Penuntun Latihan Keterampilan Klinik 1Statistika Deskriptif

A. Pendahuluan1. Latar BelakangBerdasarkan standar kompetensi dokter Indonesia, dinyatakan bahawa kemamopuan communication and recording harus mencapai tingkat empat yaitu mampu melakukan mandiri . salah satu komponennya adalah kemampuan memproses dan menerapkan informasi terutama dari literature ilmiah. Oleh karena itu , dipilihlah teknik statistika deskriftif sebagai materi pada latihan keterampiulan BlokIII mengenai Metode penelitian ini.2. Tujuan pembelajaran2.1 tujuan umumsetelah kegiatan ini diharapkan mahasiswa mampu mengolah data dengan menggunakan statistic deskriptif.2.2 Tujuan khusussetelah kegiatan ini diharapkan mahasisiwa mampu :1. mengetahui arti dan tujuan statistika deskriptif2. mengetahui tekhnik perhitungan dan penyajian statistka deskriptif3. mengolah data secara statistic untuk disajikan dalam bentuk deskriptif3. Metode Pembelajaran1. instruktur memnjelaskan tentang komponen-komponen statistika deskriptif2. mahasiswa dibagi menjadi 10 oarang perkelompok dan di bombing oleh satu orang instruktur3. mahasiswa diminta secara berkelompok diminta untuk melakukan langkah-langkah statistika deskriptif4. mahasiswa menerima umpan balik dari insturktur tentang hasil statistika deskriptif masing-masing mahasiswa 5. mahasiswa membuat laporan kelompok setelah proses LKK berakhir.B. Pelaksanaan 1. Panduan belajar telaah jurnal1.1 Landasan teoriStatistika deskriptif digunakan untuk menjelaskan gambaran dasar dari sebbuah data penelitian tanpa melakukan anlisis dan membuat kesimpulan yang berlaku umum. Gambaran dasar akan ditampilkan dalam berbagai bentuk, ysitu angka, tabel, grafik, diagram, dan lain-lain.Beberapa jenis data yaitu nominal, ordinal, interval dan rasio.Statistika deskriptif terdiri atas1. Distibusi : frekuensi, distribusi frekuensi dalam bentuk tabel/histogram/ bar chart 2. Tendensi sentral : mean ,median ,mode3. Disperse : rentang angka (range), varians, standar deviasSajian data deskriptif a. Tabelb. Tabel distribusi frekuensic. Grafikd. Diagramlingkar (pie chart)e. Pictogram (grafik gambar)1.2 Media Pembelajaran1. Penuntun LKK 1 Blok 3 FK UMP2. Komputer3. Perangkat Lunak Analisi Data (SPSS)1.3 Langkah Kerja1. Mahasiswa memasukan data panjang jari seluruh mahasiswa angkatannya2. Mahasiswa menggolongkan jenis data yang tersedia3. Mahasiswa menghitung statistika deskriptif4. Mahasiswa membuat sajian data deskriptif secara kreatif berdasarkan ketentuan statistika deskriptif5. Mahasiswa menyajikan di ruang masing-masing hasil sajiannya, sementara instruktur member penilaian6. Instruktur memberi komentar terakhirC. Penutup 1. Evaluasi formatif1.1 Evaluasi formatif dilakukan dengan mengobservasi kegiatan yang dilakukan oleh mahasiswa selama proses keterampilan klinik oleh instruktur.1.2 Indikator pencapaianIndicator pencapaian berupa hasil capaian sasaran pembelajaran yang diperoleh mahasiswa pada setiap kegiatan keterampilan klinik.1.3 umpan balikumpan balik dilakukan oleh instruktur berupa masukan terhadap hasil kegiatan keterampilan klinik mahasiswa.2. Evaluasi sumatifEvaluasi keterampilan akan dilaksanakan secara kmprenhensif pada OSCE.2.2 instument evaluasi statistic deskriptif

NoNama MahasiswaTinggi Badan (cm) Berat Badan (kg)Ukuran sepatu

70 2011SitiKusumaning Tyas1534737

70 2011Yolanda Rachmi Nuraini1585039

70 2011Cendy Arizona1483836

70 2011Lisa wendy astute1585039

70 2011Fabiola dwita rosyadi1564340

70 2011Monikas sari sinum1608339

70 2011Indria rizki1584238

70 2011Rista purnama1504537

70 2011Dwi indah pertiwi1675239

70 2011Dera apriyunita1605037

70 2011Purry ayu Olivia1574038

70 2011Risma kurniasih1736841

70 2011Poppy Geraldine1685840

70 2011Racmi arhyun Thama1554038

70 2011Geta viruca mei vila1625940

70 2011Perda angraini1555139

70 2011Rika puspasari1584440

70 2011Erika fitriani1564840

70 2011Suci lestari1534739

70 2011Tri anggun utami1606540

70 2011Santhy annisa1675541

70 2011Evi mayasari1473937

70 2011Ika arizka1544238

70 2011Dian wijayanti1586540

70 2011Anisa penidaria1644240

70 2011Febyenne vasilefa1657940

70 2011Ira maulani 1655540

70 2011Nedya belinawati1607038

70 2011Utin karmila1564336

70 2011Ani isnaini syawal1606640

70 2011Marmah oktaria1635339

70 2011Zulia navira1625539

70 2011sulastri1655040

70 2011Tantri rahma viqo1565538

70 2011Mashita prilina yusnar1456338

70 2011Lilia muspida1627340

70 2011Umi chusnul chotimah1644839

70 2011Maya agustin1594640

70 2011Yulisti fitri utami1595437

70 2011Merri febriyanti1595038

70 2011Selina heraris1645841

70 2011destrianti1595038

70 2011Ayu aryani1625039

70 2011Apprilia ayu fransiska1554537

70 2011Veranika antonia1525137

Data mahasiswa laki-lakiNoNama Mahasiswa Tinggi badan (cm)Berat badan (kg)Ukuran sepatu

