Post on 16-Nov-2021
1
LAPORAN AKHIR
PENELITIAN LEKTOR
IDENTIFIKASI EKSPRESI GEN SEL TULANG HASIL DIFERENSIASI
MESENCHYMAL STEM CELL (MSCs) MENCIT YANG DIINDUKSI
EKSTRAK BUNGA Delonix regia
Dr Kartini Eriani MSi 197004211999032001
dr Ichsan MSc 197710062003121001
Dr Silmi Mariya 197002121994032001
Dibiayai oleh
Universitas Syiah Kuala
Kementerian Riset Teknologi dan Pendidikan Tinggi
Sesuai dengan Surat Perjanjian Penugasan
Pelaksanaan Penelitian Lektor Tahun Anggaran 2019
Nomor 522UN11SPKPNBP2019 tanggal 08 Februari 2019
FAKULTAS MATEMATIKA DAN ILMU
PENGETAHUAN ALAM
UNIVERSITAS SYIAH KUALA
OKTOBER 2019
ii
RINGKASAN
Teknologi sel punca (stem cell) memiliki potensi dalam upaya penyembuhan penyakit
degeneratif Tujuan penelitian ini yaitu mengidentifikasi gen yang diekspresikan oleh
sel tulang hasil diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus
musculus) yang diinduksi ekstrak etanol bunga flamboyan Delonix regia (Boj ex
Hook) Raf menggunakan Real Time PCR Penelitian ini dilaksanakan di
Laboratorium Riset Jurusan Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam
dan Laboratorium Riset Fakultas Kedokteran Hewan Universitas Syiah Kuala dari
bulan Febuari 2019 sampai Oktober 2019 Penelitian ini menggunakan metode
Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 4 ulangan Perlakuan berupa
penambahan ekstrak etanol bunga flamboyan (D regia) yang terdiri dari dosis 00
mgml sebagai kontrol (tanpa penambahan ekstrak) 06 mgml 07 mgml 08 mgml
dan 09 mgml Media kultur yang digunakan adalah modified Dulbeccorsquos Modified
Eaglersquos Medium (mDMEM) Sel sumsum tulang mencit yang diperoleh secara aspirasi
dikultur selama 7 hari dalam inkubator CO2 5 pada suhu 37 degC Parameter penelitian
ini yaitu hasil kurva amplifikasi yang ditampilkan pada software CFX-96 Biorad yang
menunjukkan kesesuaian antara gen sel target dan primer sel tulang yang digunakan
Primer yang digunakan adalah alkaline-phosphatase (ALP) Hasil penelitian
menunjukkan bahwa ekstrak etanol bunga flamboyan dengan dosis yang digunakan
mampu menginduksi diferensiasi sel punca menjadi sel tulang berupa osteoblas
iii
PRAKATA
Syukur alhamdulillah peneliti ucapkan kepada Allah swt sehingga kami dapat
menyelesaikan laporan kemajuan penelitian lektor yang berjudul rdquoIdentifikasi
Ekspresi Gen Sel Tulang Hasil Diferensiasi Mesenchymal Stem Cell (MSCs) Mencit
yang Diinduksi Ekstrak Bunga Delonix regia Shalawat dan salam kami sanjungkan
kepada Nabi Besar Muhammad saw beserta sahabat dan sanak keluarganya
Laporan kemajuan penelitian tahap satu guna memenuhi salah satu persyaratan
dalam pelaksanaan penelitian yang didanai oleh PNBP melalui Lembaga Penelitian
Universitas Syiah Kuala Laporan kemajuan penelitian ini disusun berdasarkan hasil
penelitian yang dilaksanakan di Laboratorium Riset Biologi FMIPA Laboratorium
Riset FKH Unsyiah dan Laboratorium Kultur PSSP IPB
Penulis banyak mendapatkan bantuan dan bimbingan dari berbagai pihak
selama pelaksanaan penelitian yang masih terus berlangsung sampai saat ini Oleh
karenanya penulis mengucapkan terimakasih kepada
1 Dr Taufik Fuadi Abidin SSi MTech selaku Ketua Lembaga Penelitian
Universitas Syiah Kuala
2 Prof Dr drh Darmawi MSi selaku kepala Laboratorium Riset FKH Unsyiah
3 Dr Silmi Mariya MSi selaku Kepala Laboratorium Kultur PSSP IPB yang telah
mengizinkan penulis untuk penelitian di BIB Saree dengan segala fasilitas yang ada
4 Dr Drh Huda S Darusman MSi selaku Kepala Pusat Studi Satwa Primata IPB
yang telah membantu pelaksanaan penelitian ini
5 Serta seluruh teknisi lapangan dan Laboratorium PSSP yang tidak mungkin disebut
satu persatu
Harapan penulis semoga penelitian ini dapat kami selesaikan sesuai proposal
yang kami ajukan dan dapat bermanfaat bagi perkembangan ilmu pengetahuan
masyarakat dan pemerintah
Banda Aceh 30 Agustus 2019
Penulis
iv
DAFTAR ISI
HALAMAN PENGESAHAN i
DAFTAR ISI ii
RINGKASAN iii
BAB 1 PENDAHULUAN 1
BAB 2 TINJAUAN PUSTAKA 4
BAB 3 TUJUAN DAN MANFAAT 5
BAB 4 METODE PENELITIAN 6
41 Pemeliharaan hewan coba 6
42 Pengambilan sampel Delonix regia 6
43 Ekstraksi 6
44 Pembuatan medium kultur mDMEM dan phosphate buffer saline (PBS) 6
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang 7
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
48 Parameter Penelitian 9
49 Analisis Data Penelitian 10
BAB 5 HASIL DAN LUARAN YANG DICAPAI 11
BAB 6 KESIMPULAN DAN SARAN 22
DAFTAR PUSTAKA 23
LAMPIRAN 27
1 Biodata Peneliti 28
2 Artikel immiah 41
3 Foto dan Gambar Aktifitas 47
1
BAB 1 PENDAHULUAN
Status degeneratif merupakan salah-satu penyakit dengan tingkat kematian yang
cukup tinggi Penyakit kronis ini berhubungan pada proses degenerasi atau ketuaan
sehingga penyakit ini banyak ditemukan pada usia lanjut (Handajani et al 2010)
Kondisi yang terjadi adalah sulitnya pengobatan dan layanan kesehatan
mengakibatkan pasien degeneratif tidak mendapatkan terapi secara maksimal
Kebanyakan pasien ini lebih memilih berdiam diri dan tidak terlalu mementingkan
kesehatannya
Organisasi Kesehatan Dunia (WHO) mencatat pada tahun 2012 sedikitnya ada
839 juta kasus degenerative dan diperkirakan menjadi 115 milyar pada tahun 2025
atau sekitar 29 dari total penduduk dunia dimana penderitanya lebih banyak pada
wanita (30) dibanding pria (29) WHO juga menambahkan bahwa South East Asia
pada tahun 2008 dilaporkan bahwa terdapat sebanyak 55 kematian disebabkan oleh
penyakit degenerative
Prevalensi penyakit degeneratif di Indonesia sendiri juga semakin meningkat
Terdapat faktor pemicu utama terhadap kasus ini yaitu meliputi status gaya hidup dan
sosial ekonomi Hasil Riset Kesehatan Dasar (Riskesdas) tahun 2007 dilaporkan
bahwa terdapat kasus penyakit degeneratif di masyarakat belum terdiagnosis dengan
baik Sebagai contoh yaitu pada kasus hipertensi diketahui terdapat angka sebesar
317 dimana hanya 72 penduduk yang sudah mengetahui memiliki penyakit
degeneratif berupa hipertensi dan hanya 04 kasus yang minum obat hipertensi
Potensi stem cell dalam menyembuhkan berbagai penyakit degeneratif telah
menjadi harapan baru bagi masyarakat (Wobus dan Boheler 2006) Namun biaya
yang harus dikeluarkan untuk sekali terapi stem cell mencapai ratusan juta rupiah
Mengingat biaya terapi yang cukup besar maka terapi ini hanya dapat dirasakan oleh
masyarakat tingkat ekonomi menengah keatas sedangkan masyarakat dibawahnya
tidak Hal ini menimbulkan kesenjangan sosial dan kesenjangan hak sehat bagi
masyarakat Besarnya biaya terapi stem cell tidak terlepas dari mahalnya biaya
operasional produksi stem cell di laboratorium dan biaya aplikasi bagi pasien Salah
satu usaha yang telah dilakukan untuk menekan biaya produksi stem cell adalah
mencari senyawa kimia dari alam sebagai penginduksi diferensiasi stem cell menjadi
sel spesifik sebagai media kultur
Tumbuhan flamboyan Delonix regia (Boj ex Hook) Raf mengandung beberapa
senyawa seperti terpenoid tannin cardiac glycosides dan anthroquuinoes yang
2
berpotensi sebagai antioksidan (Singh dan Kumar 2014) saponin alkaloid
hidrokarbon fitotoksin dan karoten (Shanmukha et al 2011) Bagian bunga D regia
mengandung karotenoid galaktomannon (Jungalwala dan Cama 1962) tannin
saponin flavonoid steroid (Shanmukha et al 2011) dan alkaloid (Pharekh dan
Chanda 2007) Menurut (Jungalwala dan Chama 1962) kandungan karotenoid pada
bunga D regia berperan untuk mengatur komunikasi antar sel memberikan respon
imun transformasi neoplastik pengontrol pertumbuhan dan sebagai regulator enzim
yang bekerja sebagai detoksifikasi karsinogen (Pryor et al 2000)
Berdasarkan penelitian yang dilakukan oleh Eriani et al (2018) menggunakan
ekstrak etanol bunga flamboyan (D regia) secara in vitro mendapatkan hasil
diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus musculus) berupa
nerve-like cell dan fibroblast-like cell dengan pewarnaan HE Selain itu ditemukan sel
yang memiliki karakteristik berbentuk bulat letak inti sel berada di samping dan
berwarna gelap yang menyerupai karakteristik osteoblast Namun penentuan jenis sel
ini tidak dapat dilakukan secara visual melainkan dengan menggunakan teknik
identifikasi berdasarkan ekspresi gen dari setiap sel untuk mendapatkan hasil yang
akurat Salah satu teknik yang digunakan adalah Polymerase Chain Reaction (PCR)
PCR merupakan teknik biologi molekuler untuk mengamplifikasi sekuen DNA
spesifik menjadi ribuan sampai jutaan kopi sekuen DNA dan memberikan informasi
mengenai urutan basa nukleotida dari sampel yang digunakan (Hewajuli dan
Dharmayanti 2014) Dengan demikian gen yang diekpresikan dapat diketahui dan
membuktikan jenis sel yang diperoleh Oleh karena itu penelitian ini penting
dilakukan untuk mengetahui dan membuktikan bahwa hasil diferensiasi dan proliferasi
sel punca mesenkimal berupa sel tulang menggunakan RT-PCR
Tabel 1 Rencana Target Capaian Tahunan
No Jenis Luaran Indikator Capaian
TS TS+1 TS+2
1 Publikasi Ilmiah Internasional Ada
Nasional Terakreditasi
2 Pemakalah dalam temu ilmiah Internasional Ada
Nasional
3 Invited speaker dalam temu
ilmiah
Internasional
Nasional
4 Visiting Lecturer Internasional
5 Hak Kekayaan Intelektual (HKI) Paten
Paten Sederhana
Hak Cipta
Merek Dagang
Rahasia Dagang
3
Desain Produk Industri Ada
Indikasi Geografis
Perlindungan Varietas Tanaman
Perlindungan Topograri Sirkuit
Terpadu
6 Teknologi Tepat Guna
7 ModelPurwarupaDesainKarya SeniRekayasa Sosial
8 Buku Ajar (ISBN) Ada
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
ii
RINGKASAN
Teknologi sel punca (stem cell) memiliki potensi dalam upaya penyembuhan penyakit
