 transcription.

The Dcry1 loss-of-function mutants were equally sensitive aswild-type to UV-C treatment and thus we presume that Cry1does not encode a major photolyase activity. This activity mostlikely resides with the predicted class I CPD photolyase encodedby locus SS1G_12076.1 (Broad Institute, http://www.broad.mit.e-du/annotation/genome/sclerotinia_sclerotiorum/Home.html). ThisS. sclerotiorum protein is an ortholog of the Trichoderma atro-virde phr1 protein (Berrocal-Tito et al., 2007). demonstrated thatdeletion of phr1 inhibited spore germination, thus abolishedphotoreativation and confirmed that PHR1 was involved inDNA repair and photoinduction under blue light. Genes that en-code cryptochromes that appear to be most closely related tothe animal CRY/6–4 photolyase subfamily (Daiyasu et al.,2004) have been identified from some but not all sequencedfungal genomes. In at least one phytopathogenic fungus,Exserohilum turcicum, expression of this class of cryptochromeis associated with light-regulated asexual sporulation (Flahertyand Dunkle, 2005). Neither this class nor any additional crypto-chromes appear to be encoded by the genome of S. sclerotiorum.Considering this observation and the data obtained in the pres-ent study, members of the cryptochrome-class of photoreceptorsare not postulated to play major roles in developmental regula-tion of S. sclerotiorum. The S. sclerotiorum CRY-DASH ortholog,Cry1, appears to mediate UV-A-specific but minor effects onsclerotia size and stipe structure. This suggests that cry1 maybe required for UV stress or damage responses but is not essen-tial for completing the normal developmental life cycle of S.sclerotiorum.

The general domain structure of cryptochromes includes anamino-terminal chromophore-binding domain responsible forlight perception and a carboxyl-terminal extension that is impli-cated in signaling (Ahmad et al., 1998). CRY-DASH proteinsincluding the Sclerotinia Cry1 lack the C-terminal extension pres-ent in other classes of plant and animal CRYs. In Synechocystisand Arabidopsis CRY-DASH proteins bind DNA and are proposedto serve as transcriptional repressors (Brudler et al., 2003; Kleineet al., 2003). However, DNA-binding activity has not been dem-onstrated in animal CRY-DASH proteins (Daiyasu et al., 2004).Facella et al. (2006) reported that CRY-DASH gene expressionis under the control of clock machinery in tomato and Dunlapand Loros (2005) have indicated the same is true for the N. cras-

sa CRY-DASH protein. Development and characterization of de-fined cry-DASH mutants in a diverse group of organisms shouldlend insight into the common and the unique roles they playduring growth and development.

Although cry1 transcript accumulation positively correlateswith apothecium disc morphogenesis, this obviously does notensure a functional or regulatory relationship. In plants, thePHYA phytochrome is a primary photoreceptor regulating re-sponses to very low fluence red light and continuous far redlight. The accumulation of phyA transcripts, however, exhibits lit-tle organ specificity and transcripts are present in lower abun-dance in light-grown relative to dark-grown plants (reviewedin Sharrock and Mathews, 2006). In Neurospora, all known nearUV and blue light responses are mediated through the WC-1photoreceptor. WC-1 interacts with a second protein, WC-2, toform the WC complex (WCC) that regulates gene transcriptiondownstream of photoreception. The central role of WCC in pho-toreception and response targets these proteins for multiple lev-els of regulation. Although wc-1 transcript accumulation istransiently upregulated following light exposure, the regulationof WC-1 and WC-2 is primarily post-translational (reviewed inCorrochano, 2007). Our northern hybridization results withswc-1 and swc-2 also did not suggest a strong correlation be-tween transcript accumulation and development stage or lightexposure. Transcripts of swc2 were detected in all examinedstages of development including undifferentiated apothecium sti-pes exposed to minimal light (stage 1 apothecia) and all light-exposed differentiating stages of apothecia. swc1 transcriptswere detected in light-exposed disc development stages of apo-thecium development (stages 2–5) but also in vegetative hyphaeand some stages of sclerotial development. Given the widespreaddevelopmental occurrence of these transcripts, the regulation ofthese proteins, like the Neurospora orthologs, may occur primar-ily at the post-translational level. The difference in the size ofthe primary cry1 transcript observed in vegetative hyphae versusapothecia suggests that cry1 may be subject to additional levelsof transcriptional regulation. The differing transcripts may be aconsequence of alternative transcription start position or alterna-tive splicing of introns. Three expressed sequence tags (ESTs)covering the predicted 30 coding sequence of cry1 are presentin the S. sclerotiorum genome database. All three sequences orig-inated from a cDNA library prepared from developing apotheciamRNA. Two of the sequences resulted from the splicing of a130 bp intron immediately preceding the predicted stop codon.The resulting transcripts could explain the observation of differ-ent-sized transcripts sometimes observed in mycelia and apothe-cia (e.g., Fig. 1A and Fig 2C). Whether this splicing isdevelopmentally regulated and whether it has functional conse-quences may be of interest when the function of Cry1 is betterunderstood.