70 2011Zukhruful muzakkie1756042

70 2011Eksaka fajar nata1737341

70 2011M. aulia saputra1675241

70 2011Wendra armansyah1755542

70 2011Putra manggala wicaksana1697540

70 2011Imam taqwa1725542

70 2011Nursin mukhlis1706841

70 2011Aldieo Hartman fahreza1756844

70 2011Hendra ercha riri1715641

70 2011Syafar agus anasleo1625842

70 2011Eldhi aprian1705041

70 2011Fadil ramadhan1627640

70 2011M. fajar setiabudi1706040

70 2011Irvandra avren1666842

70 2011Andreas saputra1634938

70 2011M. Apriliandy shariff1717342

70 2011Ridwan permana1695441

70 2011Febry setiawan1799642

70 2011K. ahmad imannudin1625540

70 2011Nur habib1676241

1. Mean,Median,Modus,Standar Deviasi Tinggi Badan Mahasiswa FK UMP Angkatan 2011NoTinggi badanxFrekuensi (f)x.fX2.f

145114521025

147114721609

148114821904

150115022500

152115223104

153230646818

154115423716

155346572075

156462497344

157115724649

1585790124820

1594636101124

1605800128000

16271134183708

163232653138

164349280688

165349581675

166116627556

1674668111556

168116828224

169233857122

170351086700

171234258482

172117229584

173234659858

175352591875

179117932041

JUMLAH6510535

1710895

a. Mean 10535 : 65 =162,0769

a. Median162b. Modus162c. Standar Deviasi

2. Mean, Modus, Median,dan standar deviasi Berat BadannoBerat Badan (kg)Frekuensi (f)X2.f

13811444

23911521

34023200

44235292

54323698

64423872

74512025

84624232

94724418

104812304

114912401

1250820000

135125202

145225408

155312809

165425832

1755721175

195613136

2058310092

215913481

226027200

236213844

246313969

256528450

266614356

2768418496

287014900

2973315987

307515625

317615776

327916241

338316889

349619216

jumlah364065212491

a. Mean3640 : 65 =56b. Modus50c. Median54d. Standar Deviasi11,811

3. Mean,Modus, Median, Standar Deviasi Ukuran Sepatu Angkatan 2011 FK UMPNoUkuran SepatuFrekuensi (f)X2..f

13622592

23779583

3381014440

4391015210

5401828800

6411016810

742712348

84411936

Jumlah65101719

a. Mean2569 : 65 =39,52

b. Modus40c. Median40d. Standar Deviasi1,69

THE ASSOCIATION BETWEEN ENVIRONMENTAL FACTORS AND TUBERCULOSIS INFECTION AMONG HOUSEHOLD CONTACTS

Songpol Tornee1, Jaranit Kaewkungwal1, Wijitr Fungladda1, Udomsak Silachamroon2, Pasakorn Akarasewi3 andPramuan Sunakorn31Department of Social and Environmental Medicine, 2Department of Clinical Tropical Medicine, Faculty ofTropical Medicine, Mahidol University, Bangkok; 3Department of Disease Control, Ministry of Public Health,Nonthaburi, ThailandAbstract. A cross-sectional study was conducted to determine the association between environmental factorsand tuberculosis infection among household contacts aged less than 15 years in Bangkok, Thailand, betweenMay and December 2003. During the study period, 480 household contacts aged under 15 years were identified.The prevalence of tuberculosis infection among household contacts was 47.08% (95% CI = 42.60-51.56). Ageneralized estimating equation (GEE) indicated that the risk of positive tuberculin skin testing in householdcontacst was found to increase with household crowding. Children living in a crowded household were fivetimes more likely to have tuberculosis infection (OR = 5.19, 95% CI = 2.65-8.69). The association betweenenvironmental factors and tuberculosis infection assists community tuberculosis staff in understanding the risksfor tuberculosis infection in the community and planning appropriate preventive actions based on this risk.INTRODUCTIONTuberculosis is one of the most neglected healthcrises and is out of control in many parts of the world (WHO, 1998). The World Health Organization estimated that at least 180 million children aged lessthan 15 years were infected with Mycobacterium tuberculosis worldwide (Dolin et al, 1994).Approximately one-third of the population of Thailandis infected with tuberculosis and nearly 100,000 Thai people suffer from active tuberculosis every year (WHO, 1999). Nearly 20% of people with tuberculosis live in Bangkok, where one-sixth of Thailands totalpopulation lives (WHO, 1998).The risk for infection is particularly high among close contacts of infectious patients (CDC, 1995). These close contacts are usually family members. The assumption exists that transmission of TB to children is typically from parents to children through household contact (Wells and Nelson, 2004). One tuberculosis patient can spread M. tuberculosis to the other 10 persons who may be living in the house. Tuberculosis transmission occurs by airborne spread of infectious droplets. Transmission generally occurs indoors, where droplet nuclei can stay in the air for a long time (WHO,1997). Droplet nuclei can remain suspended in the air for several hours, depending on the environment.The association between environmental factors and tuberculosis infection has long been recognized (Clark et al, 2002), and tuberculosis transmission has long been known to be associated with poor ventilation (Sepkowitz, 1996). Overcrowded housing conditions can increase exposure of susceptible people to those with infectious respiratory disease, and may increase the probability of transmission. This study was thus conducted to determine the association between environmental factors and tuberculosis infection among household contacts aged less than 15 years in Bangkok, Thailand. This study was reviewed and approved by the Ethics Committee of the Ministry of Public Health and the Ethics Committee of the Bangkok Metropolitan Administration (BMA).

MATERIALS AND METHODSCorrespondence: Songpol Tornee, Department of Health Education, Faculty of Physical Education, Srinakharinwirot University, Sukhumvit Road,Bangkok 10110, Thailand. E-mail: songpoltor@yahoo.com

Study population and data collection techniquesThe index cases included sputum smear-positive pulmonary tuberculosis patients aged over 15 yearsold who registered for tuberculosis treatment at Bangkok Chest Clinic under the Ministry of Public Health and Health Care Centers under the Bangkok Metropolitan Administration, between May and December 2003. All of the identified household contacts 15 years who had at least one household contact aged 50% to 4%15% [79], and it was the drug of choice for thousands of patients treated in Vietnam in the period of 19601975 [1014]. Chloramphenicol and tetracyclines were also effective and widely used [15]. Of the 2 countries with the highest incidence of plague, streptomycin is used mainly in Madagascar, and tetracycline is used mainly in Tanzania [16, 17]. However, the manufacture of streptomycin and chloramphenicol has been curtailed in many countries, because of the drugs' toxicities. Although these and other antimicrobial drugs have been used, only doxycycline, demeclocycline, minocycline, tetracycline, and streptomycin are currently approved by the US Food and Drug Administration (FDA) for the treatment of plague. Several newer antimicrobial drugs, including gentamicin, are effective against Y. pestis in vitro [1821] and in experimental animal infections [2224]. A recent retrospective analysis of human cases has recently been reported [25], but there has not been a controlled, prospective assessment of human infection. The following clinical trial was conducted to test the efficacy and safety of gentamicin for the purpose of expanding the options of effective treatment. MethodsStudy design and sample size. The study intended to compare gentamicin and the standard drug, doxycycline, as monotherapy for plague. The design was a randomized, controlled, comparative, superiority, open-label trial. The sample size was calculated to show a difference in response rates, with respect to prompt cure or improvement of condition among febrile patients with less tender buboes within 3 days, of 50%. If we assume that standard therapy (given to the control group) will result in a 60% rate of prompt cure or improvement of condition (the other 40% being a result of receiving delayed treatment and/or having a complicated or fatal course, as occurred in Madagascar in 1997) [26], then 30 patients in each treatment group will be required to reach a significance level of .05 (; 2-sided) and .20 (; 1-sided) [27]. The method of randomization included the use of random number tables with variable permuted block sizes. Each patient's treatment group assignment was sealed in an envelope that was opened after the patient was selected and gave consent to enter the trial [2830]. Informed consent and entry criteria. The study was approved by the Tanzanian National Institute for Medical Research. Informed consent was obtained from all eligible patients or their legal guardians. The consent form explained the purpose of the trial, procedures, risks (allergic reactions, renal failure, deafness, vertigo, or worsening of clinical condition), and voluntary participation. Before enrolling the patient, the investigator explained verbally in the patient's own language the content of the consent form. Inclusion criteria included persons of all ages and both sexes who lived in regions where plague is endemic and who presented with histories of 3 days of fever and bubo (enlarged tender lymph nodes), pneumonia, or septicemia. Excluded subjects included pregnant or nursing women, persons who received >2 doses of pretreatment with an effective antimicrobial drug during the previous 3 days, persons who had an allergic reaction to either of the study drugs, and persons who had a significant underlying disease. Procedures. Bubo aspiration was performed by inserting a 10-ml syringe with a 21-gauge needle containing 1 cc of sterile saline, through the skin, into the bubo. The saline was injected and reaspirated until blood-tinged fluid appeared in the syringe. Drops were placed on slides for Gram staining and fluorescent antibody staining, and the remaining fluid was cultured on MacConkey agar and in trypticase soy broth. Blood samples used for culture were placed into trypticase soy broth. Bubo aspirate specimens were incubated at 25C for 48 h or until characteristic colonies were visible for placement onto nutrient agar slants for transport to the reference laboratory. Blood cultures were incubated for 48 h and subcultured on MacConkey agar, and characteristic colonies were placed on nutrient agar slants. Venous blood was drawn at the time of admission and on day 8 after the start of therapy, allowed to clot in a glass tube at room temperature for 30 min, and centrifuged at 1500 g for 10 min, and serum was removed and frozen for serologic testing and serum chemistry analysis. Serum creatinine concentration was observed to assess any renal effects caused by gentamicin during the course of therapy. Venous blood samples were also drawn for serum antibiotic measurements at peak times of 1 h after gentamicin injections and 2 h after receipt of doxycycline and at trough times of 12 h after receipt of antibiotics. Temperature, pulse, respirations, and blood pressure were measured twice daily for 7 days. Bubo length was measured, and severity of tenderness (mild, moderate, or severe) was assessed daily. Other symptoms and adverse effects of study drugs were elicited daily by means of follow-up systems review and physical examination. Because gentamicin can cause injury to the eighth nerve, ototoxicity was measured by equilibrium in the standing position and by changes in hearing acuity. One to 2 weeks after the end of therapy, patients were asked to return to the clinic for follow-up examination of symptoms and examination of the bubo. Antimicrobial treatment. Immediately after specimens were obtained for culture and patients were randomized, treatment was started and administered twice daily for 7 days. Gentamicin (Garamycin; Schering-Plough) was administered intramuscularly in 2.5-mg/kg doses. One hundredmg capsules of doxycycline (Vibramycin; Pfizer) were administered by mouth to adults, and children received powder from capsules suspended in 100 mL of water in 2.2-mg/kg doses, which they drank. Definitions of outcomes. Cure was defined as resolution of fever and painful bubo swelling, and, if initially present, recovery from pneumonia or any other symptoms of plague. Improvement of condition was defined as the persistence of any sign or symptom in a milder degree. Treatment failure was defined as a lack of improvement in condition, relapse, or death. Relapse was defined as the return of bubo tenderness, fever, or other symptoms within 12 weeks after the end of therapy. A confirmed microbiological diagnosis was based on positive culture results and/or results of serological tests of the clinical samples sent to a reference laboratory. If the clinical sample only tested positive at the local laboratory, a presumptive microbiological diagnosis was assigned. Reference laboratories. At Texas Tech University Health Sciences Center (Lubbock), NCCLS-approved standard assays were used to determine antimicrobial susceptibility using disk diffusion on Mueller-Hinton agar (Difco Detroit) in 150 15mm petri dishes and using Escherichia coli ATCC 25922 as a control. Paper disks (Becton Dickinson) were used with the following drugs, with zone diameters to define susceptibility: 10 g of ampicillin (zone diameter, 14 mm), 30 g of chloramphenicol (zone diameter, 18 mm), 5 g of ciprofloxacin (zone diameter, 21 mm), 30 g of doxycycline (zone diameter, 16 mm), 10 g of gentamicin (zone diameter, 15 mm), 10 g of streptomycin (zone diameter, 10 mm), 30 g of tetracycline (zone diameter, 19 mm), and 1.25/23.7 g of trimethoprim-sulfamethoxazole (zone diameter, 16 mm) [31, 32]. MICs were determined in a tube dilution assay using Mueller-Hinton II broth containing gentamicin sulfate and doxycycline hydrochloride (Sigma-Aldrich). Serum creatinine concentrations were measured by an enzymatic slide method using a Vitros 950 analyzer (Ortho-Clinical Diagnostics). The reference interval for creatinine level in healthy control subjects was 0.71.5 mg/dL. Gentamicin concentrations in serum were measured by fluorescence polarization immunoassay (AxSYM; Abbott Laboratories). At the Fort Collins Laboratories of Centers for Disease Control and Prevention (CDC), cultures were confirmed as Y. pestis using phage lysis, and biotype was determined using nitrate reduction and glycerol fermentation [32]. Serological testing included passive hemagglutination and inhibition tests to detect antibodies against fraction 1 antigen of Y. pestis, with a diagnostic titer defined as 1:16 and capture of IgM and IgG against fraction 1 antigen of Y. pestis in ELISAs. The direct fluorescent antibody test for fraction 1 of Y. pestis was applied to slides of bubo aspirates and, if the result was positive, allowed for a presumptive diagnosis of plague. At Ricerca Biosciences (Concord, OH), doxycycline concentrations in serum were measured by liquid chromatographymass spectroscopy/mass spectroscopy. Data analysis. Outcomes in the treatment groups were compared by means of an intent-to-treat analysis for incidences of cures, condition improvements, and treatment failures and for incidences of adverse events by binomial 95% CIs [33, 34], using statistical software StatXact, version 5.0 (Cytel Software) and the 2 test. Means of continuous variables, such as creatinine concentration, were compared with student's t test. ResultsPatientsSixty-five patients were enrolled between January and April 2002 from the plague-endemic area. Thirty-five patients were randomized to receive gentamicin, and 30 were randomized to receive doxycycline (table 1). All patients had bubonic plague, with symptoms of fever and acute lymphadenitis, except for 1 patient who presented with septicemia 1 week after a bubo had been treated and had resolved, prior to entry into the study, and 1 patient with pneumonia and a bubo. Ages ranged from 7 months to 65 years, and younger children were, by chance, assigned to the gentamicin group, resulting in a younger median age for the gentamicin group. Men were predominant in both groups. Locations and sizes of buboes were similar for both groups. Temperatures increased to higher levels in the gentamicin group, resulting in a median temperature at the time of admission that was 0.5C higher than that in the doxycycline group. Serum creatinine concentrations were >1.5 mg/dL in only 2 patients in each treatment group, and the mean concentrations were similar for both treatment groups. The majority of patients in both groups (89% of the gentamicin group and 84% of the doxycycline group) had the diagnosis of plague confirmed by culture or serologic testing. Other patients had presumptive diagnoses confirmed by fluorescent antibody applied to bubo aspirates or by culture in the local laboratory. Only 2 patients, both in the gentamicin group, had no laboratory diagnosis of plague, and neither of them had convalescent-phase serum samples available for serologic testing.