degeneratif Tujuan penelitian ini yaitu mengidentifikasi gen yang diekspresikan oleh
sel tulang hasil diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus
musculus) yang diinduksi ekstrak etanol bunga flamboyan Delonix regia (Boj ex
Hook) Raf menggunakan Real Time PCR Penelitian ini dilaksanakan di
Laboratorium Riset Jurusan Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam
dan Laboratorium Riset Fakultas Kedokteran Hewan Universitas Syiah Kuala dari
bulan Febuari 2019 sampai Oktober 2019 Penelitian ini menggunakan metode
Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 4 ulangan Perlakuan berupa
penambahan ekstrak etanol bunga flamboyan (D regia) yang terdiri dari dosis 00
mgml sebagai kontrol (tanpa penambahan ekstrak) 06 mgml 07 mgml 08 mgml
dan 09 mgml Media kultur yang digunakan adalah modified Dulbeccorsquos Modified
Eaglersquos Medium (mDMEM) Sel sumsum tulang mencit yang diperoleh secara aspirasi
dikultur selama 7 hari dalam inkubator CO2 5 pada suhu 37 degC Parameter penelitian
ini yaitu hasil kurva amplifikasi yang ditampilkan pada software CFX-96 Biorad yang
menunjukkan kesesuaian antara gen sel target dan primer sel tulang yang digunakan
Primer yang digunakan adalah alkaline-phosphatase (ALP) Hasil penelitian
menunjukkan bahwa ekstrak etanol bunga flamboyan dengan dosis yang digunakan
mampu menginduksi diferensiasi sel punca menjadi sel tulang berupa osteoblas
iii
PRAKATA
Syukur alhamdulillah peneliti ucapkan kepada Allah swt sehingga kami dapat
menyelesaikan laporan kemajuan penelitian lektor yang berjudul rdquoIdentifikasi
Ekspresi Gen Sel Tulang Hasil Diferensiasi Mesenchymal Stem Cell (MSCs) Mencit
yang Diinduksi Ekstrak Bunga Delonix regia Shalawat dan salam kami sanjungkan
kepada Nabi Besar Muhammad saw beserta sahabat dan sanak keluarganya
Laporan kemajuan penelitian tahap satu guna memenuhi salah satu persyaratan
dalam pelaksanaan penelitian yang didanai oleh PNBP melalui Lembaga Penelitian
Universitas Syiah Kuala Laporan kemajuan penelitian ini disusun berdasarkan hasil
penelitian yang dilaksanakan di Laboratorium Riset Biologi FMIPA Laboratorium
Riset FKH Unsyiah dan Laboratorium Kultur PSSP IPB
Penulis banyak mendapatkan bantuan dan bimbingan dari berbagai pihak
selama pelaksanaan penelitian yang masih terus berlangsung sampai saat ini Oleh
karenanya penulis mengucapkan terimakasih kepada
1 Dr Taufik Fuadi Abidin SSi MTech selaku Ketua Lembaga Penelitian
Universitas Syiah Kuala
2 Prof Dr drh Darmawi MSi selaku kepala Laboratorium Riset FKH Unsyiah
3 Dr Silmi Mariya MSi selaku Kepala Laboratorium Kultur PSSP IPB yang telah
mengizinkan penulis untuk penelitian di BIB Saree dengan segala fasilitas yang ada
4 Dr Drh Huda S Darusman MSi selaku Kepala Pusat Studi Satwa Primata IPB
yang telah membantu pelaksanaan penelitian ini
5 Serta seluruh teknisi lapangan dan Laboratorium PSSP yang tidak mungkin disebut
satu persatu
Harapan penulis semoga penelitian ini dapat kami selesaikan sesuai proposal
yang kami ajukan dan dapat bermanfaat bagi perkembangan ilmu pengetahuan
masyarakat dan pemerintah
Banda Aceh 30 Agustus 2019
Penulis
iv
DAFTAR ISI
HALAMAN PENGESAHAN i
DAFTAR ISI ii
RINGKASAN iii
BAB 1 PENDAHULUAN 1
BAB 2 TINJAUAN PUSTAKA 4
BAB 3 TUJUAN DAN MANFAAT 5
BAB 4 METODE PENELITIAN 6
41 Pemeliharaan hewan coba 6
42 Pengambilan sampel Delonix regia 6
43 Ekstraksi 6
44 Pembuatan medium kultur mDMEM dan phosphate buffer saline (PBS) 6
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang 7
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
48 Parameter Penelitian 9
49 Analisis Data Penelitian 10
BAB 5 HASIL DAN LUARAN YANG DICAPAI 11
BAB 6 KESIMPULAN DAN SARAN 22
DAFTAR PUSTAKA 23
LAMPIRAN 27
1 Biodata Peneliti 28
2 Artikel immiah 41
3 Foto dan Gambar Aktifitas 47
1
BAB 1 PENDAHULUAN
Status degeneratif merupakan salah-satu penyakit dengan tingkat kematian yang
cukup tinggi Penyakit kronis ini berhubungan pada proses degenerasi atau ketuaan
sehingga penyakit ini banyak ditemukan pada usia lanjut (Handajani et al 2010)
Kondisi yang terjadi adalah sulitnya pengobatan dan layanan kesehatan
mengakibatkan pasien degeneratif tidak mendapatkan terapi secara maksimal
Kebanyakan pasien ini lebih memilih berdiam diri dan tidak terlalu mementingkan
kesehatannya
Organisasi Kesehatan Dunia (WHO) mencatat pada tahun 2012 sedikitnya ada
839 juta kasus degenerative dan diperkirakan menjadi 115 milyar pada tahun 2025
atau sekitar 29 dari total penduduk dunia dimana penderitanya lebih banyak pada
wanita (30) dibanding pria (29) WHO juga menambahkan bahwa South East Asia
pada tahun 2008 dilaporkan bahwa terdapat sebanyak 55 kematian disebabkan oleh
penyakit degenerative
Prevalensi penyakit degeneratif di Indonesia sendiri juga semakin meningkat
Terdapat faktor pemicu utama terhadap kasus ini yaitu meliputi status gaya hidup dan
sosial ekonomi Hasil Riset Kesehatan Dasar (Riskesdas) tahun 2007 dilaporkan
bahwa terdapat kasus penyakit degeneratif di masyarakat belum terdiagnosis dengan
baik Sebagai contoh yaitu pada kasus hipertensi diketahui terdapat angka sebesar
317 dimana hanya 72 penduduk yang sudah mengetahui memiliki penyakit
degeneratif berupa hipertensi dan hanya 04 kasus yang minum obat hipertensi
Potensi stem cell dalam menyembuhkan berbagai penyakit degeneratif telah
menjadi harapan baru bagi masyarakat (Wobus dan Boheler 2006) Namun biaya
yang harus dikeluarkan untuk sekali terapi stem cell mencapai ratusan juta rupiah
Mengingat biaya terapi yang cukup besar maka terapi ini hanya dapat dirasakan oleh
masyarakat tingkat ekonomi menengah keatas sedangkan masyarakat dibawahnya
tidak Hal ini menimbulkan kesenjangan sosial dan kesenjangan hak sehat bagi
masyarakat Besarnya biaya terapi stem cell tidak terlepas dari mahalnya biaya
operasional produksi stem cell di laboratorium dan biaya aplikasi bagi pasien Salah
satu usaha yang telah dilakukan untuk menekan biaya produksi stem cell adalah
mencari senyawa kimia dari alam sebagai penginduksi diferensiasi stem cell menjadi
sel spesifik sebagai media kultur
Tumbuhan flamboyan Delonix regia (Boj ex Hook) Raf mengandung beberapa
senyawa seperti terpenoid tannin cardiac glycosides dan anthroquuinoes yang
2
berpotensi sebagai antioksidan (Singh dan Kumar 2014) saponin alkaloid
hidrokarbon fitotoksin dan karoten (Shanmukha et al 2011) Bagian bunga D regia
mengandung karotenoid galaktomannon (Jungalwala dan Cama 1962) tannin
saponin flavonoid steroid (Shanmukha et al 2011) dan alkaloid (Pharekh dan
Chanda 2007) Menurut (Jungalwala dan Chama 1962) kandungan karotenoid pada
bunga D regia berperan untuk mengatur komunikasi antar sel memberikan respon
imun transformasi neoplastik pengontrol pertumbuhan dan sebagai regulator enzim
yang bekerja sebagai detoksifikasi karsinogen (Pryor et al 2000)
Berdasarkan penelitian yang dilakukan oleh Eriani et al (2018) menggunakan
ekstrak etanol bunga flamboyan (D regia) secara in vitro mendapatkan hasil
diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus musculus) berupa
nerve-like cell dan fibroblast-like cell dengan pewarnaan HE Selain itu ditemukan sel
yang memiliki karakteristik berbentuk bulat letak inti sel berada di samping dan
berwarna gelap yang menyerupai karakteristik osteoblast Namun penentuan jenis sel
ini tidak dapat dilakukan secara visual melainkan dengan menggunakan teknik
identifikasi berdasarkan ekspresi gen dari setiap sel untuk mendapatkan hasil yang
akurat Salah satu teknik yang digunakan adalah Polymerase Chain Reaction (PCR)
PCR merupakan teknik biologi molekuler untuk mengamplifikasi sekuen DNA
spesifik menjadi ribuan sampai jutaan kopi sekuen DNA dan memberikan informasi
mengenai urutan basa nukleotida dari sampel yang digunakan (Hewajuli dan
Dharmayanti 2014) Dengan demikian gen yang diekpresikan dapat diketahui dan
membuktikan jenis sel yang diperoleh Oleh karena itu penelitian ini penting
dilakukan untuk mengetahui dan membuktikan bahwa hasil diferensiasi dan proliferasi
sel punca mesenkimal berupa sel tulang menggunakan RT-PCR
Tabel 1 Rencana Target Capaian Tahunan
No Jenis Luaran Indikator Capaian
TS TS+1 TS+2
1 Publikasi Ilmiah Internasional Ada
Nasional Terakreditasi
2 Pemakalah dalam temu ilmiah Internasional Ada
Nasional
3 Invited speaker dalam temu
ilmiah
Internasional
Nasional
4 Visiting Lecturer Internasional
5 Hak Kekayaan Intelektual (HKI) Paten
Paten Sederhana
Hak Cipta
Merek Dagang
Rahasia Dagang
3
Desain Produk Industri Ada
Indikasi Geografis
Perlindungan Varietas Tanaman
Perlindungan Topograri Sirkuit
Terpadu
6 Teknologi Tepat Guna
7 ModelPurwarupaDesainKarya SeniRekayasa Sosial
8 Buku Ajar (ISBN) Ada
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
iii
PRAKATA
Syukur alhamdulillah peneliti ucapkan kepada Allah swt sehingga kami dapat
menyelesaikan laporan kemajuan penelitian lektor yang berjudul rdquoIdentifikasi
Ekspresi Gen Sel Tulang Hasil Diferensiasi Mesenchymal Stem Cell (MSCs) Mencit
yang Diinduksi Ekstrak Bunga Delonix regia Shalawat dan salam kami sanjungkan
kepada Nabi Besar Muhammad saw beserta sahabat dan sanak keluarganya
Laporan kemajuan penelitian tahap satu guna memenuhi salah satu persyaratan
dalam pelaksanaan penelitian yang didanai oleh PNBP melalui Lembaga Penelitian
Universitas Syiah Kuala Laporan kemajuan penelitian ini disusun berdasarkan hasil
penelitian yang dilaksanakan di Laboratorium Riset Biologi FMIPA Laboratorium
Riset FKH Unsyiah dan Laboratorium Kultur PSSP IPB
Penulis banyak mendapatkan bantuan dan bimbingan dari berbagai pihak