In conclusion, cry1 does not appear to play an essential role in S.sclerotiorum apothecial photomorphogenesis. The S. sclerotiorumgenome appears to encode all of the blue light/UV-A photorecep-tors demonstrated to mediate photoresponses in Neurospora:WC-1, WC-2, and VIVID (VVD). WC-1 and WC-2 (WC complex)are responsible for mediating blue light/UV-A photoresponses(carotenogenesis, protoperithecia formation, phototropism, circa-dian rhythm, etc.) in N. crassa and orthologs have been demon-strated to be photoregulators in other filamentous fungi(Purschwitz et al., 2006; Corrochano, 2007). Additionally, VVD isrequired for photoadaptation in N. crassa and other filamentousfungi (Schrode et al., 2001; Schwerdtfeger and Linden, 2003; Elvinet al., 2005; Schmoll et al., 2005). We are currently investigatingthe functions of WC-1, WC-2, and VVD orthologs in S. sclerotiorumto better understand their roles in the photoresponses of thisfungus.

S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276 1275

Acknowledgments

We thank Karen C. Chumosco and Donna Williams for assistingwith cryostat sections and confocal microscope, respectively. Wealso thank Ulla K. Benny for her technical assistance. This workwas supported by CREES Grant 2005-35319-15282 from the Uni-ted States Department of Agriculture.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.fgb.2008.06.004.

References

Adams, P.B., Ayers, W.A., 1979. Sclerotinia sclerotiorum: ecology of Sclerotiniaspecies. Phytopathology 69, 896–899.

Ahmad, M., Cashmore, A.R., 1993. HY4 gene of Arabidopsis thaliana encodes a proteinwith characteristics of a blue-light photoreceptor. Nature 366, 162–166.

Ahmad, M., Jarillo, J.A., Smirnova, O., Cashmore, A.R., 1998. The CRY1 blue lightphotoreceptor of Arabidopsis interacts with phytochrome A in vitro. Mol. Cell 1,939–948.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl,K., 1991. Current Protocols in Molecular Biology. John Wiley and Sons, NewYork.

Ballario, P., Talora, C., Galli, D., Linden, H., Macino, G., 1998. Roles in dimerizationand blue light photoresponses of PAS and LOV domains of Neurospora crassawhite collar proteins. Mol. Microbiol. 29, 719–729.

Ballario, P., Vittorioso, P., Magrelli, A., Talora, C., Cabibbo, A., Macino, G., 1996. Whitecollar-1, a central regulator of blue light responses in Neurospora, is a zinc fingerprotein. EMBO J. 15, 1650–1657.

Bendtsen, J.D., Nielsen, H., von Heijne, G., Brunak, S., 2004. Improved prediction ofsignal peptides: SignalP 30. J. Mol. Biol. 340, 783–795.

Berrocal-Tito, G.M., Esquivel-Naranjo, E.U., Horwitz, B.A., Estrella1, A.H., 2007.Trichoderma atroviride PHR1, a fungal photolyase responsible for DNA repair,autoregulates its own photoinduction. Eukaryot. Cell 6, 1682–1692.

Blumenstein, A., Vienken, K., Tasler, R., Purschwitz, J., Veith, D., Frankenberg-Dinkel,N., Fischer, R., 2005. The Aspergillus nidulans phytochrome FphA repressessexual development in red light. Curr. Biol. 15, 1833–1838.

Briggs, W.R., Huala, E., 1999. Blue-light photoreceptors in higher plants. Annu. Rev.Cell. Dev. Biol. 15, 33–62.

Brudler, R.K., Hitomi, H., Daiyasu, H.T., Kucho, K., Ishiura, M., Kanehisa, M., Roberts,V., Todo, T., Tainer, J., 2003. Identification of a new cryptochrome class.Structure, function, and evolution. Mol. Cell 11, 59–67.