Table 1.Characteristics of patients with plague before gentamicin or doxycycline treatment.

Identification and Susceptibilities of Y. pestisY. pestis was isolated from 30 patients and confirmed by phage lysis at the CDC (Fort Collins, CO). These isolates had been obtained from bubo aspirates of 29 patients and from a culture of blood obtained from 1 septicemic patient; the 30 confirmed isolates belonged to biotype antigua. All isolates were susceptible by disc diffusion to ampicillin, chloramphenicol, ciprofloxacin, doxycycline, gentamicin, streptomycin, tetracycline, and trimethoprim-sulfamethoxazole. The median MIC for each isolate tested, using the 23 results for each isolate, were 0.13 mg/L of gentamicin (range, 0.060.25 mg/L) for 30 isolates, and 0.25 mg/L of doxycycline for 18 isolates, and 0.50 mg/L of doxycycline for 12 isolates (range for both median values, 0.130.5). All isolates were susceptible to all tested antimicrobial drugs by disk diffusion. MICs of gentamicin and doxycycline that were low (in the range of 0.060.5 mg/L) confirmed that all isolates were susceptible to the study drugs. Response to Treatment and Adverse EventsThree patients died on days 1 and 2 after the start of therapy (table 2), 2 of whom were treated with gentamicin and 1 of whom was treated with doxycycline, and these deaths were attributed to advanced disease and complications at the time therapy was initiated. All other patients had favorable responses to treatment and were considered to be cured or to have had an improved condition after 7 days of treatment. The rates of favorable outcome were 94% (95% CI, 81.1%99.0%) for gentamicin and 97% (95% CI, 83.4%99.8%) for doxycycline. The estimated difference of response rates (gentamicin-doxycycline) was -3% (95% CI for true difference in response rates, -16.1% to 12.1%; P > .05). When patients returned for follow-up visits 12 weeks after the end of therapy, no relapses had occurred. Four patients failed to return for follow-up visits; 3 of these had received gentamicin, and 1 had received doxycycline. The patients who died are described as brief case reports.

Table 2. Clinical responses to gentamicin or doxycycline treatment.Case ReportsPatient 1. One day before admission, a 10-year-old girl suddenly developed fever, headache, submandibular swelling, and cough. On the same day, she experienced chills and myalgias and was observed to be delirious. She took a tablet of acetaminophen. On admission, she had a temperature of 41C, a pulse rate of 88 beats per min, and respirations of 24 per min. There was a submandibular lymph node that measured 2 2 cm. The chest exam showed coarse rales. No radiographic examination was available. She received 1 dose of gentamicin 40 mg intramuscularly. Three hours later, she was noted to have had a seizure, and she died. The bubo aspirate obtained before treatment tested positive for Y. pestis. This simultaneous presentation of pneumonia and submandibular bubo suggests that the patient was exposed to an aerosol of Y. pestis from another person with pneumonic plague and that the inoculum reached the lungs by inhalation at the same time as it did the submandibular lymph nodes through the oral mucosa. Patient 2. A 65-year-old woman developed a painful swelling in the right groin 7 days before admission. She treated herself with 8 tablets of tetracycline, and the swelling subsided. On the day of admission, she developed chills and myalgia. She did not have a bubo, her temperature was 38.5C, her pulse rate was 78 per min, she had respirations of 24 per min, and she had systolic/diastolic blood pressure of 110/70 mm Hg. She received gentamicin (80 mg intramuscularly), and she died 4 h later. Results of a blood culture performed before treatment were positive for Y. pestis. This patient with bubonic plague was partially treated with tetracycline, and the patient's condition improved clinically, but regrowth of residual bacteria in the blood caused fatal septicemia before the immune response was protective. Patient 3. A 34-year-old woman pregnant for 24 weeks developed fever, chills, headache, myalgias, and left inguinal swelling 2 days before admission. She aborted a dead fetus on the morning of admission. Her temperature was 38.8C, her pulse rate was 100 beats per min, she had respirations of 20 per min, and her systolic/diastolic blood pressure was 120/80 mm Hg. She had a tender left inguinal bubo that measured 5 2 cm. She was confused and had vaginal bleeding. She received doxycycline (100 mg orally) twice on the day of admission. She continued to have vaginal bleeding and received ergotamine injections. She died the next morning. A bubo aspirate obtained before treatment grew presumptive Y. pestis. Her serum creatinine concentration at admission was 3.0 mg/dL. This pregnant patient with presumptive bubonic plague died after an abortion, with complications of hemorrhage and prerandomization renal failure. Among the surviving patients, buboes responded with reduced tenderness and, in most patients, were smaller or had disappeared after 7 days of treatment. In 2 patients treated with gentamicin, buboes suppurated and spontaneously drained pus. Temperatures of most patients in both treatment groups, which were measured daily, promptly decreased to 3 days increased mortality and are largely responsible for a worldwide mortality rate of 7%; a mortality rate in the United States of 12%, which was reported to the World Health Organization in the 1990s [16]; and a mortality rate of 22% in a series study of selected patients in United States [35, 36]. These results indicate that gentamicin may be an effective alternative treatment to streptomycin as a drug of choice for the treatment of plague. Alternative therapies are needed because streptomycin is no longer available in most countries, because drug manufacturing has been severely curtailed. An exception is Madagascar, which manufactures its own drug and uses it to treat domestic cases of plague. In vitro plasmid-mediated resistance to streptomycin has been reported in Y. pestis isolated from 2 patients with bubonic plague in Madagascar in 1995; both of these patients survived their infections while receiving streptomycin, probably because they were treated concomitantly with trimethoprim-sulfamethoxazole, to which their isolates were susceptible. These streptomycin-resistant strains would have been susceptible to gentamicin because of the specificities of the responsible enzymes [37, 38]. Both antibiotics were well tolerated in these patients, with the infrequent occurrence of adverse events that were short lived. Most of the adverse events, which were symptoms and signs reported after treatment was initiated, were probably not caused by the drugs, because they included known nonspecific symptoms of plague infection, such as headache, cough, and gastrointestinal symptoms [35]. On the other hand, 4 patients treated with gentamicin had increases in their serum creatinine concentrations to >1.5 mg/dL at the end of therapy. It was not determined whether these increases in creatinine concentrations were reversible, because the study design did not include blood sampling at a subsequent visit. The mean serum creatinine concentration measured after treatment in gentamicin-treated patients was 1.04 mg/dL; this was in the normal range and represented a modest increase from the pretreatment mean of 0.78 mg/dL. Although the increases were determined to be statistically significant by a paired t test (P < .05), the clinical significance of the nephrotoxicity is doubtful. The serum creatinine concentration is sometimes elevated in patients with plague because of sepsis, especially in patients who have subsequent fatal outcomes [35]. The increases in serum creatinine concentrations in surviving patients treated with gentamicin were likely caused by gentamicin use, because patients treated with doxycycline did not show increases in their creatinine concentration. On testing, no gentamicin recipients had evidence of ototoxicity. It is likely that once daily administration could be effective in reducing the risk of renal toxicity and the cost and the logistics of twice-daily injections. Such a modification would need to be field tested. Both intravenous and intramuscular routes achieve similar serum concentrations. Clinical responses in surviving patients were prompt in both treatment groups, with temperatures normalizing after 1 day for most patients and buboes showing reduced size and tenderness over several days. These prompt responses suggest that treatment courses 15 h) and that our peak samples were obtained 2 h after the first dose, with the trough samples obtained later in the course of therapy, after a steady state had been achieved. Although the dosages of 100 mg orally twice daily for adults and 2.2 mg/kg twice daily for children were clinically effective, it has been advised to give loading doses of twice these amounts for the first 72 h and then, for the maintenance dose, to reduce the dose size by one-half [43]. The use of a loading dose of doxycycline followed by a once-daily administration should be considered for patients with plague, because life-threatening infections require early attainment of high-tissue concentrations of antibiotic.