selama pelaksanaan penelitian yang masih terus berlangsung sampai saat ini Oleh
karenanya penulis mengucapkan terimakasih kepada
1 Dr Taufik Fuadi Abidin SSi MTech selaku Ketua Lembaga Penelitian
Universitas Syiah Kuala
2 Prof Dr drh Darmawi MSi selaku kepala Laboratorium Riset FKH Unsyiah
3 Dr Silmi Mariya MSi selaku Kepala Laboratorium Kultur PSSP IPB yang telah
mengizinkan penulis untuk penelitian di BIB Saree dengan segala fasilitas yang ada
4 Dr Drh Huda S Darusman MSi selaku Kepala Pusat Studi Satwa Primata IPB
yang telah membantu pelaksanaan penelitian ini
5 Serta seluruh teknisi lapangan dan Laboratorium PSSP yang tidak mungkin disebut
satu persatu
Harapan penulis semoga penelitian ini dapat kami selesaikan sesuai proposal
yang kami ajukan dan dapat bermanfaat bagi perkembangan ilmu pengetahuan
masyarakat dan pemerintah
Banda Aceh 30 Agustus 2019
Penulis
iv
DAFTAR ISI
HALAMAN PENGESAHAN i
DAFTAR ISI ii
RINGKASAN iii
BAB 1 PENDAHULUAN 1
BAB 2 TINJAUAN PUSTAKA 4
BAB 3 TUJUAN DAN MANFAAT 5
BAB 4 METODE PENELITIAN 6
41 Pemeliharaan hewan coba 6
42 Pengambilan sampel Delonix regia 6
43 Ekstraksi 6
44 Pembuatan medium kultur mDMEM dan phosphate buffer saline (PBS) 6
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang 7
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
48 Parameter Penelitian 9
49 Analisis Data Penelitian 10
BAB 5 HASIL DAN LUARAN YANG DICAPAI 11
BAB 6 KESIMPULAN DAN SARAN 22
DAFTAR PUSTAKA 23
LAMPIRAN 27
1 Biodata Peneliti 28
2 Artikel immiah 41
3 Foto dan Gambar Aktifitas 47
1
BAB 1 PENDAHULUAN
Status degeneratif merupakan salah-satu penyakit dengan tingkat kematian yang
cukup tinggi Penyakit kronis ini berhubungan pada proses degenerasi atau ketuaan
sehingga penyakit ini banyak ditemukan pada usia lanjut (Handajani et al 2010)
Kondisi yang terjadi adalah sulitnya pengobatan dan layanan kesehatan
mengakibatkan pasien degeneratif tidak mendapatkan terapi secara maksimal
Kebanyakan pasien ini lebih memilih berdiam diri dan tidak terlalu mementingkan
kesehatannya
Organisasi Kesehatan Dunia (WHO) mencatat pada tahun 2012 sedikitnya ada
839 juta kasus degenerative dan diperkirakan menjadi 115 milyar pada tahun 2025
atau sekitar 29 dari total penduduk dunia dimana penderitanya lebih banyak pada
wanita (30) dibanding pria (29) WHO juga menambahkan bahwa South East Asia
pada tahun 2008 dilaporkan bahwa terdapat sebanyak 55 kematian disebabkan oleh
penyakit degenerative
Prevalensi penyakit degeneratif di Indonesia sendiri juga semakin meningkat
Terdapat faktor pemicu utama terhadap kasus ini yaitu meliputi status gaya hidup dan
sosial ekonomi Hasil Riset Kesehatan Dasar (Riskesdas) tahun 2007 dilaporkan
bahwa terdapat kasus penyakit degeneratif di masyarakat belum terdiagnosis dengan
baik Sebagai contoh yaitu pada kasus hipertensi diketahui terdapat angka sebesar
317 dimana hanya 72 penduduk yang sudah mengetahui memiliki penyakit
degeneratif berupa hipertensi dan hanya 04 kasus yang minum obat hipertensi
Potensi stem cell dalam menyembuhkan berbagai penyakit degeneratif telah
menjadi harapan baru bagi masyarakat (Wobus dan Boheler 2006) Namun biaya
yang harus dikeluarkan untuk sekali terapi stem cell mencapai ratusan juta rupiah
Mengingat biaya terapi yang cukup besar maka terapi ini hanya dapat dirasakan oleh
masyarakat tingkat ekonomi menengah keatas sedangkan masyarakat dibawahnya
tidak Hal ini menimbulkan kesenjangan sosial dan kesenjangan hak sehat bagi
masyarakat Besarnya biaya terapi stem cell tidak terlepas dari mahalnya biaya
operasional produksi stem cell di laboratorium dan biaya aplikasi bagi pasien Salah
satu usaha yang telah dilakukan untuk menekan biaya produksi stem cell adalah
mencari senyawa kimia dari alam sebagai penginduksi diferensiasi stem cell menjadi
sel spesifik sebagai media kultur
Tumbuhan flamboyan Delonix regia (Boj ex Hook) Raf mengandung beberapa
senyawa seperti terpenoid tannin cardiac glycosides dan anthroquuinoes yang
2
berpotensi sebagai antioksidan (Singh dan Kumar 2014) saponin alkaloid
hidrokarbon fitotoksin dan karoten (Shanmukha et al 2011) Bagian bunga D regia
mengandung karotenoid galaktomannon (Jungalwala dan Cama 1962) tannin
saponin flavonoid steroid (Shanmukha et al 2011) dan alkaloid (Pharekh dan
Chanda 2007) Menurut (Jungalwala dan Chama 1962) kandungan karotenoid pada
bunga D regia berperan untuk mengatur komunikasi antar sel memberikan respon
imun transformasi neoplastik pengontrol pertumbuhan dan sebagai regulator enzim
yang bekerja sebagai detoksifikasi karsinogen (Pryor et al 2000)
Berdasarkan penelitian yang dilakukan oleh Eriani et al (2018) menggunakan
ekstrak etanol bunga flamboyan (D regia) secara in vitro mendapatkan hasil
diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus musculus) berupa
nerve-like cell dan fibroblast-like cell dengan pewarnaan HE Selain itu ditemukan sel
yang memiliki karakteristik berbentuk bulat letak inti sel berada di samping dan
berwarna gelap yang menyerupai karakteristik osteoblast Namun penentuan jenis sel
ini tidak dapat dilakukan secara visual melainkan dengan menggunakan teknik
identifikasi berdasarkan ekspresi gen dari setiap sel untuk mendapatkan hasil yang
akurat Salah satu teknik yang digunakan adalah Polymerase Chain Reaction (PCR)
PCR merupakan teknik biologi molekuler untuk mengamplifikasi sekuen DNA
spesifik menjadi ribuan sampai jutaan kopi sekuen DNA dan memberikan informasi
mengenai urutan basa nukleotida dari sampel yang digunakan (Hewajuli dan
Dharmayanti 2014) Dengan demikian gen yang diekpresikan dapat diketahui dan
membuktikan jenis sel yang diperoleh Oleh karena itu penelitian ini penting
dilakukan untuk mengetahui dan membuktikan bahwa hasil diferensiasi dan proliferasi
sel punca mesenkimal berupa sel tulang menggunakan RT-PCR
Tabel 1 Rencana Target Capaian Tahunan
No Jenis Luaran Indikator Capaian
TS TS+1 TS+2
1 Publikasi Ilmiah Internasional Ada
Nasional Terakreditasi
2 Pemakalah dalam temu ilmiah Internasional Ada
Nasional
3 Invited speaker dalam temu
ilmiah
Internasional
Nasional
4 Visiting Lecturer Internasional
5 Hak Kekayaan Intelektual (HKI) Paten
Paten Sederhana
Hak Cipta
Merek Dagang
Rahasia Dagang
3
Desain Produk Industri Ada
Indikasi Geografis
Perlindungan Varietas Tanaman
Perlindungan Topograri Sirkuit
Terpadu
6 Teknologi Tepat Guna
7 ModelPurwarupaDesainKarya SeniRekayasa Sosial
8 Buku Ajar (ISBN) Ada
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
iv
DAFTAR ISI
HALAMAN PENGESAHAN i
DAFTAR ISI ii
RINGKASAN iii
BAB 1 PENDAHULUAN 1
BAB 2 TINJAUAN PUSTAKA 4
BAB 3 TUJUAN DAN MANFAAT 5
BAB 4 METODE PENELITIAN 6
41 Pemeliharaan hewan coba 6
42 Pengambilan sampel Delonix regia 6
43 Ekstraksi 6
44 Pembuatan medium kultur mDMEM dan phosphate buffer saline (PBS) 6
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang 7
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang 7
48 Parameter Penelitian 9
49 Analisis Data Penelitian 10
BAB 5 HASIL DAN LUARAN YANG DICAPAI 11
BAB 6 KESIMPULAN DAN SARAN 22
DAFTAR PUSTAKA 23
LAMPIRAN 27
1 Biodata Peneliti 28
2 Artikel immiah 41
3 Foto dan Gambar Aktifitas 47
1
BAB 1 PENDAHULUAN
Status degeneratif merupakan salah-satu penyakit dengan tingkat kematian yang
cukup tinggi Penyakit kronis ini berhubungan pada proses degenerasi atau ketuaan
sehingga penyakit ini banyak ditemukan pada usia lanjut (Handajani et al 2010)
Kondisi yang terjadi adalah sulitnya pengobatan dan layanan kesehatan
mengakibatkan pasien degeneratif tidak mendapatkan terapi secara maksimal
Kebanyakan pasien ini lebih memilih berdiam diri dan tidak terlalu mementingkan
kesehatannya
Organisasi Kesehatan Dunia (WHO) mencatat pada tahun 2012 sedikitnya ada
839 juta kasus degenerative dan diperkirakan menjadi 115 milyar pada tahun 2025
atau sekitar 29 dari total penduduk dunia dimana penderitanya lebih banyak pada
wanita (30) dibanding pria (29) WHO juga menambahkan bahwa South East Asia
pada tahun 2008 dilaporkan bahwa terdapat sebanyak 55 kematian disebabkan oleh
penyakit degenerative
Prevalensi penyakit degeneratif di Indonesia sendiri juga semakin meningkat
Terdapat faktor pemicu utama terhadap kasus ini yaitu meliputi status gaya hidup dan
sosial ekonomi Hasil Riset Kesehatan Dasar (Riskesdas) tahun 2007 dilaporkan
bahwa terdapat kasus penyakit degeneratif di masyarakat belum terdiagnosis dengan
baik Sebagai contoh yaitu pada kasus hipertensi diketahui terdapat angka sebesar
317 dimana hanya 72 penduduk yang sudah mengetahui memiliki penyakit
degeneratif berupa hipertensi dan hanya 04 kasus yang minum obat hipertensi
Potensi stem cell dalam menyembuhkan berbagai penyakit degeneratif telah
menjadi harapan baru bagi masyarakat (Wobus dan Boheler 2006) Namun biaya
yang harus dikeluarkan untuk sekali terapi stem cell mencapai ratusan juta rupiah
Mengingat biaya terapi yang cukup besar maka terapi ini hanya dapat dirasakan oleh
masyarakat tingkat ekonomi menengah keatas sedangkan masyarakat dibawahnya
tidak Hal ini menimbulkan kesenjangan sosial dan kesenjangan hak sehat bagi
masyarakat Besarnya biaya terapi stem cell tidak terlepas dari mahalnya biaya
operasional produksi stem cell di laboratorium dan biaya aplikasi bagi pasien Salah
satu usaha yang telah dilakukan untuk menekan biaya produksi stem cell adalah
mencari senyawa kimia dari alam sebagai penginduksi diferensiasi stem cell menjadi
sel spesifik sebagai media kultur
Tumbuhan flamboyan Delonix regia (Boj ex Hook) Raf mengandung beberapa
senyawa seperti terpenoid tannin cardiac glycosides dan anthroquuinoes yang
2