Brunelle, S.A., Hazard, E.S., Sotka, E.E., Dolah, Frances, M.V., 2007. Characterizationof a Dinoflagellate cryptochrome blue light receptor with a possible role incircadian control of the cell cycle. J. Phycol. 43, 509–518.

Carroll, A.M., Sweigard, J.A., Valent, B., 1994. Improved vectors for selectingresistance to hygromycin. Fungal Genet. Newsl. 41, 22.

Cashmore, A.R., Jarillo, J.A., Wu, Y., Liu, D., 1999. Cryptochromes: blue light receptorsfor plants and animals. Science 284, 760–765.

Catlett, N.L., Bee-Na, L., Yoder, O.C., Turgeon, B.G., 2003. Split-marker recombinationfor efficient targeted deletion of fungal genes. Fungal Genet. Newsl. 50, 9–11.

Cerdá-Olmedo, E., 2001. Phycomyces and the biology of light and color. FEMSMicrobiol. Rev. 25, 503–512.

Cheng, P., Yang, Y., Wang, L., He, Q., Liu, Y., 2003. WHITE COLLAR-1, amultifunctional Neurospora protein involved in the circadian feedback loops,light sensing, and transcription repression of wc-2. J. Biol. Chem. 278, 3801–3808.

Chet, I., Henis, Y., 1975. Sclerotial morphogenesis in fungi. Ann. Rev. Phytopathol.13, 169–192.

Chomczynski, P., 1992. One-hour downward alkaline capillary transfer for blottingof DNA and RNA. Anal. Biochem. 201, 134–139.

Corrochano, L.M., Cerdá-Olmedo, E., 1991. Photomorphogenesis in Phycomyces andin other fungi. Photochem. Photobiol. Sci. 54, 319–327.

Corrochano, L.M., 2007. Fungal photoreceptors: sensory molecules for fungaldevelopment and behaviour. Photochem. Photobiol. Sci. 6, 725–736.

Crosson, S., Rajagopal, S., Moffat, K., 2003. The LOV domain family:photoresponsive signaling modules coupled to diverse output domains.Biochemistry 42, 2–10.

Daiyasu, H., Ishikawa, T., Kuma, K.I., Iwai, S., Todo, T., Toh, H., 2004. Identification ofcryptochrome DASH from vertebrates. Genes Cells 9, 479–495.

Di Pietro, A., Roncero, M.I.G., 1998. Cloning, expression, and role in pathogenicity ofpg1 encoding the major extracellular endopolygalacturonase of the vascularwilt pathogen Fusarium oxysporum. Mol. Plant–Microb. Interact. 11, 91–98.

Dunlap, J.C., Loros, J.J., 2005. Neurospora photoreceptors. In: Briggs, W.R., Spudich,J.L. (Eds.), Handbook of Photosensory Receptors. Wiley-VCH, Weinheim, pp.371–389.

Elvin, M., Loros, J.J., Dunlap, J.C., Heintzen, C., 2005. The PAS/LOV protein VIVIDsupports a rapidly dampened daytime oscillator that facilitates entrainment ofthe Neurospora circadian clock. Genes Dev. 19, 2593–2605.

Emanuelsson, O., Nielsen, H., Brunak, S., von Heijne, G., 2000. Predicting subcellularlocalization of proteins based on their N-terminal amino acid sequence. J. Mol.Biol. 300, 1005–1016.

Facella, P., Lopez, L., Chiappetta, A., Bitonti, M.B., Giuliano, G., Perrotta, G., 2006.CRY-DASH gene expression is under the control of the circadian clockmachinery in tomato. FEBS Lett. 580, 4618–4624.

Flaherty, J.E., Dunkle, L.D., 2005. Identification and expression analysis of regulatorygenes induced during conidiation in Exserohilum turcicum. Fungal Genet. Biol.42, 471–481.

Galland, P., 1992. Forty years of blue-light research and no anniversary. Photochem.Photobiol. 56, 847–853.

Godoy, G., Steadman, J.R., Dickman, M.B., Dam, R., 1990. Use of mutants todemonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorumon Phaseolus vulgaris. Physiol. Mol. Plant Pathol. 37, 179–191.

Gressel, J., Rau, W., 1983. Photocontrol of fungal development and Photomorphogenesis.In: Shropshire, W., Mohr, H. (Eds.), Encyclopedia of Plant Physiology, New Series.Springer-Verlag, New York, pp. 603–639.