AcknowledgmentsWe thank David Dennis and May Chu at the Centers for Disease Control and Prevention (Fort Collins, CO) for providing reference laboratory support, Juma Hamza at Gologolo Dispensary (Tanzania) for his assistance with patient care, and B.S. Kilonzo at Sokoine University (Morogoro, Tanzania) and Eligius Lyamuya at Muhimbili University (Dar Es Salaam, Tanzania) and Fred Marsik at the US Food and Drug Administration for technical advice. Manuscript preparation. William B. Greenough, III, and Mrs. Terri Rigsby (Johns Hopkins University, Baltimore, MD) helped with manuscript preparation because of T.B.'s incarceration in the Federal Medical Center, Fort Worth, Texas [44]. Financial support. US Food and Drug Administration and Center for Drug Evaluation and Research. Potential conflicts of interest. All authors: no conflicts. Footnotes The views expressed in this paper are those of the authors and must not be interpreted as the policies or guidance of the US Food and Drug Administration. Received July 27, 2005. Accepted November 2, 2005.

2006 by the Infectious Diseases Society of America References1. Dennis DT, Gage KL, Gratz N, Poland JD, Tikhomirov E. Plague manual: epidemiology, distribution, surveillance and control. Geneva: World Health Organization; 1999.2. Kool JL. Risk of person-to-person transmission of pneumonic plague. Clin Infect Dis 2005;40:1166-72.3. Welty TK, Grabman J, Kompare E, et al. Nineteen cases of plague in Arizona: a spectrum including ecthyma gangrenosum due to plague and plague in pregnancy. West J Med 1985;142:641-6.4. Campbell GL, Hughes JM. Plague in India: a new warning from an old nemesis. Ann Intern Med 1995;122:151-3.5. Inglesby TV, Dennis DT, Henderson DA, et al. Plague as a biological weapon: medical and public health management. JAMA 2000;283:2281-90.6. Eitzen E, Pavlin J, Cieslak T, Christopher G, Culpepper R, editors. Medical management of biological casualties. Handbook. Fort Detrick, MD: US Army Medical Research Institute of Infectious Diseases; 1998.7. Wagle PM. Recent advances in the treatment of bubonic plague. Indian J Med Sci 1948;2:489-94.8. Meyer KF. Modern therapy of plague. JAMA 1950;144:982-5.9. Datt Gupta AK. A short note on plague cases treated at Campbell Hospital. Ind Med Gaz 1948;83:150-1.10. Butler T. A clinical study of bubonic plague. Observations of the 1970 epidemic with emphasis on coagulation studies, skin histology, and electrocardiograms. Amer J Med 1972;53:268-76.11. Butler T, Levin J, Cu DQ, Walker RI. Bubonic plague: detection of endotoxemia with the limulus test. Ann Intern Med 1973;79:642-6.12. Butler T, Bell WR, Linh NN, Tiep ND, Arnold K. Yersinia pestis infection in Vietnam. I. Clinical and hematologic aspects. J Infect Dis 1974;129:78-84.13. Butler T, Levin J, Linh NN, Chau DM, Adickman M, Arnold K. Yersinia pestis infection in Vietnam II. Quantitative blood cultures and detection of endotoxin in the cerebrospinal fluid of patients with meningitis. J Infect Dis 1976;133:493-9.14. Butler T. Plague and other Yersinia infections. New York: Plenum; 1983. p. 178-82.15. McCrumb FR, Mercier S, Robic J, et al. Chloramphenicol and Terramycin in the treatment of pneumonic plague. Amer J Med 1953;14:284-93.16. Human plague in 1998 and 1999. Wkly Epidemiol Rec 2000;75:338-43.17. Kilonzo BS, Makundi RH, Mbise TJ. A decade of plague epidemiology and control in the Western Usambara mountains, north-east Tanzania. Acta Tropica 1992;50:323-9.18. Butler T. Yersinia species. In: Yu VL, Merigan TC, Barriere L, et al., editors. Antimicrobial therapy and vaccines. Baltimore: Williams and Wilkins; 1999. p. 488-91.19. Frean JA, Arntzen L, Capper T, Bryskier A. Klugman KP. In vitro activities of 14 antibiotics against 100 human isolates of Yersinia pestis from a southern African plague focus. Antimicrob Agents Chemother 1996;40:2646-7.20. Smith MD, Vinh DX, Hoa NTT, Wain J, Thung D, White NJ. In vitro antimicrobial susceptibilities of strains of Yersinia pestis. Antimicrob Agents Chemother 1995;39:2153-4.21. Wong JD, Barash JR, Sandfort RF, Janda JM. Susceptibilities of Yersinia pestis strains to 12 antimicrobial agents. Antimicrob Agents Chemother 2000;44:1995-6.22. Bonacorsi SP, Scavizzi MR, Guiyoule A, Amouroux JH, Carniel E. Assessment of a fluoroquinolone, three B-Lactams, two aminoglycosides and a cycline in treatment of murine Yersinia pestis infection. Antimicrob Agents Chemother 1994;38:481-6.23. Russell P, Eley SM, Bell DL, Manchee RJ, Titball RW. Doxycycline or ciprofloxacin prophylaxis and therapy against experimental Yersinia pestis infection in mice. J Antimicrob Chemother 1996;37:769-74.24. Byrne WR, Welkos SL, Pitt ML, et al. Antibiotic treatment of experimental pneumonic plague in mice. Antimicrob Agents Chemother 1998;42:675-81.25. Boulanger LL, Ettestad P, Fogarty JD, Dennis DT, Romig D, Mertz G. Gentamicin and tetracyclines for the treatment of human plague: review of 75 cases in New Mexico, 19851999. Clin Infect Dis 2004;38:663-9.26. Ratsitorahina M, Chanteau S, Rahalison L, Ratsifasomanana L, Boisier P. Epidemiological and diagnostic aspects of the outbreak of pneumonic plague in Madagascar. Lancet 2000;355:111-3.27. Young MJ, Bresnitz EA, Strom BL. Sample size nomograms for interpreting negative clinical studies. Ann Intern Med 1983;99:248-51.28. Hulley SB, Cummings SR, Browner WS, et al. Designing clinical research: an epidemiologic approach. Philadelphia: Lippincott Williams and Wilkins; 2001.29. Huitfeldt B. Statistical aspects of clinical trials of antibiotics in acute infections. Rev Infect Dis 1986;8(Suppl 3):350-7.30. Norrby SR. The design of clinical trials with antibiotics. Eur J Clin Microbiol Infect Dis 1990;9:523-9.31. Barry AL, Thornsberry C. Susceptibility testing: diffusion test procedures. In: Lennette EH, Balows A, Hausler WJ, Truant JP, editors. Manual of clinical microbiology. Third ed. Washington, DC: American Society for Microbiology; 1980. p. 464.32. Chu MC. Laboratory manual of plague diagnostic tests. Geneva, Switzerland: Centers for Disease Control and Prevention and World Health Organization; 2000.33. Blyth C, Still H. Binomial confidence intervals. J Am Stat Assoc 1983;78:106-16.34. Casella G. Refining binomial confidence intervals. Can J Stat 1986;14:113-29.35. Crook LD, Tempest B. Plague: a clinical review of 27 cases. Arch Intern Med 1992;152:1253-6.36. Gage KL, Dennis DT, Orloski KA, et al. Cases of cat-associated human plague in the Western US, 19771998. Clin Infect Dis 2000;30:893-900.37. Galimand M, Guiyoule A, Gerbaud G, et al. Multidrug resistance in Yersinia pestis mediated by transferable plasmid. N Engl J Med 1997;337:677-80.38. Guiyoule A, Gerbaud G, Buchrieser C, et al. Transferable plasmid-mediated resistance to streptomycin in a clinical isolate of Yersinia pestis. Emerg Infect Dis 2001;7:43-8.39. Blaser J, Konig C. Once-daily dosing of aminoglycosides. Eur J Clin Microbiol Infect Dis 1995;14:1029-38.40. Hatala R, Dinh T, Cook DJ. Once-daily aminoglycoside dosing in immunocompetent adults: a meta-analysis. Ann Intern Med 1996;124:717-25.41. Chanteau S, Rahalison L, Ralafiarisoa L, et al. Development and testing of a rapid diagnostic test for bubonic and pneumonic plague. Lancet 2003;361:211-6.42. Lyamuya EF, Nyanda P, Mohammedali H, Mhalu FS. Laboratory studies on Yersinia pestis during the 1991 outbreak of plague in Lushoto, Tanzania. J Trop Med Hyg 1992;95:335-8.43. Cunha B. Doxycycline re-visited. Arch Intern Med 1999;159:1006-7.44. Murray BE, Anderson KE, Arnold K, et al. Destroying the life and career of a valued physician-scientist who tried to protect us from plague: was it really necessary? Clin Infect Dis 2005;40:1644-8.FORMULIR LATIHAN TELAAH ARTIKEL RIVIEW