berpotensi sebagai antioksidan (Singh dan Kumar 2014) saponin alkaloid
hidrokarbon fitotoksin dan karoten (Shanmukha et al 2011) Bagian bunga D regia
mengandung karotenoid galaktomannon (Jungalwala dan Cama 1962) tannin
saponin flavonoid steroid (Shanmukha et al 2011) dan alkaloid (Pharekh dan
Chanda 2007) Menurut (Jungalwala dan Chama 1962) kandungan karotenoid pada
bunga D regia berperan untuk mengatur komunikasi antar sel memberikan respon
imun transformasi neoplastik pengontrol pertumbuhan dan sebagai regulator enzim
yang bekerja sebagai detoksifikasi karsinogen (Pryor et al 2000)
Berdasarkan penelitian yang dilakukan oleh Eriani et al (2018) menggunakan
ekstrak etanol bunga flamboyan (D regia) secara in vitro mendapatkan hasil
diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus musculus) berupa
nerve-like cell dan fibroblast-like cell dengan pewarnaan HE Selain itu ditemukan sel
yang memiliki karakteristik berbentuk bulat letak inti sel berada di samping dan
berwarna gelap yang menyerupai karakteristik osteoblast Namun penentuan jenis sel
ini tidak dapat dilakukan secara visual melainkan dengan menggunakan teknik
identifikasi berdasarkan ekspresi gen dari setiap sel untuk mendapatkan hasil yang
akurat Salah satu teknik yang digunakan adalah Polymerase Chain Reaction (PCR)
PCR merupakan teknik biologi molekuler untuk mengamplifikasi sekuen DNA
spesifik menjadi ribuan sampai jutaan kopi sekuen DNA dan memberikan informasi
mengenai urutan basa nukleotida dari sampel yang digunakan (Hewajuli dan
Dharmayanti 2014) Dengan demikian gen yang diekpresikan dapat diketahui dan
membuktikan jenis sel yang diperoleh Oleh karena itu penelitian ini penting
dilakukan untuk mengetahui dan membuktikan bahwa hasil diferensiasi dan proliferasi
sel punca mesenkimal berupa sel tulang menggunakan RT-PCR
Tabel 1 Rencana Target Capaian Tahunan
No Jenis Luaran Indikator Capaian
TS TS+1 TS+2
1 Publikasi Ilmiah Internasional Ada
Nasional Terakreditasi
2 Pemakalah dalam temu ilmiah Internasional Ada
Nasional
3 Invited speaker dalam temu
ilmiah
Internasional
Nasional
4 Visiting Lecturer Internasional
5 Hak Kekayaan Intelektual (HKI) Paten
Paten Sederhana
Hak Cipta
Merek Dagang
Rahasia Dagang
3
Desain Produk Industri Ada
Indikasi Geografis
Perlindungan Varietas Tanaman
Perlindungan Topograri Sirkuit
Terpadu
6 Teknologi Tepat Guna
7 ModelPurwarupaDesainKarya SeniRekayasa Sosial
8 Buku Ajar (ISBN) Ada
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
1
BAB 1 PENDAHULUAN
Status degeneratif merupakan salah-satu penyakit dengan tingkat kematian yang
cukup tinggi Penyakit kronis ini berhubungan pada proses degenerasi atau ketuaan
sehingga penyakit ini banyak ditemukan pada usia lanjut (Handajani et al 2010)
Kondisi yang terjadi adalah sulitnya pengobatan dan layanan kesehatan
mengakibatkan pasien degeneratif tidak mendapatkan terapi secara maksimal
Kebanyakan pasien ini lebih memilih berdiam diri dan tidak terlalu mementingkan
kesehatannya
Organisasi Kesehatan Dunia (WHO) mencatat pada tahun 2012 sedikitnya ada
839 juta kasus degenerative dan diperkirakan menjadi 115 milyar pada tahun 2025
atau sekitar 29 dari total penduduk dunia dimana penderitanya lebih banyak pada
wanita (30) dibanding pria (29) WHO juga menambahkan bahwa South East Asia
pada tahun 2008 dilaporkan bahwa terdapat sebanyak 55 kematian disebabkan oleh
penyakit degenerative
Prevalensi penyakit degeneratif di Indonesia sendiri juga semakin meningkat
Terdapat faktor pemicu utama terhadap kasus ini yaitu meliputi status gaya hidup dan
sosial ekonomi Hasil Riset Kesehatan Dasar (Riskesdas) tahun 2007 dilaporkan
bahwa terdapat kasus penyakit degeneratif di masyarakat belum terdiagnosis dengan
baik Sebagai contoh yaitu pada kasus hipertensi diketahui terdapat angka sebesar
317 dimana hanya 72 penduduk yang sudah mengetahui memiliki penyakit
degeneratif berupa hipertensi dan hanya 04 kasus yang minum obat hipertensi
Potensi stem cell dalam menyembuhkan berbagai penyakit degeneratif telah
menjadi harapan baru bagi masyarakat (Wobus dan Boheler 2006) Namun biaya
yang harus dikeluarkan untuk sekali terapi stem cell mencapai ratusan juta rupiah
Mengingat biaya terapi yang cukup besar maka terapi ini hanya dapat dirasakan oleh
masyarakat tingkat ekonomi menengah keatas sedangkan masyarakat dibawahnya
tidak Hal ini menimbulkan kesenjangan sosial dan kesenjangan hak sehat bagi
masyarakat Besarnya biaya terapi stem cell tidak terlepas dari mahalnya biaya
operasional produksi stem cell di laboratorium dan biaya aplikasi bagi pasien Salah
satu usaha yang telah dilakukan untuk menekan biaya produksi stem cell adalah
mencari senyawa kimia dari alam sebagai penginduksi diferensiasi stem cell menjadi
sel spesifik sebagai media kultur
Tumbuhan flamboyan Delonix regia (Boj ex Hook) Raf mengandung beberapa
senyawa seperti terpenoid tannin cardiac glycosides dan anthroquuinoes yang
2
berpotensi sebagai antioksidan (Singh dan Kumar 2014) saponin alkaloid
hidrokarbon fitotoksin dan karoten (Shanmukha et al 2011) Bagian bunga D regia
mengandung karotenoid galaktomannon (Jungalwala dan Cama 1962) tannin
saponin flavonoid steroid (Shanmukha et al 2011) dan alkaloid (Pharekh dan
Chanda 2007) Menurut (Jungalwala dan Chama 1962) kandungan karotenoid pada
bunga D regia berperan untuk mengatur komunikasi antar sel memberikan respon
imun transformasi neoplastik pengontrol pertumbuhan dan sebagai regulator enzim
yang bekerja sebagai detoksifikasi karsinogen (Pryor et al 2000)
Berdasarkan penelitian yang dilakukan oleh Eriani et al (2018) menggunakan
ekstrak etanol bunga flamboyan (D regia) secara in vitro mendapatkan hasil
diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus musculus) berupa
nerve-like cell dan fibroblast-like cell dengan pewarnaan HE Selain itu ditemukan sel
yang memiliki karakteristik berbentuk bulat letak inti sel berada di samping dan
berwarna gelap yang menyerupai karakteristik osteoblast Namun penentuan jenis sel
ini tidak dapat dilakukan secara visual melainkan dengan menggunakan teknik
identifikasi berdasarkan ekspresi gen dari setiap sel untuk mendapatkan hasil yang
akurat Salah satu teknik yang digunakan adalah Polymerase Chain Reaction (PCR)
PCR merupakan teknik biologi molekuler untuk mengamplifikasi sekuen DNA
spesifik menjadi ribuan sampai jutaan kopi sekuen DNA dan memberikan informasi
mengenai urutan basa nukleotida dari sampel yang digunakan (Hewajuli dan
Dharmayanti 2014) Dengan demikian gen yang diekpresikan dapat diketahui dan
membuktikan jenis sel yang diperoleh Oleh karena itu penelitian ini penting
dilakukan untuk mengetahui dan membuktikan bahwa hasil diferensiasi dan proliferasi
sel punca mesenkimal berupa sel tulang menggunakan RT-PCR
Tabel 1 Rencana Target Capaian Tahunan
No Jenis Luaran Indikator Capaian
TS TS+1 TS+2
1 Publikasi Ilmiah Internasional Ada
Nasional Terakreditasi
2 Pemakalah dalam temu ilmiah Internasional Ada
Nasional
3 Invited speaker dalam temu
ilmiah
Internasional
Nasional
4 Visiting Lecturer Internasional
5 Hak Kekayaan Intelektual (HKI) Paten
Paten Sederhana
Hak Cipta
Merek Dagang
Rahasia Dagang
3
Desain Produk Industri Ada
Indikasi Geografis
Perlindungan Varietas Tanaman
Perlindungan Topograri Sirkuit
Terpadu
6 Teknologi Tepat Guna
7 ModelPurwarupaDesainKarya SeniRekayasa Sosial
8 Buku Ajar (ISBN) Ada
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
2
berpotensi sebagai antioksidan (Singh dan Kumar 2014) saponin alkaloid
hidrokarbon fitotoksin dan karoten (Shanmukha et al 2011) Bagian bunga D regia
mengandung karotenoid galaktomannon (Jungalwala dan Cama 1962) tannin
saponin flavonoid steroid (Shanmukha et al 2011) dan alkaloid (Pharekh dan
Chanda 2007) Menurut (Jungalwala dan Chama 1962) kandungan karotenoid pada
bunga D regia berperan untuk mengatur komunikasi antar sel memberikan respon
imun transformasi neoplastik pengontrol pertumbuhan dan sebagai regulator enzim
yang bekerja sebagai detoksifikasi karsinogen (Pryor et al 2000)
Berdasarkan penelitian yang dilakukan oleh Eriani et al (2018) menggunakan
ekstrak etanol bunga flamboyan (D regia) secara in vitro mendapatkan hasil
diferensiasi sel punca mesenkimal sumsum tulang mencit (Mus musculus) berupa
nerve-like cell dan fibroblast-like cell dengan pewarnaan HE Selain itu ditemukan sel
yang memiliki karakteristik berbentuk bulat letak inti sel berada di samping dan
berwarna gelap yang menyerupai karakteristik osteoblast Namun penentuan jenis sel
ini tidak dapat dilakukan secara visual melainkan dengan menggunakan teknik
identifikasi berdasarkan ekspresi gen dari setiap sel untuk mendapatkan hasil yang
akurat Salah satu teknik yang digunakan adalah Polymerase Chain Reaction (PCR)
PCR merupakan teknik biologi molekuler untuk mengamplifikasi sekuen DNA
spesifik menjadi ribuan sampai jutaan kopi sekuen DNA dan memberikan informasi
mengenai urutan basa nukleotida dari sampel yang digunakan (Hewajuli dan
Dharmayanti 2014) Dengan demikian gen yang diekpresikan dapat diketahui dan
membuktikan jenis sel yang diperoleh Oleh karena itu penelitian ini penting
dilakukan untuk mengetahui dan membuktikan bahwa hasil diferensiasi dan proliferasi
sel punca mesenkimal berupa sel tulang menggunakan RT-PCR
Tabel 1 Rencana Target Capaian Tahunan
No Jenis Luaran Indikator Capaian
TS TS+1 TS+2
1 Publikasi Ilmiah Internasional Ada
Nasional Terakreditasi
2 Pemakalah dalam temu ilmiah Internasional Ada
Nasional
3 Invited speaker dalam temu
ilmiah
Internasional
Nasional
4 Visiting Lecturer Internasional