He, Q., Cheng, P., Yang, Y., Wang, L., Gardner, K.H., Liu, Y., 2002. White collar-1, aDNA binding transcription factor and a light sensor. Science 297, 840–843.

He, Q., Liu, Y., 2005. Molecular mechanism of light responses in Neurospora: fromlight-induced transcription to photoadaptation. Genes Dev. 19, 2888–2899.

Herrera-Estrella, A., Horwitz, B.A., 2007. Looking through the eyes of fungi:molecular genetics of photoreception. Mol. Microbiol. 64, 5–15.

Hitomi, K., Okamoto, K., Daiyasu, H., Miyashita, H., Iwai, S., Toh, H., Ishiura, M., Todo,T., 2000. Bacterial cryptochrome and photolyase: characterization of twophotolyase-like genes of Synechocystis sp. PCC6803. Nucleic Acids Res. 28,2353–2362.

Horwitz, B.A., Berrocal, T.G., 1997. A spectroscopic view of some recent advances inthe study of blue light photoreception. Bot. Acta 110, 360–368.

Huang, Y., Baxter, R., Smith, B.S., Partch, CL., Colbert, C.L., Deisenhofer, J., 2006.Crystal structure of cryptochrome 3 from Arabidopsis thaliana and itsimplications for photolyase activity. Proc. Natl. Acad. Sci. USA 103, 17701–17706.

Hutchens III, A.R., 2005. Ambient pH-and carbon-regulated gene expression in thenecrotrophic phytopathogen Sclerotinia sclerotiorum. M.S. Thesis. University ofFlorida.

Islam, S.Z., Honda, Y., Sonhaji, M., 1988. Phototropism of conidial germ tubes ofBotrytis cinerea and its implication in plant infection processes. Plant Dis. 82,850–856.

Jurick, W.M., Rollins, J.A., 2007. Deletion of the adenylate cyclase (sac1) gene affectsmultiple developmental pathways and pathogenicity in Sclerotinia sclerotiorum.Fungal Genet. Biol. 44, 521–530.

Kleine, T., Lockhart, P., Batschauer, A., 2003. An Arabidopsis protein closely related toSynechocystis cryptochrome is targeted to organelles. Plant J. 35, 93–103.

Lin, C., 2002. Blue Light receptors and signal transduction. Plant Cell 14, S207–S225.Lin, C., Todo, D., 2005. The cryptochromes. Genome Biol. 6, 220.Lin, C., Shalitin, D., 2003. Cryptochrome structure and signal transduction. Annu.

Rev. Plant Biol. 54, 469–496.Linden, H., Ballario, P., Macino, G., 1997. Blue light regulation in Neurospora crassa.

Fungal Genet. Biol. 22, 141–150.Liu, Y., He, Q., Cheng, P., 2003. Photoreception in Neurospora: a tale of two White

Collar proteins. Cell. Mol. Life Sci. 60, 2131–2138.Lorang, J.M., Tuori, R.P., Martinez, J.P., Sawyer, T.L., Redman, R.S., Rollins, J.A.,

Wolpert, T.J., Johnson, K.B., Rodriguez, R.J., Dickman, M.B., Ciuffetti, L.M., 2001.Green fluorescent protein is lighting up fungal biology. Appl. Environ. Microbiol.67, 1987–1994.

Navarro, E., Lorca-Pascual, J., Quiles-Rosillo, M., Nicolás, F., Garre, V., Torres-Martínez, S., Ruiz-Vázquez, R., 2001. A negative regulator of light-inducible carotenogenesis in Mucor circinelloides. Mol. Genet. Genomics266, 463–470.

Ng, W.O., Pakrasi, H.B., 2001. DNA photolyase homologs are the major UV resistancefactors in the cyanobacterium Synechocyctis sp. PCC 6803. Mol. Gen. Genet. 264,924–930.

Pall, M.L., Brunelli, J.P., 1993. A series of six compact fungal transformation vectorscontaining polylinkers with multiple unique restriction sites. Fungal Genet.Newsl. 40, 59–62.

Purschwitz, J., Muller, S., Kastner, C., Fischer, R., 2006. Seeing the rainbow:lightsensing in fungi. Curr. Opin. Microbiol. 9, 566–571.

Rollins, J.A., 2003. The Sclerotinia sclerotiorum pac1 gene is required for sclerotialdevelopment and virulence. Mol. Plant–Microb. Interact. 16, 785–795.