1. PENDAHULUAN1.Apakah pendahuluan menggambarkan isi utama penelitian?Ya,Karena bisa kita lihat dari bagian abstrak pada halaman 1 dan 2 telah menggambarkan isu utama dan mengapa penelitian ini dilakukan.

2.Apakah nama-nama tersebut telah dituliskan sesuai dengan aturan jurnal?Karena dalam jurnal ini diurutkan dari akhir ke awal bersarkan orang yang berpengaruh dalam penelitian tersebut.

3.Apakah sudah tercakup komponen IMRAD (Introduction,Methods,Results,Discussion)Ya, IMRAD telah dituliskan pada halaman pertama dan kedua.

4.Apakah keseluruhan abstrak informatif?Ya, karena selain ada bagian abstrak,bagian tujuan, hasil, metode, dan diskusi juga dituliskan dengan sumber yang terpercaya.

5.Apakah paragraf atau bagian pertama mengumukakan alasan dilakukannya penelitianPada paragraf pertama tidak mengemukakan alasan dilakukan penelitian,akan tetapi dari keseluruhan pendahuluan telaah menggambarkan alasan dilakukan penelitian.

6.Apakah paragraf atau bagian kedua menyatakan hipotesis atau tujuan penelitian dan desain yang digunakan?Ya. Bisa dillihat di dalam pendahhuluan.

7. Apakah pendahuluan didukung oleh pustaka yang kuat dan relevan?Ya,karena bisa dilihat daftar pustaka dituliskan pada halaman pertama dan kedua.

2. METODE

8.Apakah disebutkan desain,tempat dan waktu penelitian ?Ya.Desain dituliskan pada bagian methods,pada halaman pertama dan ketiga.Tempat penelitian sesuai dengan judul jurnal tempat dilaksanakan di Negara Tanzania.Waktu penelitian dilaksankan pada 27 Juli 2005.

9.Apakah disebutkan populasi sumber (populasi terjangkau)Populasi terjangkau tidak disebutkan karena penelitian yang dilakukan adalah system random,akan tetapi tempat atau negara populasi sumber adalah waga Negara Tanzania yang terjangkit wabah Pes.

10.Apakah criteria pemilihan (inklusi dan eksklusi disebutkan )Ya. Kriteria dapat kita lihat dalam metode halaman tiga dan empat, dimana criteria dijelaskan pada sub judul informed consentand entry criteria.

11.Apakah cara pemilihan subyek (teknik sampling disebutkan)

12.Apakah perkiraan besar sampel disebutkan dan disebut pula alsannya?Ya,besar sampel dapat kita lihat dalam metode yang ada pada halaman 1-3 dimana sampel itu sendiri diambil sebesar 65 orang. 35 orang menerima gentacimin dan 30 orang mendapatkan Doxycycline.

13.Apakah perkiraan besar sampel dihitung dengan rumus yang sesuai?Ya, karena dari sampel itu sendiri sudah ada batas kepercayaan. Dari batas kepercayaan dapat kita ambil kesimpulan bahwa besar sampel terdapat dalam hasil perhitungan statistika.

14.Apakah komponen-komponen rumus besar sampel diisi dengan angka-angka yang masuk akal?Iya, karena hasil perhitungan dapat di pertanggungjawabkan berdasarkan sumber yang terpercaya.

15.Apakah observasi, pengukuran, serta intervensi dirinci sehingga orang lain dapat mengulanginya?Iya, karena observasi yang dilakukan mengikuti kaidah metode penelitian ilmiah,metode-metode penelitian ilmiah, dan sumber yang terpercaya.

16.Bila teknik pengukuran tidak dirinci,apakah disebutkan rujukannya?Tidak, karena teknik pengukuran telah dirincikan.

17.Apakah disebutkan rencana analisis batas kemaknaan,dan power penelitian?Ya, batas kemaknaan dituliskan sebesar P < 0,05.

18.Apakah disebutkan program computer yang di pakai?Ya,program computer yang dipakai adalah statistical software StateXact, Version 5.0 (cytel Software) dan the X2 test.

3. HASIL19.Apakah disertakan table deskripsi subjek penelitian?Ya, tabel deskripsi subyek penelitian disertakan pada halaman 6.

20.Apakah disebutkan jumlah subjek yang diteliti? Ya, subyek penelitian disebutkan baik pada tabel deskripsi penelitian dan pada metode, dimana jumlah subyek penelitian adalah sebesar 65 orang.

21.Apakah dijelaskan subjek yang drop out dengan alasannya?Tidak, karena dalam penelitian ini tidak terdapat subyek penelitian yang drop out.

22.Apakah penulisan table dilakukan dengan tepat?Ya, karena penulisna tabel telah mengikuti kaaidah penulisan metode ilmiah yang ada.

23.Apakah tabel dan ilustrasi informative?Ya, tabel dan ilustrasi dijelaskan dengan bahsa yang mudah meskipun dengan bahasa inggris dan kosakata bahasa inggris yang terbatas.

24.Apakah tabel dan ilustrasi tersebut memang diperlukan?Iya, karena apabila tabel dan ilustrasi tidak ada maka pembaca dan orang yang akan memnguji penelitian itu akan merasa kesulitan.

25.Apakah semua outcome yang penting disebutkan dalam hasil?Ya,karena besar sumber dan penjelasan mengenai semua penelitian ini terangkum didalam hasil dan dijelaskan kembali di dalam diskusi.

26.Apakah subjek yang drop out diikutkan dalam analisis?Tidak, karena tidak ada subyek yang drop out.

27.Apakah analisis dilakukan dengan uji yang sesuai?Ya. Karena analisis dilakukan dengan uji klinis yang terpecaya dan bisa di per tanggungjawabkan.

28.Apakah disertakan interval kepercayaan?Interval kepercayaan disertakan tercantum dalam hasil dan kesimpulan dari artikel

4. DISKUSI29.Apakah semua hal yang relevan dibahas?Ya, karena dalam diskusi dijelaskan dan membahas metode,tata cara, dan hasil yang tidak jauh dari penelitian tersebut.