5 Hak Kekayaan Intelektual (HKI) Paten
Paten Sederhana
Hak Cipta
Merek Dagang
Rahasia Dagang
3
Desain Produk Industri Ada
Indikasi Geografis
Perlindungan Varietas Tanaman
Perlindungan Topograri Sirkuit
Terpadu
6 Teknologi Tepat Guna
7 ModelPurwarupaDesainKarya SeniRekayasa Sosial
8 Buku Ajar (ISBN) Ada
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
3
Desain Produk Industri Ada
Indikasi Geografis
Perlindungan Varietas Tanaman
Perlindungan Topograri Sirkuit
Terpadu
6 Teknologi Tepat Guna
7 ModelPurwarupaDesainKarya SeniRekayasa Sosial
8 Buku Ajar (ISBN) Ada
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
4
BAB 2 TINJAUAN PUSTAKA
Bunga D regia mengandung senyawa fitokimia yang bersifat sebagai
antioksidan Antioksidan merupakan substansi yang dapat menetralkan aksi radikal
bebas Radikal bebas merupakan molekul yang dapat memicu kerusakan sel
meningkatkan risiko kanker dan penyakit jantung Asupan tinggi antioksidan seperti
vitamin C vitamin E selenium β-carotene dan carotenoid lain dianjurkan pada
penderita diabetes melitus (Franz 2012) β-carotene dapat memperbaiki metabolisme
lipid pada penderita diabetes dengan menurunkan sintesis total kolesterol LDL (Low
Density Lipoprotein) dan VLDL (Very Low Density Lipoprotein) (Mooradian et al
1994)
Bunga D regia mengandung senyawa fitokimia kelompok flavonoid yang
cukup tinggi Flavonoid merupakan senyawa fenolik alam (seringkali dalam formasi
polifenol) yang memiliki sifat antioksidan (Zhai et al 1998) Senyawa-senyawa ini
bertanggung jawab terhadap zat warna merah ungu biru dan sebagian zat warna
kuning dalam tumbuhan Semua flavonoid menurut strukturnya merupakan turunan
senyawa induk ldquoflavonldquo yakni nama sejenis flavonoid yang terbesar jumlahnya dan
juga lazim ditemukan Sebagian besar flavonoid yang terdapat pada tumbuhan terikat
pada molekul gula sebagai glikosida dan dalam bentuk campuran jarang sekali
dijumpai berupa senyawa tunggal Flavonoid dapat digunakan sebagai obat karena
mempunyai bermacam macam bioaktifitas seperti antiinflamasi antikanker
antifertilitas antiviral antidiabetes antidepresant diuretik (Tarmizi 2008)
Kandungan senyawa kimia pada bunga D regia adalah flavonoid tannin
alkaloid saponin steroid karotenoid dan turunannya yaitu lycopene phytoene β-
karoten prolycopene neolycopene δ-lycopene dan γ-lycopene Selain itu juga
terkandung senyawa kimia berupa phenolic acid dan turunannya yaitu gallic acid
protocatehuic acid salisylic acid trans-cinnamic acid dan clhrogenic acid Senyawa
lainnya adalah anthocyanins dan turunannya yaitu cyanidin-3-glucoside cyanidin-3-
gentiobioside dan β-sitosterol (Singh dan Kumar 2014)
Penelitian ini adalah kelanjutan dari beberapa penelitian sebelumnya Penelitian
tentang potensi ekstrak Delonix regia terhadap peningkatan imunostimulan dan uji
toksisitas secara in vivo pada hewan model telah dilaporkan oleh Eriani et al (2018)
terhadap peningkatan dan kapasitas makrofag (Rosnizar et al (2017) Berdasarkan
hasil penelitian Eriani et al (2018) senyawa fitokimia dalam bunga flamboyan (D
regia) mampu menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
5
menjadi nerve-like cell fibroblast-like cell dan diduga osteoblast-like cell yang
diidentifikasi dengan pewarnaan HE Hasil tersebut menjadi informasi penting dalam
kajian perbanyakan (kultur) stem cell sehingga perlu dikembangkan guna peningkatan
kesehatan masyarakat Untuk itu setiap hasil diferensiasi stem cell perlu diuji kembali
dan dikonfirmasi melalui analisis molekuler Produk sel yang teramplifikasi
merupakan hasil terjemahan secara signifikan yang mendeskripsikan fungsi senyawa
ekstrak D regia sebagai media alternatif media kultur sel terbaru
Ekstrak D regia terbukti dapat meningkatkan proliferasi dan diferensiasi
mesenchymal stem cell secara in vitro namun penelitian tersebut masih perlu
dilanjutkan mengingat parameter yang digunakan masih berupa parameter morfologi
Pendeteksian akan keberadaan osteoblas dan osteosit hasil proliferasi dan diferensiasi
sel MSC perlu dilakukan secara molekuler agar hasil yang didapat lebih akurat
BAB 3 TUJUAN DAN MANFAAT
Tujuan penelitian ini adalah untuk melihat pengaruh penambahan ekstrak
metanol Delonik regia terhadap hasil ekspresi gen Alkaline Phosphatase dan Beta
Actin sebagai indikasi keberadaan osteosit menggunakan qPCR Sedangkan manfaat
penelitian ini adalah memberikan informasi ilmiah dan bermanfaat dalam aplikasi
klinis untuk membantu penyembuhan penyakit degeneratif pada tulang melalui
teknologi sel puncastem cell terutama osteoporosis
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
6
BAB 4 METODE PENELITIAN
41 Pemeliharaan hewan coba
Hewan coba yang digunakan dalam penelitian ini adalah mencit jantan galur
Balb-C (Mus musculus) Hewan yang digunakan berumur dua bulan dan memiliki
berat badan rata-rata 30 g Kandang mencit berukuran 48 cm x 36 cm x 13 cm yang
ditutupi dengan jaring-jaring kawat pada bagian atasnya Bagian alas dari kandang
diisi dengan sekam padi setinggi 3 cm dari permukaan dasar kandang Pemberian
makan dan minum dilakukan secara ad libitum
42 Pengambilan sampel bunga D regia
Sampel bunga D regia yang digunakan berasal dari kawasan Banda Aceh dan
sekitarnya Kemudian petal bunga dipisahkan dengan bagian bunga lainnya Petal
dicuci dengan air mengalir hingga bersih kemudian dipotong-potong dan dikeringkan
tanpa terkena sinar matahari langsung Petal bunga D regia yang sudah kering
kemudian dihaluskan dengan menggunakan blender sehingga menjadi bubuk
homogen (Pasaribu et al 2015)
43 Ekstraksi
Sebanyak 1000 g bubuk bunga D regia disiapkan terlebih dahulu Kemudian
sampel dimaserasi dengan metanol absolut selama 3 x 24 jam Setelah itu disaring
menggunakan kertas saring untuk memisahkan filtratnya Filtrat hasil penyaringan
kemudian dipekatkan dengan menggunakan rotary evaporator pada suhu 550C sampai
diperoleh ekstrak kental Ekstrak yang diperoleh selanjutnya ditempatkan dalam botol
tertutup dan disimpan di lemari pendingin pada suhu 4-80C Ekstrak dibuat dalam
bentuk suspensi berupa ekstrak cair yang dilarutkan dengan akuades untuk
mempermudah pemberian kepada hewan coba (Pasaribu et al 2015)
44 Pembuatan medium kultur (modified Dulbeccorsquos modified eaglesrsquos medium)
mDMEM dan phosphate buffer saline (PBS)
Media kultur mDMEM dibuat sebanyak 100 ml dengan cara terlebih dahulu
menimbang DMEM-Powder sebanyak 1 g dan dimasukkan ke dalam gelas beker
selanjutnya ditambahkan aquadest 100 mL dan diaduk rata Natrium hipoklorit
(NaHCO3) ditimbang sebanyak 037 g dan dicampurkan ke dalam larutan pada gelas
beker Pekerjaan selanjutnya dilakukan di dalam LAF (Laminar Air Flow) Larutan
AANE dan ITS masing-masing sebanyak 100 microL gentamycin 125 microL NBCS 1 mL
ditambahkan ke dalam gelas beker Kemudian larutan disterilkan menggunakan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
7
mikrofilter dengan ukuran pori 022 microm dan dimasukkan ke dalam botol penyimpanan
Botol diberi label dan tutup botol direkatkan dengan parafilm Selanjutnya disimpan
dalam lemari pendingin
Larutan stok PBS terdapat dua jenis sesuai penggunaannya yaitu larutan stok
PBS untuk sentrifugasi dan untuk pencucian gelatin Larutan stok PBS yang digunakan
untuk proses sentrifugasi dibuat dengan mencampurkan 096 g PBS-Powder dengan
100 mL aquadest dan ditambahkan NBCS sebanyak 01 mL Sedangkan pembuatan
larutan stok untuk pencuci gelatin hanya dengan melarutkan 096 g PBS-Powder dalam
100 mL aquadest Kedua larutan stok PBS ini ditambahkan gentamycin masing-
masing sebanyak 125 microL saat akan digunakan Selanjutnya larutan stok PBS
dimasukkan dalam botol diberi label dan direkatkan tutup botol dengan parafilm
selanjutnya larutan stok PBS disimpan dalam lemari pendingin
45 Persiapan kultur Mesenchymal Stem Cell (MSC) sumsum tulang
Kaca penutup diletakkan dalam cawan petri dan dilapisi gelatin 01 sebanyak
1 mL selama satu jam pada suhu kamar Cawan petri dibersihkan dari gelatin dengan
cara dibilas dengan menggunakan larutan modified phosphate buffer saline (mPBS)
dan dibiarkan selama 5 menit Selanjutnya cawan petri diisi dengan modified
Dulbeccorsquos modified eaglesrsquos medium (mDMEM) sebanyak 2 mL dan diinkubasi
dalam inkubator CO2 5 selama satu jam pada suhu 37degC
46 Isolasi dan kultur primer Mesenchymal Stem cell (MSC) sumsum tulang
Mencit dikorbankan dengan metode dislokasi servikalis Selanjutnya
dilakukan pengambilan tulang femur dan tibia Tulang dibersihkan dari jaringan otot
dan lemak yang dilakukan dalam larutan mPBS Setelah bersih tulang dimasukkan
dalam cawan petri yang berisi larutan mPBS steril Kemudian kedua bagian ujung
tulang femur dan tibia dipotong dengan gunting
Sumsum tulang dibilas dengan mPBS menggunakan spuid Sumsum tulang
dikeluarkan dengan cara memasukkan kanul spuid yang berisi mPBS ke dalam rongga
tulang Setelah kanul spuid masuk pada rongga tulang mPBS dikeluarkan sehingga
sumsum tulang terdorong untuk keluar Suspensi sumsum tulang ditampung dalam
cawan petri Pemipetan dilakukan secara berulang dan disentrifugasi selama 10 menit
pada kecepatan 3000 rpm Hasil sentrifugasi dicuci dengan mPBS sebanyak empat kali
dan satu kali dicuci dengan mDMEM Sebelum diinkubasi jumlah sel dihitung
menggunakan hemositometer dengan rumus perhitungan total sel (selml) (Djuwita et
al 2010)
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
8
Total sel (selml) = rata-rata jumlah sel pada 5 kotak x faktor pengencer x 104
Selanjutnya suspensi sumsum tulang dengan konsentrasi 1 x 106 dimasukkan
