Seminar Tugas Akhir Heteroplasmi pada Gen 12S rRNA mtDNA Penderita Diabetes Mellitus Tipe 2

download Seminar  Tugas Akhir Heteroplasmi pada Gen 12S  rRNA mtDNA Penderita Diabetes Mellitus  Tipe  2

of 24

  • date post

  • Category


  • view

  • download


Embed Size (px)


Sofi Siti Shofiyah 10506063 Pembimbing : Achmad S. Noer , Ph.D. Seminar Tugas Akhir Heteroplasmi pada Gen 12S rRNA mtDNA Penderita Diabetes Mellitus Tipe 2. Agenda Presentasi. Pendahuluan Metodologi Penelitian Hasil Penelitian Pembahasan Kesimpulan. Pendahuluan. DNA Mitokondria. - PowerPoint PPT Presentation

Transcript of Seminar Tugas Akhir Heteroplasmi pada Gen 12S rRNA mtDNA Penderita Diabetes Mellitus Tipe 2

  • Sofi Siti Shofiyah10506063

    Pembimbing: Achmad S. Noer, Ph.D

    Seminar Tugas Akhir

  • Pendahuluan Metodologi Penelitian Hasil Penelitian Pembahasan Kesimpulan 27 Mei 2010*Seminar Tugas Akhir / 24

    Seminar Tugas Akhir

  • Seminar Tugas Akhir

  • *27 Mei 2010Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: KesimpulanLaju Mutasi mtDNA 10 x lebih cepat dibandingkan DNA inti mitochondrial disease

    Fokus penelitian merupakan gen 12S rRNA

    Seminar Tugas Akhir

    Seminar Tugas Akhir

  • Diabetes mellitus adalah penyakit yang ditandai dengan peningkatan kadar gula darah yang terus menerus.

    Penderita diabetes di Indonesia mencapai angka 8,4 juta di tahun 2004 dan akan meningkat pada 2030 menjadi sebanyak 21,3 juta penderita (WHO,2004)

    27 Mei 2010* /24Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: KesimpulanSeminar Tugas Akhir

    Jenis Diabetes Mellitus Tipe I Insulin-dependent diabetes

    Kerusakan sel -pankreasTipe II Non-insulin-dependent diabetes

    Maternally Inherited Diabetes (Mutasi A3243G)

    Seminar Tugas Akhir

  • Heteroplasmi adalah campuran antara mtDNA termutasi dan normal pada satu sel27 Mei 2010*/24Seminar Tugas AkhirPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • 27 Mei 2010Seminar Tugas Akhir*/24Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan1234

    Seminar Tugas Akhir

  • Sampel urin penderita diabetes merupakan sampel yang tidak positif PASA (PCR Alelle Specific Alignment) A3243 G Penelitian sebelumnya (Maksum, 2009) menduga adanya heteroplasmi pada sampel di daerah gen 12s rRNA27 Mei 2010*/24Seminar Tugas AkhirT1420GT1349GPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • 27 Mei 2010Seminar Tugas Akhir*

    Seminar Tugas Akhir

  • */24Amplifikasi dengan PCR ElektroforesisAnalisis in silicoScreening dan Isolasi PlamidSequencingDirect SequencingKloning genPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

  • 27 Mei 2010*/242491Seminar Tugas AkhirPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Primer Urutan 5 3Posisi Ukuran Afor (PCR) CCTCCCACTCCCATACTACTAA458-47922 nukleotida Arev (PCR)GGGGTAAGATTTGCCGAGT2491-247319 nukelotida2f (Seqeuencing)GAACACTACGAGCCACAGC1138-115620 nukelotida

    Seminar Tugas Akhir

  • 27 Mei 2010*/24Seminar Tugas AkhirPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • 27 Mei 2010Seminar Tugas Akhir*

    Seminar Tugas Akhir

  • 27 Mei 2010*/24Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: KesimpulanSeminar Tugas Akhir

    Seminar Tugas Akhir

  • 27 Mei 2010*/24Seminar Tugas AkhirPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • 27 Mei 2010*/24Marker 7 9 14Ukuran tidak dapat ditentukan dengan jelas Seminar Tugas AkhirPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • 27 Mei 2010*/24 Marker 79 141kb DNA ladder 20.000 pb

    5.000 pb

    1.500 pb

    500 pb

    75 kb

    Sampel berukuran 5 kbSeminar Tugas AkhirPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • 27 Mei 2010*/24Seminar Tugas AkhirPendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • 27 Mei 2010*/24 Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: KesimpulanPenelitian Sebelumnya Perlakuan 1 (PCR) Perlakuan 2 (Kloning gen)(Maksum, 2009)Seminar Tugas AkhirPerlakuan 1Perlakuan 2Maksum, 2009Tidak adanya mutasi pada perlakukan 1 dan 2 pada posisi 1349 dan 1420 dibandingkan dengan penelitian sebelumnya

    Seminar Tugas Akhir

  • Ditemukan mutasi yang ada pada setiap sampel, yaitu A1438G

    Terdapat mutasi lain pada sampel hasil kloning 7 , yaitu G1485A27 Mei 2010*/24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • Mutasi A1438G (Ada pada setiap sampel) dilaporkan di database Mitomap sebagai mutasi yang berkaitan dengan diabetes mellitus (Tawata, 1998)

    Mutasi G1485A belum dilaporkan ke Mitomap 27 Mei 2010*/24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    SindromLocusPenyakit AlelRNAHoHeStatusDiabetes Mellitus MTRNR1DM C1310T12S+-Prov Diabetes Mellitus MTRNR1DMA1438G12S+-ProvDiabetes Mellitus MTTL1DM/DMDFA3243GtRNALeu-+Cfrm

    Seminar Tugas Akhir

  • Sampel merupakan penderita diabetes mellitus tanpa penyakit neuropatik yang menyertai sehingga mutasi yang diperoleh diperkirakan berkaitan dengan penyakit diabetes mellitus.

    27 Mei 2010*/24Seminar Tugas Akhir Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Mutasi Penelitian SebelumnyaPerlakuan 1(PCR) Perlakuan 2 (Kloning)T1349G--T1420G--A1438GG1485A--

    Seminar Tugas Akhir

  • Sampel bersifat heteroplasmi karena memiliki campuran mtDNA termutasi yang berbeda antara perlakuan 1, perlakuan 2, dan penelitian sebelumnya

    Terdapat mutasi A1438G pada sampel dengan perlakuan PCR dan kloning yang dilaporkan berkaitan dengan diabetes mellitus

    Terdapat mutasi yang belum dilaporkan, G1485A, pada sampel dengan perlakuan 2 (kloning)27 Mei 2010Seminar Tugas Akhir*/24Pendahuluan :: Metodologi Penelitian :: Hasil :: Pembahasan :: Kesimpulan

    Seminar Tugas Akhir

  • TERIMA KASIH27 Mei 2010*/24Seminar Tugas Akhir

    Seminar Tugas Akhir