30.Apakah dibahas keterbatasan penelitian, dan kemungkinan dampaknya terhadap hasil?Tidak, akan tetapi ada 1 pasien yang mengalami gejala penyakit yang berbeda dari yang lainnya akan tetapi tidak mempengaruhi atau menghasilakan bias dalam penelitian ini.

31.Apakah disebutkan kesulitan penelitian, penyimpangan dari protocol, dan kemungkinan dampak terhadap hasil?TIdak, karena penelitian ini tidak terdapat penyimpangan.

32.Apakah pembahasan dilakukan menghubungkannya dengan pertanyaan penelitian?Ya, didalam judul pendahuluan terutama dalam latar belakang dimana pertanyaan atau hal yang ingin dicapai dalam penelitian ini adalah membandingkan pemakaian gentacimin dan doxycycline, dan pembahasan pun dihubungkan dan dilakukan berdasarkan tujuan dan pertanyaan penelitian ini.

33.Apakah pembahasan dilakukan dengan menghubungkannya dengan teori dan hasil penelitian terdahulu?Ya, Karena bisa kita lihat, penelitian ini tidak pernah menyimpang dari pembahasan dan teori dari penelitian ilmiah serta daftar pustaka yang dijadikan refrensi dalam penelitian ini.

34.Apakah kesimpulan utama penelitian?Kesimpulan utama dari penelitian ini terdapat dalam bagian abstrak. Both gentamicin and doxycycline were effective therapies for adult and pediatric plague, with high rates of favorable responses and low rates of adverse events. Dimana artinya adalah bahwa gentacimin dan doxicycline adalah terapi efektif untuk penderita pes dewasa dan anak-anak dengan persentase sembuh yang tinggi dan persentase membahayakan yang rendah.

35.Apakah kesimpulan didasarkan pada data penelitian?Ya, kesimpulan yang diambil dalam penelitian ini sangat didasarkan oleh data penelitian sebelumnya.

36.Apakah kesimpulan tersebut sahih?Ya, karena kesimpulan ini di ambil dari data yang terpercaya dan didasarkan oleh metode ilmiah. Selain itu penellitian ini sudah bisa diterima oleh US Food and Drug Administration (FDA) untuk pengobatan penderita wabah Pes.

37.Apakah disebutkan generalisasi hasil penelitian?Ya, generalisasi disebutkan dalam kesimpulan dan diskusi yang ada dalam lembar 10-12 jurnal ini.

38.Apakah disertakan saran penelitian selanjutnya, dengan anjuran metodologis yang tepat?Tidak, akan tetapi yang disarankan adalah pengobatannya yaitu mengenai peningkatan konsentrasi serum.

39.Apakah terima kasih ditujukan kepada orang yang tepat?Ya, karena daftar terima kasih dituliskan dan dapat dibaca dalam lembar 12 dan 13.

40.Apakah daftar pustaka disusun sesuai dengan aturan jurnal?Ya, aturan daftar pustaka yang digunakan dalam jurnal serta penelitian ini adalah aturan Van Couver.

41.Apakah semua yang tertulis pada daftar pustaka tertera pada nas, dan sebaliknya?Ya, karena dalam daftar pustaka jurnal ini dituliskan dalam Van Couver. Dan semua yang ada dalam daftar pustaka tertera dalam naskah jurnal ini.

42.Apakah keseluruhan makalah ditulis dengan bahasa yang lancar , enak dibaca, informatif, hemat kata, dan efektif?Ya, Karena walaupun dituliskan dalam Bahasa inggris Klompok turorial 4 dapat mengerti jurnal ini. Selain itu jurnal yang berdasarkan penelitian ini, telah dipublikasikan kepada dunia dan yang pastinya jurnal ini hemat kata, infomatif, dan enak dibaca.

43.Apakah makalah ditulis dengan ejaan yang taat asas?Ya, karena makalah ini mengikuti asas-asas penulisan metode ilmiah.

5. UJI KLINIK44.Apakah dilakukan randomisasi (pengelompokan subjek penelitian dialokasikan secara acak) dan apa jenis randomisasi (simple, blok, dan lain-lain)?Ya, penelitian ini dilakukan randomisasi (pengelompokan subjek penelitian dialokasikan secara acak) dan nama randomisasi ini adalah randomized clinical trial.

45.Apakah dilakukan blinding (penyamaran) atau open (tanpa penyamaran)?Tidak, pemilihan subyek dilakukan hanya dengan random

46.Apakah ada control atau tanpa control?Tidak karena dalam penelitian ini sistem pengelompokan sampel tidak dibagi dua berdasarkan ada atau tidak adanya penyakit. Akan tetapi dalam penelitian ini yang di bagi dua adalalah pemberian dua contoh obat kepada dua klompok sampel. Selain itu tujuan obat ini adalah menentukan perbandingan khasiat obat untuk penderita wabah pes.

47.Apakah desain uji klinik yang dilakukan (parallel, crossing over, latin square, desain factorial)?Desain uji klinik ini adalah parallel

48.Bagaimana penangan drop out?Penanganan dalam drop out dalam makalah ini tidak ada.

49.Apakah uji statistik yang digunakan sesuai dengan skala pengukuran (nominal, ordinal, numeric), distribusi hasil pengukuran (normal atau tidak), hipotesis penelitian (asosiatif atau korelatif)?Yak arena uji statistic yang dilakukan oleh peneliti telah dilakukan berdasarkan metode penelitian yang sahih,dan telah di akui oleh US Food Administration (FDA),dan hipotesis serta hasil penelitian sangat berkorelasi dan saling berhubungan.

50.Bagaimana kemaknaan substansi dibandingkan dengan kemaknaan statistik (analisis interim)?

6. PEMAHAMAN JURNAL REVIEWJENIS JURNAL

Jurnal Potong Lintang

1.Adakah angka prevalensi?Ada.

2.Adakah tabel 2 x 2 yang menganalisis hubungan antara faktor risiko dan efek?Dalam atikel ini tidak dijelaskan dan tidak disertakan tabel 2x2 yang menganalisis faktor resiko dan efek.

3.Adakah nilai OR/RR?Tidak ada karena nilai yang dicari adalah Interval kepercayaan

4.Berapa kali terjadi kontak antara peneliti dan subjek penelitian?Tidak dijelaskan berapa kali peneliti dan subyek penelitian terjadi kontak akan tetapi dari artikel dijelaskan

Jurnal Kasus Kontrol

1.Tentukan variabel yang termasuk kelompok efek/kasus?Eek kasus adalah warga atau orang yang terinfeksi pes.

2.Tentukan variabel yang termasuk kelompok risiko?Variabel yang termasuk di klompok faktor resiko adalah bakteri Yersinia pestis

3.Adakah tabel 2 x 2 yang menganalisis hubungan antara risiko dan efek?Tidak ada.

4.Bagaimana peneliti menelusuri risiko penyakit?Tidak dijelaskan karena didalam artikel ini membahas uji klinik di mana faktor resiko penyakit ini sudah tetap yaitu bakteri Yersinia Pestis.

Jurnal Kohort

1.Tentukan variabel yang termasuk kelompok efek/kasus?Eek kasus adalah warga atau orang yang terinfeksi pes

2.Tentukan variabel yang termasuk kelompok risiko?Variabel yang termasuk di klompok faktor resiko adalah bakteri Yersinia pestis

3.Bagaimana peneliti mengbservasi perjalanan risiko/follow up?Dengan melakukan uji klinis dan di pantau mengenai efek dari pemberian obat yang diberikan.

Jurnal Kualitatif

1.Bagaimana keterlibatan peneliti terhadap subjek yang diamati?Peneliti melakukan uji klinis yang langsung mengadakan kontak langsung berupa pemberian 2 obat yang berbeda kepada subyek penellitian.

2.Bagaimana peneliti menjamin validitas data penelitian (tri angular)?Dengan diterimanya penelitian dan obat-obatan oleh US Food and Drug Administration (FDA)

The Impact of Phenotypic and Genotypic G6PD Deficiency on Risk of Plasmodium vivax Infection: A Case-Control Study amongst Afghan Refugees in PakistanTop of FormBottom of Form Toby Leslie1,2*, Marnie Briceo3, Ismail Mayan2, Nasir Mohammed2, Eveline Klinkenberg4, Carol Hopkins Sibley3, Christopher J. M. Whitty1, Mark Rowland11 Department of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom, 2 HeathNet TPO, Peshawar, North West Frontier Province, Pakistan, 3 Department of Genome Sciences, University of Washington, Seattle, Washington, United States of America, 4 HealthNet TPO, Amsterdam, The NetherlandsAbstract BackgroundThe most common form of malaria outside Africa, Plasmodium vivax, is more difficult to control than P. falciparum because of the latent liver hypnozoite stage, which causes multiple relapses and provides an infectious reservoir. The African (A) G6PD (glucose-6-phosphate dehydrogenase) deficiency confers partial protection against severe P. falciparum. Recent evidence suggests that the deficiency also confers protection against P. vivax, which could explain its wide geographical distribution in human populations. The deficiency has a potentially serious interaction with antirelapse therapies (8-aminoquinolines such as primaquine). If the level of protection was sufficient, antirelapse therapy could become more widely available. We therefore tested the hypothesis that G6PD deficiency is protective against vivax malaria infection.