ke dalam cawan petri yang telah berisi medium mDMEM sebanyak 1 mL Kemudian
diinkubasi dalam inkubator CO2 5 pada suhu 37degC (Kang et al 2005) Kemudian
dilakukan evaluasi setelah satu hari inkubasi dan dilakukan pergantian medium serta
penambahan ekstrak C quadrangula sesuai dengan dosis perlakuan yang digunakan
sebanyak 10 microL Medium kultur diganti setiap dua hari sekali dan kultur dilakukan
sampai hari ketujuh (Djuwita et al 2012)
47 Evaluasi hasil kultur Mesenchymal Stem Cell (MSC) sumsum tulang
1 Isolasi total RNA
Isolasi total RNA menggunakan ReliaPrepTM RNA Cell Miniprep System
(Promega Z6011) Sel kultur yang telah diperoleh dimasukkan dalam tabung sentrifus
steril dan disentrifugasi pada kecepatan 300 rpm selama 5 menit Sel pelet hasil
sentrifugasi dicuci dengan PBS dingin steril kemudian disentrifugasi pada kecepatan
300 rpm selama 5 menit dan supernatan dipisahkan dengan hati-hati Kemudian buffer
BL dan TG ditambahkan sebanyak 250 microl dan di vortex atau pipetting selama 5 detik
Isopropanol ditambahkan sebanyak 85 microl dan dihomogenkan menggunakan vorteks
selama 5 detik Minicolumn dimasukkan dalam tabung koleksi dan lysate dimasukkan
kedalam minicolumn tersebut Liquid didalam tabung koleksi dibuang dan minicolumn
dimasukkan kembali kedalam tabung koleksi RNA Wash Solution sebanyak 500 microl
dimasukkan kedalam minicolumn dan sentrifugasi dengan kecepatan 12000-14000
rpm selama 30 detik
DNase I incubation solution disiapkan dengan penambahan beberapa reagen
sesuai protokol dan dicampurkan dengan pemipetan secara perlahan (tidak
menggunakan vorteks) DNase I incubation solution ditambahkan sebanyak 30microl pada
membran Minicolumn dan inkubasi selama 15 menit pada suhu 20deg-25degC kemudian
Column Wash Solution ditambahkan sebanyak 200 microl pada minicolumn dan
disentrifugasi dengan kecepatan12000-14000 rpm selama 15 detik selanjutnya RNA
Wash Solution ditambahkan sebanyak 500 microl dan disentrifugasi dengan
kecepatan12000-14000 rpm selama 30 detik Tabung koleksi dibuang beserta dengan
supernatan Minicolumn dipindahkan ke dalam tabung koleksi baru dan RNA Wash
Solution ditambahkan sebanyak 300 microl dan disentrifugasi dengan kecepatan tinggi
selama 2 menit ReliaPrepTM Minicolumn yang berada pada tabung koleksi
dipindahkan pada tabung elusi Nuclease-free water ditambahkan pada membran
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
9
minicolumn sebanyak 30 microl Tabung minicolumn dibuang dan tabung elusi ditutup
Tabung elusi mengandung RNA purifikasi dan setelahnya dilakukan sintesis cDNA
2 Sintesis cDNA
Sintesis cDNA menggunakan GoScriptTM Reverse Transcription System
(Promega A5000) RNA dan primer mix disiapkan dengan cara mencampurkan 1 microl
sampel RNA random primer sebanyak 01 microl dan nuclease free-water sebanyak 39
microl yang kemudian dipanaskan pada suhu 70degC selama 5 menit Komponen reverse
transcription reaction mix disiapkan dengan cara mencampurkan GoScriptTM5
reaction buffer sebanyak 4 microl MgCl2 sebanyak 12 microl PCR nucleotid mix sebanyak
10 microl recombinan RNasin ribonuclease inhibitor sebanyak 05 microl GoScriptTM reverse
transcriptase sebanyak 10 dan nuclease free-water sebanyak 73 microl Reverse
transcription master mix ditambahkan sebanyak 15 microl pada setiap tabung yang berisi
sampel Selanjutnya dilakukan reaksi reverse transcription pada mesin RT-PCR
dengan tahapan anneal pada suhu 25degC selama 5 menit tahap extend pada suhu 37degC
selama 1 jam dan tahap inactivated reverse transcriptase pada suhu 70degC selama 15
menit Sampel cDNA yang telah diperoleh disimpan dalam lemari penyimpanan
dengan suhu -20degC sebelum dilakukan proses reaksi amplifikasi pada PCR
3 Analisis ekspresi gen menggunakan RT-PCR
Proses qPCR dilakukan menggunakan kit GoTaqreg qPCR Master Mix
(Promega A6001) Reagen qPCR Master Mix disiapkan dengan cara mencampurkan
GoTaqreg qPCR Master Mix sebanyak 125 microl nuclease free-water sebanyak 75 microl dan
primer masing-masing sebanyak 2 microl Selanjutnya dimasukkan sampel cDNA
sebanyak 3 microl pada setiap tabung reaksi dan ditambahkan dengan qPCR Master Mix
yang telah dibuat Semua sampel dimasukkan kedalam mesin RT-PCR Biorad
Tabel 2 Jenis primer yang digunakan dalam penelitian
Jenis Primer Primer Forward Primer Reverse
Beta-actin 5rsquo ATGAAGATCCTGACCGAGCG 3rsquo 5rsquo TACTTGCGCTCAGGAGGAGC 3rsquo
Alkaline-
phosphatase 5rsquo GAGCAGGAACAGAAGTTTGC 3rsquo 5rsquo GTTGCAGGGTCTGGAGAGTA 3rsquo
48 Parameter Penelitian
Parameter yang diamati pada penelitian ini adalah hasil amplifikasi yang
ditampilkan berdasarkan grafik pada software PCR (CFX-96 Biorad) yang
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
10
menunjukkan kesesuaian antara gen sel target dan primer yang digunakan DNA yang
teramplifikasi menunjukkan spesifitas hasil kultur sel dari sel tulang
49 Analisis Data Penelitian
Analisis data dilakukan secara deskriptif sesuai dengan kurva amplifikasi yang
diperoleh dari hasil RT-PCR Perbedaan hasil amplifikasi dianalisis dengan
menggunakan rumus Livaks R = 2ΔCt (R = 2[Ct sample ndash Ct control])
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
11
BAB 5 HASIL DAN LUARAN YANG DICAPAI
51 Diferensiasi Sel Punca Mesenkimal
Hasil pengamatan diferensiasi MSC dalam medium kultur dengan ekstrak
etanol bunga flamboyan (Dregia) diperoleh tiga jenis sel yang diduga hasil
diferensiasi MSC sumsum tulang mencit (Mus musculus) yaitu menyerupai sel
fibroblas sel saraf dan sel osteoblas Sel fibroblas ditandai dengan adanya penjuluran
sitoplasma dan memiliki inti sel berbentuk lonjong Sel fibroblas hasil diferensiasi
MSC pada medium kultur dapat dilihat pada Gambar 51
Gambar 51 Morfologi sel fibroblas dalam medium kultur
(A Inti sel B Penjuluran sitoplasma)
Gambar 51 memperlihatkan kesesuaian morfologi sel fibroblas pada medium
kultur dengan pernyataan Mescher (2010) yang mengatakan bahwa morfologi
fibroblas aktif ditandai dengan adanya percabangan pada sitoplasma inti sel berbentuk
lonjong besar dan berwarna pucat serta sitoplasmanya penuh dengan retikulum
endoplasma kasar Sel fibroblas terlibat dalam proses penyembuhan luka dan proses
fisologis dalam tiap jaringan dan organ dalam tubuh selain itu sel fibroblas juga
terlibat aktif dalam pembentukan serat-serat terutama serat kolagen (Kurniawati et al
2015) Berdasarkan informasi tersebut sel fibroblas yang diperoleh dari hasil
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
12
diferensiasi MSC dapat diaplikasikan dalam terapi sel punca (stem cell) pada penderita
luka bakar dan penderita aging (penuaan)
Jenis sel kedua yang dijumpai dalam medium kultur adalah menyerupai sel
saraf Sel saraf dalam medium kultur ditandai dengan adanya penjuluran sitoplasma
ke segala arah dan memiliki inti sel yang terletak di bagian sentral Sel saraf yang
dijumpai pada medium kultur dapat dilihat pada Gambar 42 di bawah ini
Gambar 52 Morfologi sel saraf dalam medium kultur a Sel saraf muda b Sel saraf
dewasa (A Inti sel B Sitoplasma C Akson)
Gambar 52 menunjukkan bahwa terjadi proses perkembangan sel saraf dalam
medium kultur yang diikuti proses maturasi Sel saraf muda memiliki volume
sitoplasma lebih banyak dengan penjuluran lebih pendek (Gambar 52a) Sebaliknya
Gambar 52b merupakan sel saraf dewasa dengan penjuluran sitoplasma membentuk
akson lebih panjang Berdasarkan Gambar 52 badan sel saraf dewasa terlihat lebih
kecil dibandingkan dengan badan sel saraf muda hal ini terjadi akibat penurunan
volume sitoplasma yang diikuti pembentukan penjuluran sitoplasma menjadi akson
dan dendrit
Sel ketiga hasil diferensiasi MSC adalah sel tulang yang secara morfologi
menyerupai osteoblas dengan ciri-ciri sel berbentuk bulat letak inti sel berada di
sentral dan berukuran besar sebagaimana yang terlihat pada Gambar 53 dibawah ini
a b
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
13
Gambar 53 Morfologi sel osteoblast dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Kontrol b Pada dosis 06 mgml
(A Inti sel B Sitoplasma)
Karakteristik sel pada Gambar 53 sesuai dengan pernyataan (Djuwita et al
2012) yang mengatakan bahwa osteoblas yang aktif mensintesis matriks tulang
memiliki inti sel yang besar apparatus golgi dan retikulum endoplasma yang banyak
Akan tetapi osteoblas akan berubah bentuk menjadi kuboid yang besar setelah
proteoblas berhenti mengalami proliferasi
Gambar 54 Morfologi sel tulang dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) a Pada dosis 07 mgml b Pada
dosis 08 mgml (A Inti sel B Sitoplasma C Penjuluran sitoplasma)
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
14
Sel osteoblas pada Gambar 54 memperlihatkan bentuk yang sedikit berbeda
Sel tulang pada (Gambar 54a) memperlihatkan morfologi sel yang berbentuk bulat
dan memiliki inti sel yang besar sedangkan pada (Gambar 54b) memperlihatkan
morfologi sel tulang yang berukuran besar memiliki inti sel yang besar dan terdapat
sedikit penjuluran pada sitoplasmanya Hal ini disebabkan karena terjadinya
transformasi osteoblas menuju osteosit yang melibatkan perubahan morfologi serta
penurunan ukuran diameter sel Osteosit adalah sel yang berasal dari osteoblas dan sel
yang membentuk komponen selular utama pada tulang yang dewasa Osteosit
merupakan sel dewasa yang memiliki aparatus golgi dan retikulum endoplasma kasar
yang lebih sedikit tetapi memiliki lisosom yang lebih banyak dibandingkan dengan
osteoblas dan memiliki penjuluran pada sitoplasmanya (Stevenson dan Marsh 2007)
Beberapa studi menunjukkan bahwa ukuran osteosit berbeda-beda tergantung pada