Rollins, J.A., Dickman, M.B., 2001. pH signaling in Sclerotinia sclerotiorum:identification of a pacC/RIM1 homologue. Appl. Environ. Microbiol. 67, 75–81.

Rosales-Saavedra, T., Esquivel-Naranjo, E.U., Casas-Flores, S., Martinez-Hernandez,P., Ibarra-Laclette, E., Cortes-Penagos, C., Herrera-Estrella, A., 2006. Novel light-regulated genes in Trichoderma atroviride: a dissection by cDNA microarrays.Microbiology 152, 3305–3317.

Russo, G.M., Dahlberg, K.R., Van Etten, J.L., 1982. Identification of a development-specific protein in sclerotia of Sclerotinia sclerotiorum. Exp. Mycol. 6, 259–267.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A laboratory manual. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sancar, A., 1994. Structure and function of DNA photolyase. Biochemistry 33, 2–9.Sancar, A., 2003. Structure and function of DNA photolyase and cryptochrome blue-

light photoreceptors. Chem. Rev. 103, 2203–2237.Schmoll, M., Franchi, L., Kubicek, C.P., 2005. Envoy, a PAS/LOV domain protein of

Hypocrea jecorina (Anamorph Trichoderma reesei), modulates cellulase genetranscription in response to light. Eukaryot. Cell 4, 1998–2007.

1276 S. Veluchamy, J.A. Rollins / Fungal Genetics and Biology 45 (2008) 1265–1276

Schwerdtfeger, C., Linden, H., 2000. Localization and light-dependentphosphorylation of white collar 1 and 2, the two central components of bluelight signaling in Neurospora crassa. Eur. J. Biochem. 267, 414–421.

Schwerdtfeger, C., Linden, H., 2003. VIVID is a flavoprotein and serves as a fungalblue light photoreceptor for photoadaptation. EMBO J. 22, 4846–4855.

Selby, C.P., Sancar, A., 2006. A cryptochrome/photolyase class of enzymes withsingle-stranded DNA-specific photolyase activity. Proc. Natl. Acad. Sci. USA, 1–5.

Sharrock, R.A., Mathews, S., 2006. Phytochrome genes in higher plants: Structure,expression and evolution. In: Schäfer, E., Nagy, F. (Eds.), Photomorphogenesis inPlants and Bacteria, third ed. Springer, Dordrecht, The Netherlands, pp. 99–129.

Shrode, L.B., Lewis, Z.A., White, L.D., Bell-Pedersen, D., Ebbole, D.J., 2001. vvd isrequired for light adaptation of conidiation-specific genes of Neurospora crassa,but not circadian conidiation. Fungal Genet. Biol. 32, 169–181.

Somers, D.E., Kim, W.-Y., Geng, R., 2004. The F-box protein ZEITLUPE confersdosage-dependent control on the circadian clock, photomorphogenesis, andflowering time. Plant Cell 16, 769–782.

Steadman, J.R., 1979. Control of plant diseases caused by Sclerotinia species.Phytopathology 69, 904–907.

Sun, P., Yang, X.B., 2000. Light, temperature, and moisture effects on apotheciumproduction of Sclerotinia sclerotiorum. Plant Dis. 84, 1287–1293.

Talora, C., Franchi, L., Linden, H., Ballario, P., Macino, G., 1999. Role of a white collar-1-white collar-2 complex in blue-light signal transduction. EMBO J. 18, 4961–4968.

Thaning, C., Nilsson, H.-E., 2000. A narrow range of wavelengths active in regulatingapothecial development in Sclerotinia sclerotiorum. Phytopathology 148, 627–631.

Willets, H.J., Bullock, S., 1992. Developmental biology of Sclerotinia. Mycol. Res. 96,801–816.

Willets, H.J., Wong, J.A.L., 1980. The biology of Sclerotinia sclerotiorum, S. trifoliorum,and S. minor with emphasis on species nomenclature. Bot. Rev. 46, 101–165.

Worthington, E.N., Kavakli, H., Berrocal-Tito, G., Bondo, B.E., Sancar, A., 2003.Purification and characterization of three members of the photolyase/cryptochrome family blue-light photoreceptors from Vibrio cholerae. J. Biol.Chem. 278, 39143–39154.

Yelton, M.A., Hamer, J.E., Timberlake, W.E., 1984. Transformation of Aspergillusnidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 81, 1470–1474.