Methods and FindingsA case-control study design was used amongst Afghan refugees in Pakistan. The frequency of phenotypic and genotypic G6PD deficiency in individuals with vivax malaria was compared against controls who had not had malaria in the previous two years. Phenotypic G6PD deficiency was less common amongst cases than controls (cases: 4/372 [1.1%] versus controls 42/743 [5.7%]; adjusted odds ratio [AOR] 0.18 [95% confidence interval (CI) 0.060.52], p = 0.001). Genetic analysis demonstrated that the G6PD deficiency allele identified (Mediterranean type) was associated with protection in hemizygous deficient males (AOR = 0.12 [95% CI 0.020.92], p = 0.041). The deficiency was also protective in females carrying the deficiency gene as heterozygotes or homozygotes (pooled AOR = 0.37 [95% CI 0.150.94], p = 0.037).ConclusionsG6PD deficiency (Mediterranean type) conferred significant protection against vivax malaria infection in this population whether measured by phenotype or genotype, indicating a possible evolutionary role for vivax malaria in the selective retention of the G6PD deficiency trait in human populations. Further work is required on the genotypic protection associated with other types of G6PD deficiency and on developing simple point-of-care technologies to detect it before administering antirelapse therapy.Please see later in the article for the Editors' SummaryCitation: Leslie T, Briceo M, Mayan I, Mohammed N, Klinkenberg E, et al. (2010) The Impact of Phenotypic and Genotypic G6PD Deficiency on Risk of Plasmodium vivax Infection: A Case-Control Study amongst Afghan Refugees in Pakistan. PLoS Med 7(5): e1000283. doi:10.1371/journal.pmed.1000283Academic Editor: Stephen John Rogerson, University of Melbourne, AustraliaReceived: September 22, 2009; Accepted: April 15, 2010; Published: May 25, 2010Copyright: 2010 Leslie et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Funding: The study was funded in part by GlaxoSmithKline as an investigator-initiated study and was sponsored by the London School of Hygiene & Tropical Medicine. MR and CJMW were supported by the Gates Malaria Partnership, and TL is supported by the ACT Consortium. Neither the funder nor the sponsor played any role in design and conduct of the study, in the collection, analysis, and interpretation of the data, decision to publish, or in the preparation, review, or approval of the manuscript.Competing interests: Other than the partial funding by GlaxoSmithKline of this investigator-initiated study, CJMW has received funding for investigator -initiated research from Pfizer. None of the other authors have conflicts of interest to declare.Abbreviations: AOR, adjusted odds ratio* E-mail: toby.leslie@lshtm.ac.ukEditors' SummaryTopBackgroundMalaria is a parasitic infection transmitted to people through the bite of an infected mosquito. Although Plasmodium falciparum is responsible for most malaria deaths, P. vivax is the commonest, most widespread cause of malaria outside sub-Saharan Africa. Like other malaria parasites, P. vivax has a complex life cycle. Infected mosquitoes inject a parasitic form known as sporozoites into people where they replicate inside liver cells without causing symptoms. About 89 days later, merozoites (another parasitic form) are released from the liver cells and invade red blood cells. Here, they replicate rapidly before bursting out and infecting more red blood cells. This increase in the parasitic burden causes malaria's characteristic symptoms (debilitating and recurring chills and fevers). P. vivax infections are usually treated with chloroquine (although resistance to this drug is now emerging) but patients must also take primaquine, a drug that kills hypnozoites, a form of P. vivax that hibernates in the liver. Hypnozoites can cause a relapse months after the initial bout of malaria and make P. vivax malaria harder to control than P. faciparum malaria.Why Was This Study Done?Some mutations (DNA changes) protect their human carriers against specific disease-causing organisms. These mutations occur at high frequencies in populations where these organisms are common. For example, the widespread distribution of mutations that cause a deficiency in an enzyme called glucose-6-phosphate dehydrogenase (G6PD) mirrors the distribution of malaria and the African (A) form of G6PD deficiency, a type of G6PD deficiency that is common in people of African origin, is known to provide partial protection against severe P. falciparum malariaP. falciparum does not thrive in G6PD-deficient red blood cells. In areas where P. vivax malaria is common, Mediterranean and Asian variants of G6PD deficiency are more widespread than A G6PD, so the question is, do these variants protect against P. vivax malaria? In this case-control study (a study in which the characteristics of people with and without a specific condition are compared), the researchers investigate whether G6PD deficiency protects against P. vivax infection in a population of Afghan refugees living in Pakistan.What Did the Researchers Do and Find?The researchers enrolled 372 Afghan refugees who had had P. vivax malaria during the previous two years and 743 refugees who had not had malaria over the same period. They measured G6PD activity in the participants' blood to detect phenotypic G6PD deficiency (reduced enzyme activity) and looked for the Mediterranean variant of the G6PD gene in the participants (genotypic G6PD deficiency). 5.7% of the controls but only 1.1% of the cases had phenotypic G6PD deficiency. Statistical analyses indicated that participants with reduced G6PD levels were about one-fifth as likely to develop P. vivax malaria as those with normal G6PD levels after allowing for other factors that might affect their susceptibility to malaria, an adjusted odds ratio (AOR) of 0.18. The genetic analysis indicated that the Mediterranean G6PD gene variant provided protection against P. vivax infection in men (AOR 0.12) and in women carrying either one or two defective copies of the G6PD gene (AOR 0.37); because the G6PD gene is on the X chromosome, men have only one copy of the gene but women have two copies.What Do These Findings Mean?These findings indicate that Mediterranean-type G6PD deficiency protects against P. vivax malaria infection in this population of Afghan refugees. Although further studies are needed to determine whether other G6PD variants protect against P. vivax malaria, these findings suggest that P. vivax malaria might be responsible for the retention of the G6PD deficiency trait in some human populations. In addition, these findings may have implications for the treatment of P. vivax malaria. Currently, in most places where P. vivax malaria is common, primaquine is not given routinely because primaquine can trigger red blood cell death (hemolytic anemia) in G6PD-deficient people and tests for G6PD deficiency are rarely available. These findings suggest that the risk of exposure to primaquine among people infected with P. vivax might be lower than previously assumed, because G6PD deficiency is less common among P. vivax-infected patients than among the general population. Nevertheless, these findings are unlikely to increase the use of primaquine immediately. Such an increase, the researchers suggest, will only occur if a simple test for G6PD deficiency is developed.Additional InformationPlease access these Web sites via the online version of this summary at http://dx.doi.org/10.1371/journal.pmed.1000283. Information is available from the World Health Organization on malaria (in several languages) The US Centers for Disease Control and Prevention provides information on malaria (in English and Spanish) Information is available from the Wellcome Trust on all aspects of malaria, including a news item about G6PD deficiency protecting against severe P. falciparum malaria MedlinePlus provides links to additional information on malaria (in English and Spanish) The Malaria Vaccine Initiative has a fact sheet on Plasmodium vivax malaria Vivaxmalaria provides information about P. vivax More about G6PD deficiency can be found on KidsHealth from the Nemours Children's Health System IntroductionTopThe majority of malaria outside sub-Saharan Africa is caused by Plasmodium vivax, which causes up to 390 million clinical cases a year amongst a population at risk of approximately 2.6 billion [1],[2]. Its wide geographical distribution is due, in part, to its ability to undergo development (sporogony) in mosquitoes at a lower temperature than P. falciparum and to its formation of a latent liver stage (the hypnozoite), which initiates secondary blood-stage infections [3]. These characteristics make vivax malaria significantly more difficult to control or eliminate than falciparum malaria.Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common genetic enzymopathy in humans with more than 200 variants identified to date [4]. Because the trait is X-linked and recessive, expression of phenotypic deficiency occurs more frequently in males than females. G6PD deficiency is relatively rare in populations where malaria is rare but may exceed 10% in prevalence where malaria is common [5]. In patients with G6PD deficiency, treatment with 8-aminoquinoline drugs such as primaquine may cause methemoglinaemia [6] and precipitate haemolytic anaemia which, although often mild and subclinical, can be severe in some people with particular G6PD deficiency variants [7],[8]. The potentially life-threatening interaction between the enzyme deficiency and anti-hypnozoite drugs places a major constraint on the ability of endemic countries to control or eliminate vivax malaria, because G6PD testing is not available in most areas with vivax malaria, so safe treatment of hypnozoite infections with 8-aminoquinoline drugs is not deemed feasible [9].The concordance of the distribution of G6PD deficiency with maps of historical malaria led to the hypothesis that the trait is protective against P. falciparum. This hypothesis was confirmed in endemic areas of Africa where the African (A) variant of G6PD deficiency protected against severe disease [10][12]. Falciparum malaria is now thought to be the principal evolutionary driver for retention of the A variant of G6PD deficiency [10][12]. Mediterranean and Asian variants of G6PD deficiency are, however, more common in areas where vivax malaria is endemic. Mediterranean variants tend to cause more significant haemolysis than the A variant when challenged with antimalarial drugs, fava beans, or other environmental stressors. A recent study [13] demonstrated that one Asian variant (G6PD-Mahidol) was associated with lower levels of parasitaemia in Thai adults with vivax malaria, but not with P. vivax infection or with P. falciparum. Genetic evidence for an evolutionary interaction was also demonstrated. Vivax malaria, often incorrectly assumed to be benign [14],[15], seems likely to exert evolutionary pressure for retention of the G6PD trait in human populations. We therefore investigated whether G6PD deficiency is protective against vivax malaria infection in a South Asian population in Pakistan.MethodsTopUsing a case-control design, we examined the association of G6PD deficiency with vivax malaria, retrospectively, over 2 years of observation. The study was conducted in three Afghan refugee villages in North West Frontier Province, Pakistan (Adizai, Baghicha, and Kaghan). The refugee villages had populations ranging from 1,000 to 3,500 people. Malaria transmission was seasonal and hypoendemic [16],[17] with the majority (approximately 95%) of cases being due to vivax malaria and the remainder to P. falciparum. Ethnically, the population is Pashtun [18].Selection of Cases and ControlsIn November and December 2006, cases were selected from residents of the refugee villages who in earlier studies were diagnosed with vivax malaria [19],[20]. Cases were defined as individuals who had had at least one episode of vivax malaria in the previous 2 years based on research slides collected using standard methods and double read by two experienced microscopists. Discordant slides were read by a third microscopist. A cross-checking procedure was in place in all clinics and maintained accuracy at >98% [21] (HealthNet TPO, unpublished data, 20045). In addition, PCR was conducted on blood samples taken from cases during one of the studies [19] (n = 30), which confirmed that all tested cases were indeed infected with P. vivax.Village health records were used to select community controls from the same population as cases. Controls had no known episodes of malaria during the same 2 years of observation. The record system contained information on every family, and each family had a health card on which every member was recorded by name. The registration was regularly updated for births and deaths during consultation in the village health clinics. If a malaria blood smear was taken, the slide result was recorded against the patient's record (even if it was negative). If the patient was parasitaemic, the treatment given was also recorded. The records are maintained by trained village health workers and clinic staff. This allowed the compilation of a list of all individuals in the villages who had not had malaria over the 2 years before the study. All residents from the same villages as cases who were more than 2 years old and had no history of malaria in their clinic record were therefore eligible for enrolment as controls.Controls were selected at random from the complete list of eligible village residents. A bottle was spun outside the house of each case in order to select a random house and if it contained an eligible control (of the same sex and within 5 years of age of the case), then the control was enrolled. If no suitable control was available, the bottle was re-spun until a suitable control was found from a house in the vicinity of the case. The selection was therefore controlled for the likely confounding factors of age and village (associated with risk of infection) and sex (associated with risk of G6PD deficiency) to ensure that disease and exposure risk was broadly similar between cases and controls. Once informed consent was given, the control was assessed by microscopy for current malaria parasitaemia, and if positive the control was not included. Because no controls had parasitaemia at the time of the survey, none were excluded on the basis of this criterion. Information on treatment-seeking practice was collected to identify those individuals who had sought medical care outside the village in the last 2 years; a restricted analysis, in which such individuals were excluded, was conducted as a check against potential bias resulting from malaria that was not recorded in clinic records. Children under the age of 2 years were excluded since they would not have been born at the start of the observation period.Blood samples were collected in EDTA tubes and immediately tested for phenotypic G6PD deficiency using a colorimetric test (Sigma Diagnostics, Poole, Dorset, UK) according to the manufacturer's instructions. Samples found to be deficient were tested a second time. Each participant gave a blood sample stored on filter paper for genetic analysis. The filter papers were allowed to dry, marked with the participant's identifier and stored in individual bags. The samples selected for analysis were sent to the Department of Genome Sciences at the University of Washington, Seattle, USA.Ethics StatementEthical approval was obtained from the London School of Hygiene and Tropical Medicine Ethics Review Board and from the Pakistan Medical Research Council Committee on Bioethics. All participants gave written informed consent to participate. For the gene sequencing, ethical approval was given by the University of Washington Ethics Committee.Statistical AnalysisThe primary analysis examined the association between phenotypic G6PD deficiency and vivax malaria. A sample size was calculated for a 2:1 ratio of controls to cases. A sample of 500 cases and 1,000 controls gave 80% power to detect a frequency of phenotypic G6PD deficiency of 1% amongst cases and 3.5% amongst controls [19],[20] at the 95% confidence level.We conducted univariate and multivariate analysis using unconditional logistic regression and adjusting for prespecified potential confounding factors between cases and controls; those factors included in the final unconditional multivariate logistic regression model for the primary outcome were age group, sex, tribe, and refugee village. In response to suggestions from the statistical referee we undertook an additional post-hoc analysis using conditional logistic regression, which was not part of the prespecified analytical plan. In this analysis each case was matched with the two controls identified in their village by bottle-spinning and was thus matched for village, sex, and age group. We included tribe as a potential confounding factor in the model.G6PD deficiency is an X-linked mutation so the secondary analysis examined the association between the deficiency (both phenotypic and genotypic) and infection separately for males and females. This analysis took the same approach as before and applied unconditional logistic regression and a post-hoc conditional logistic regression. The genotyped samples were used to assess the level of protection conferred by confirmed hemizygous deficiency in males and heterozygous and homozygous deficiency in females. The study was not powered specifically for the secondary analyses. Data was analysed using STATA v8 (STATA Corp, College Station, TX, USA).Genetic AnalysisParticipant blood samples were examined for G6PD genotype in two phases. Initially, we selected half of the samples from males who were phenotypically deficient and the requisite number of male non-deficient samples (in an approximate 1:2 ratio). We then amplified a 5.2 kb fragment using the primers 13125F: 5 GTT TAT GTC TTC TGG GTC AGG GAT GG 3 and 18396R: 5 AGT GTT GCT GGA AGT CAT CTT GGG T 3 from Saunders et al, [22]. Forty-six out of 57 of the samples that we attempted to amplify gave good sequence across the majority of that fragment (up to exon 10) and showed that the predominant allele was the Mediterranean (Med) type.In the second phase we conducted PCR amplification of Med allele fragments on the 40% sample of the participants whose samples were available, in equal proportion between cases and controls. These comprised the same 1:2 ratio of cases to controls and allowed examination of the frequency of the Med allele between cases and controls. Med allele fragments were amplified in a 20 l reaction volume containing: 1 PCR PreMix A, 0.2 M each primer, 0.5 units FailSafe enzyme mix (Epicentre, Madison, WI), and 2 L of template DNA. Cycling conditions were: 94C for 3 min; 36 cycles of 94C for 30 s, 55C for 30 s, 62C for 60 s; 62C for 5 min, 15C for 5 min. Sequencing was done in a 10 l volume, using 13 l of PCR product, 1.7 l 5 sequencing buffer for Big Dye (400 mM Tris-HCl, 10 mM MgCl2, pH = 9.0), 0.8 M primer, and 1 l Big Dye (Applied Biosystems, Foster City, CA). Products of sequencing reactions were separated on an ABI 3130xl (Applied Biosystems, Foster City, CA) and analyzed using Sequencher (Gene Codes Corporation, Ann Arbor, MI). The following primers were used for the Med allele: Medf: 5 ATGATGCAGCTGTGATCCTCACTC 3 and Medr: 5 ATGAGGTTCTGCACCATCTCCTTG 3.ResultsTopA total of 372 cases and 743 controls were enrolled into the study at a ratio of roughly 1:2. Table 1 shows enrolment data for cases and controls. There were no differences in the frequency of sex, village, or age group between cases and controls, although tribal group did differ. There was a lower than anticipated number of participants, because some of the cases (identified in the earlier studies [19],[20]; n = 125) had either repatriated to Afghanistan or had been enrolled more than once in the previous studies (but were included only once in the present survey). All participants were ethnic Pashtuns.There was a lower frequency of phenotypic G6PD deficiency amongst cases (4/372 [1.1%]) than controls (42/743 [5.7%]), Chi2 = 13.1, p