tipe tulang dan aktivitas serta ukuran dari osteoblas Bentuk dan ukuran dari osteosit
yang baru tertanam pada tulang juga dapat bervariasi Hal ini tergantung pada umur
masing-masing osteosit dan tingkat kematangan osteosit (Dallas dan Bonewald 2010)
Gambar 55 Morfologi sel osteoblas dalam medium kultur yang ditambahkan ekstrak
etanol bunga flamboyan (D regia) dosis 09 mgml (A Inti sel B
Sitoplasma)
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
15
Osteoblas merupakan sel tulang yang berperan dalam menghasilkan bahan
organik untuk menyusun tulang Sel yang secara morfologi menyerupai osteoblas
dalam medium kultur merupakan sel yang menjadi target identifikasi pada penelitian
ini Pengidentifikasian sel yang menyerupai osteoblas ini dilakukan secara molekular
dengan mengidentifikasi gen alkaline phosphatase (ALP) sebagai penanda keberadaan
dari sel tersebut ALP merupakan gen pertama yang terdeteksi pada progenitor sel
osteoblas pada proses diferensiasi osteoblas (Zur Nieden et al 2003) dan penanda sel
tulang yang paling sering digunakan (Singer dan Eyre 2008) ALP sering digunakan
untuk mengukur aktivitas osteoblas karena sebagian besar ALP yang berada dalam
serum berasal dari osteoblas (Singer dan Eyre 2008) Berdasarkan pengamatan secara
visual dalam medium kultur sel yang menyerupai osteoblas ini diperoleh pada kultur
MSC kontrol dan semua sampel yang diberikan perlakuan dosis ekstrak etanol bunga
D regia dan dilanjutkan dengan identifikasi DNA sel target secara molekular
berdasarkan ekspresi gen ALP menggunakan mesin RT-PCR
52 Identifikasi Osteoblas Menggunakan Real Time PCR
Teknik identifikasi molekular yang sering digunakan adalah identifikasi
menggunakan Real Time PCR (RT-PCR) Hasil analisis menggunakan RT-PCR
diperoleh dalam bentuk kurva yang ditampilkan pada layar komputer dengan software
yang ditentukan Kurva amplifikasi (amplification curve) dan kurva puncak pelelehan
(melt peak curve) merupakan dua kurva yang diperlukan dalam analisis hasil
identifikasi menggunakan RT-PCR sebagaimana yang dilakukan pada penelitian ini
untuk mendapatkan hasil yang akurat
Hasil identifikasi molekular yang dinyatakan berdasarkan kurva amplifikasi
menggambarkan bahwa sampel dengan primer β-aktin teramplifikasi di atas garis
ambang batas (base line threshold) dengan awal siklus terampilifikasi relatif sama dan
hasil analisis menggunakan melt peak curve menggambarkan bahwa semua sampel
dengan primer β-aktin memiliki titik puncak pelelehan pada suhu yang sama Hal ini
menyatakan bahwa sampel dengan primer β-aktin pada semua perlakuan adalah
homogen karena tidak membentuk titik puncak pelelehan yang berbeda Analisis kurva
ampilifikasi pada sampel dengan primer ALP menggambarkan bahwa keempat sampel
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
16
uji (U1 U2 U3 dan U4) teramplifikasi di atas base line threshold sedangkan pada
sampel kontrol (U0) menunjukkan hasil negatif terhadap osteoblast dikarenakan grafik
sigmoid berada dibawah base line threshold Begitu juga hasil evaluasi menggunakan
melt peak curve yang menggambarkan bahwa keempat sampel uji dengan primer ALP
memiliki titik puncak suhu pelelehan yang sama sehingga tidak adanya hasil false
positive
Amplifikasi yang dijalankan pada mesin RT-PCR ditampilkan dalam bentuk
kurva pada layar komputer dengan software Biorad CFX-96 dengan spesifikasi
perlakuan sampel uji P0U0 P1U1 P2U2 P3U3 dan P4U4 ditampilkan pada Gambar 46
di bawah ini
Gambar 56 Kurva amplifikasi sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Hasil kurva amplifikasi yang diperoleh dari pengujian menggunakan mesin
RT-PCR menunjukkan bahwa sampel uji memperlihatkan hasil yang positif keculi
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan
17
pada perlakuan kontrol dengan primer ALP dimana garis berada di bawah base line
threshold Hasil amplifikasi yang diperoleh melewati garis ambang batas (base line
threshold) dimana setiap sinyal flouresen terbaca dan menunjukkan DNA yang
teramplifikasi Base line threshold merupakan garis horizontal pada sumbu x (garis
lurus berwarna hijau) yang menjadi tolak ukur grafik sigmoid sampel yang
teramplifikasi Amplifikasi ditetapkan berdasarkan intensitas flouresen semakin
banyak produk amplifikasi yang dihasilkan maka akan semakin besar akumulasi
flouresen yang terbaca (NurrsquoUtami 2011) Kurva amplifikasi juga menunjukkan
bahwa jumlah siklus teramplifikasinya setiap sampel berbeda-beda berdasarkan
dengan primer yang digunakan Sampel dengan primer β-aktin yang merupakan
reference gene dari DNA sel target telah teramplifikasi pada siklus ke 26 sedangkan
sampel dengan primer alkaline phosphatase (ALP) teramplifikasi pada siklus ke 32
Perbedaan siklus teramplifikasinya setiap sampel diduga dipengaruhi oleh
desain dan konsentrasi primer banyak siklus PCR serta suhu annealing yang
digunakan pada proses amplifikasi PCR Menurut Grunenwald (2003) proses
amplifikasi oleh PCR dipengaruhi oleh berbagai parameter antara lain kualitas dan
konsentrasi DNA template desain dan konsentrasi primer konsentrasi ion
magnesium konsentrasi empat deoksinukleotida (dNTP) buffer PCR konsentrasi Taq
polymerase siklus PCR dan penggunaan teknik hotstart Selain itu perbedaan ini
disebabkan karena β-aktin merupakan protein yang sangat penting bagi sel eukariotik
Protein ini berperan penting untuk membentuk jaringan yang memberikan dukungan
mekanik sel menentukan bentuk sel pergerakan sel dan pembelahan sel Sifat dari
gen aktin adalah housekeeping gene yaitu gen yang memiliki tingkat ekspresi yang
stabil di berbagai jaringan pada semua tahapan perkembangan Sifat ini menjadikan
gen aktin digunakan sebagai kontrol internal (reference gene) pada analisis ekspresi
gen menggunakan metode qRT-PCR (Hannum et al 2010) Oleh karena itu sampel
dengan primer β-aktin akan lebih mudah teramplifikasi dibandingkan sampel dengan
primer ALP yang merupakan primer dari DNA sel target Berdasarkan kurva
amplifikasi 56 sampel dengan primer β-aktin lebih cepat teramplifikasi dengan nilai
Relative Fluorecent Units (RFU) yang tinggi Nilai RFU menyatakan akumulasi
flouresen yang terbaca Semakin tinggi nilai RFU maka semakin banyak produk
amplifikasi (amplikon) yang dihasilkan
Peningkatan fluoresen ditandai dengan terbentuknya grafik sigmoid seperti
yang tergambar pada Gambar 56 (garis berwarna hijau) yang akan berpotongan
18
dengan base line threshold Penelitian ini menggunakan label flouresen berupa SYBR
green I SYBR green I akan mengukur intensitas flouresen secara proporsional sesuai
dengan produk PCR yang dihasilkan Akumulasi dari amplikon PCR meningkat
seiring dengan meningkatnya siklus reaksi yang menunjukkan bahwa molekul SYBR
green I berikatan dengan DNA Akan tetapi SYBR green I merupakan label flouresen
yang tidak spesifik sehingga dapat menghasilkan sinyal pengujian false-positive
karena terbentuknya produk yang tidak spesifik Sensitifitas deteksi dengan
menggunakan SYBR green I dipengaruhi oleh pembentukan primer-dimer spesifisitas
primer yang rendah konsentrasi primer dapat membatasi produk amplifikasi dan
terbentuknya struktur sekunder pada produk PCR Faktor-faktor ini dapat
mengarahkan pada terbentuknya produk DNA utas ganda yang tidak diharapkan yang
dapat berikatan dengan SYBR green I dan menghasilkan sinyal flouresen Oleh karena
itu perlu dilakukannya analisis formasi dari kurva pelelehan (melting curve) dan kurva
puncak pelelehan (melt peak curve) (Pestana et al 2010) Melt peak curve dapat
menunjukkan ada atau tidaknya produk non-spesifik Kurva puncak pelelehan sampel
uji dilampirkan pada Gambar 57
19
Gambar 57 Kurva puncak pelelehan (melt peak curve) sampel uji
Keterangan
P Primer β-aktin U Primer alkaline phosphatase
P0 Kontrol U0 Kontrol
P1 Dosis 06 mgml U1 Dosis 06 mgml
P2 Dosis 07 mgml U2 Dosis 07 mgml
P3 Dosis 08 mgml U3 Dosis 08 mgml
P4 Dosis 09 mgml U3 Dosis 09 mgml
Gambar 57 menunjukkan bahwa grafik sigmoid untuk semua sampel dengan
primer β-aktin berada di atas base line threshold akan tetapi satu sampel dengan
primer ALP yaitu pada perlakuan kontrol (U0) berada dibawah base line threshold
Hal ini menunjukkan bahwa semua sampel memiliki sel hidup yang ditunjukkan
dengan adanya senyawa β-actin pada setiap sampel Akan tetapi hasil pengamatan
morfologi sel osteoblast yang ada pada perlakuan kontrol tidak dapat di buktikan
sebagai sel osteoblast hal ini dikarenakan pada perlakuan kontrol grafik sigmoid
berada dibawah base line threshold Hasil yang diperoleh dari grafik amplikasi juga di
dukung oleh analisis grafik puncak pelelehan (melt peak curve) Hasil dapat dikatakan
positif apabila titik puncak pelelehan yang diperoleh juga berada di atas base line
threshold dan pada satu titik yang sama sedangkan apabila terbentuk produk non-
spesifik maka grafik akan berada di bawah base line threshold atau akan membentuk
titik puncak pada suhu yang berbeda dengan amplikon dari produk spesifik atau melt
20
peak dapat pula memiliki lebih dari satu puncak suhu Pestana et al (2010)
mengatakan bahwa semua produk PCR untuk primer set tertentu harus memiliki nilai
suhu pelelehan (Tm) yang sama kecuali jika terdapat adanya mispriming kontaminasi
atau primer-dimer Berdasarkan kurva (Gambar 57) produk PCR yang dihasilkan
adalah homogen dengan semua sampel uji memiliki nilai Tm yang sama
Hasil analisis formasi melt peak curve menunjukkan bahwa pada sampel uji
U1 U2 U3 dan U4 terdapat sel osteoblast dikarenakan grafik sigmoid pada melt peak
curve berada di atas base line threshold Sedangkan sel osteoblast dikatakan negatif
pada sampel kontrol (U0) Selain itu dapat dinyatakan bahwa sel yang secara
morfologi menyerupai sel osteoblast pada dosis ekstrak 06 mgml 07 mgml 08
mgml dan 09 mgml merupakan sel osteoblast secara ekspresi gen sedangkan pada
sampel kontrol yang secara morfologi juga menunjukkan adanya sel osteoblast
dinyatakan negatif berdasarkan ekspresi gen Hal ini menjelaskan bahwa ekstrak
etanol bunga D regia mampu menginduksi proliferasi dan diferensiasi MSC menjadi
osteoblas dengan terdeteksinya gen ALP
Kandungan kimia pada bunga Dregia yang dapat memicu diferensiasi
osteoblas adalah flavonoid seperti yang dilaporkan oleh Zhang et al (2008) bahwa
senyawa flavonoid dapat memicu diferensiasi osteoblas sehingga dengan
menggunakan dosis yang tepat MSC dapat berdiferensiasi menjadi osteoblas Selain
itu tumbuhan flamboyan yang tergolong kelompok polong-polongan dari Familia
Fabacea ini diduga memiliki kandungan fitoestrogen Fitoestrogen merupakan
senyawa yang ditemukan pada tumbuhan kacang-kacangan dan merupakan senyawa
yang mirip dengan estrogen Salah satu jenis dari fitoestrogen adalah isoflavonoid
yang terdiri dari genistein dan daidzein Genistein yang merupakan komponen dalam
fitoestrogen dapat menstimulasi diferensiasi sel punca sumsum tulang menjadi
osteoblas Diferensiasi tersebut terjadi karena adanya peningkatan Cbfa-1 (Ducy
2000) dan Transforming Growth Factor beta-1 (TGFacirc-1) (Heim et al 2004)
Senyawa Cbfa-1 adalah faktor transkripsi pada sel progenitor menjadi osteoblas dan
berperan dalam mengontrol proses perkembangan diferensiasi dan pematangan fungsi
osteoblas (Ducy 2000) Senyawa TGFacirc-1 mengatur gen transkripsi pada sel melalui
sinyal reseptor (Roberts et al 1990) Ogita et al (2008) melaporkan bahwa genistein
dan daidzein juga dapat meningkatkan proliferasi osteoblas melalui proses sintesis
protein dengan mengatur sintesis Cbfa-1 dan Bone Morphogenic Protein-2 (BMP-2)
(Federici et al 2004)
21
Penelitian Eriani et al (2018) yang juga menggunakan ekstrak etanol bunga
(D regia) memperoleh hasil berdasarkan pengamatan morfologi terdapat sel yang
menyerupai osteoblas pada dosis ekstrak etanol bunga D regia 08 mgml
Berdasarkan hasil penelitian ini ekstrak etanol bunga flamboyan (D regia) dengan
dosis 08 mgml dan 09 mgml terbukti dapat memicu proliferasi dan diferensiasi MSC
menjadi osteoblas Berdasarkan informasi tersebut maka dosis ekstrak etanol bunga
D regia sebesar 08 mgml dan 09 mgml dapat dijadikan salah satu faktor yang dapat
menginduksi proliferasi dan diferensiasi MSC dalam medium kultur menjadi
osteoblas Sehingga hasil kultur MSC berupa osteoblas ini dapat diaplikasikan pada
penderita osteoporosis melalui terapi stem cell
22
BAB 6 KESIMPULAN DAN SARAN
Simpulan dari penelitian ini adalah
1 Pemberian ekstrak etanol bunga flamboyan (D regia) memberikan pengaruh
terhadap diferensiasi mesenchymal stem cell sumsum tulang mencit
2 Deteksi dengan RT-PCR menunjukkan 4 sampel positif teramplifikasi gen alkaline
phosphatase sebagai penyandi sel tulang
3 Analisis RT-PCR menunjukkan pemberian ekstrak etanol bunga flamboyan (D
regia) pada dosis 06 mgml 07 mgml 08 mgml dan 09 mgml mampu
menginduksi diferensiasi mesenchymal stem cell sumsum tulang mencit menjadi
osteoblas
Sedangkan saran yang dapat diberikan dari penelitian ini adalah perlunya
dilakukan uji toksisitas dari Delonik regia terhadap kondisi sel pada medium kultur
Juga diharapkan di masa yang akan datang penelitian lanjutan mengenai aplikasi klinis
sel punca mesenkimal terhadap penyakit degeneratif lebih banyak dilakukan demi
kemajuan ilmu pengetahuan di Indonesia
23
DAFTAR PUSTAKA
Adje F Lozano Y F Meudec E Lozano P Adima A Agbo Nrsquozi G dan
Gaydou E M 2008 Anthocyanin Characterization of Pilot Plant Water
Extract of Delonix regia Flowers Molecules 13 1238-1245
Aryulina D Muslim C Manaf S dan Winarni WE 2004 Biologi 2 SMA dan MA
Untuk Kelas XI Penerbit Esis Erlangga Jakarta
httpbibitbungacomtanaman-flamboyan-royal-ponciana Diakses pada
tanggal 18 April 2016
Azab S s dan Daim M A 2013 Phytochemical Cytotoxic Hepatoprotective
Antioxidant Properties of Delonix regia Leaves Extract Med Chem Res 22
4269-4277
Bunga bibit 2015 Tanaman Flamboyan (Royal Ponciana)
Black EM Lowings JP Smith J Heaton PR dan McElhinney LM 2002 A rapid
RT-PCR Method to Differentiate six established genotypes of Rabies and
Rabies-Related Viruses Using TaqMan Technology J Virol Methods 105 25-
35
Borah P 2011 Primer Designing for PCR Sci Vis Vol 11 (3) 134-136
Ceriana R Djuwita I dan Wresdiyati T 2014 Ekstrak Batang Sipatah-Patah
Meningkatkan Proliferasi san Diferensiasi Sel Punca Mesenkimal Sumsum
Tulang Jurnal Veteriner 4 (15) 436-445
Chamberlain G Fox J Ashton B dan Middleton J 2007 Concise Review
Mesenchymal Stem Cell Their Phenotype Differentiation Capacity
Immunological Features and Potential for Homing Tissue Specifik Stem Cells
25 2739-2749
Chantratia W Sukasem C Kaewpongsri S Srichunrusami C Pairoj W
Thitithanyanont A Chaichoune K Ratanakron P Songsrem T
Damrongwatanapokin S dan Landt O 2008 Qualitative Detection of Avian
Influenza A (H5N1) Viruses a comperative evaluation of four real-time
nucleic acid amplification methods Mol Cell Probes 22 (5-6) 287-293
Chen C S 2002 Phorbol Ester Induced Elevated Oxidative Activity and Alkalization
in a Subset of Lysosome BMC Cell Biol 3 1-11
Dallas S L and Bonewald L F 2010 Dynamics Of The Transition From Osteoblast
to Osteocyte NIH Public Access 437-443
Djuwita I Pratiwi I A Wiranto A dan Sabri M 2012 Proliferasi dan Diferensiasi
Sel Tulang Tikus Dalam Medium Kultur In Vitro yang Mengandung Ekstrak
Batang Cissus quadrangular Salibs (Sipatah-Patah) Jurnal Kedokteran
Hewan 2(6) 78
Djuwita I Riyacumala V Mohamad K Prasetyaningtijas W E dan Nurhidayat
2012 Pertumbuhan dan Sekresi Protein Hasil Kultur Primer Sel-Sel Serebrum
Anak Tikus Jurnal Veteriner 13 (2) 125-135
Ducy P 2000 CBFA1 A Molecular Switch on Osteoblast Biology Developmental
Dynamics 219(4) 461-471
Effendi A 2009 Skripsi Pengaruh Conditioned Medium RAT Embryonic Fibroblast
(CM- REF) Dengan dan Tanpa Leukemia Inhibitory Factor (LIF) Dalam
Medium Terhadap Tingkat Proliferasi dan Sifat Pluripotensi Mesenchyal Stem
Cell Sumsum Tulang Tikus Dalam Kultur In Vitro Fakultas Kedokteran
Hewan Institut Pertanian Bogor Bogor
24
Federici E Garrett R Quintin A 2004 Soybean Extract and Its Isoflavones Genistein
and Daidzein Stimulate BMP-2 Expression and Bone Formation by Inhibiting
the Mevalonate Pathway in Osteoblast Cells Bone 34 54-54
Grunenwald 2003 Methods in Molecular Biology PCR Protocols Second Edition
Edited by John M S Bartlett and David Starling Humana Press 603-610
Halim D Murti H Sandra F Boediono A Djuwantono T dan Boenjamin S
2010 Stem Cell Dasar Teori dan Aplikasi Klinis Erlangga Jakarta
Hannum S Akashi K Suharsono U W Hartana A Yokota A dan Suharsono
2010 Isolasi Fragmen cDNA Dari Gen Penyandi Aktin Dari Melastoma
malabathricum Makara Sains 2 (14) 163-167
Heim M Frank O Kampmann G Sochocky N Pennimpede T Fuchs P
Hunziker W Weber P Martin I dan Bendik I 2004 The Fhytoestrogen
Genistein Enhances Osteogenesis and Repress Adipogenic Differentiation of
Human Primary Bone Marrow Stromal Cells Endocrinology 145 (2) 848-859
Hewajuli D A dan Dharmayanti 2014 Perkembangan Teknologi Reverse
Transcriptase-Polymerase Chain Reaction dalam Mengidentifikasi Genom
Avian Influenza dan Newcastle Disease Dalam Yuwono T 2006 Teori dan
Aplikasi Polymerase Chain Reaction Penerbit Andi Yogyakarta
Hoffbrand A V Moss P A H dan Pettit J E 2006 Essential Haematology 5th
Asia Blackwell Publishing 129-181
Huldani 2012 Referat Biomarker Remodeling Tulang Fakultas Kedokteran
Universitas Lambung Mangkurat Banjarmasin Dalam Thomas SDC 2012
Bone Tunovour Markers 35 156-158
Jahan I Rahman S M Rahman S M Kaisar A M Islam S M Wahab A dan
Rashid A M 2010 Chemical and Biological Investigations of Delonix regia
(Bojer ex Hook) Raf Acta Pharm 60 207-215
Jungalwala F B dan Chama H R 1962 Carotenoids in Delonix regia (Gulmohar)
Flower Biochemical Journal 85 1-8
Junqueira L C dan Carneiro J 2005 Basic Histology 11th Ed Mc Graw Hill New
York
Kawiyana S K 2009 Osteoporosis Patogenesis Diagnosis dan Penanganan Terkini
(2)10
Kenneth LJ dan Thomas SD 2001 Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-ΔΔCT Method Applied
Biosystems Foster City California and Department of Pharmaceutical
Science College of Pharmacy Washington State University Pullman
Washington 25 402-408
Kuehnel W 2003 Color Atlas of Cytology Histology and Microscopic Anatomy 4th
Ed Thieme Stuttgart New York
Kumar A V Shaik R dan Yeshwanth D 2013 Phytochemical Evaluation of
Delonix regia Samanea saman Bauhinia variegatga International Journal of
Research in Pharmacy and Chemistry 3(4) 768-772
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D dan Putri T 2015
Kultur Primer Fibroblas Penelitian Pendahuluan Artikel Penelitian 38(1) 34
Kusumo DA 2012 Eprintundipacid Tanggal akses 26 Januari 2016
Lubis NDA 2011 Repositoryusuacidgtbitstream Tanggal akses 28 Desember
2015
Mariajancyrani J Chandramohan G Saravanan P dan Savaraj S 2013 In-Vitro
Antioxidant Potential of Delonix regia Leaves Scholars Academic Journal of
Pharmacy (SAJP) 2(6) 468-471
25
Margono A 2012 Potensi Sel Punca Mesenkhim Asal Jaringan Lemak dengan
Produk Plasma untuk Produk Plasma untuk Regenerasi Sel Odontoblas
Jaringan Pulpa In-Vitro Disertasi Fakultas Kedokteran Gigi Program Doktor
Ilmu Kedokteran Gigi Universitas Indonesia Jakarta Dalam Cherly T
Gomillion KJLB Stem Cells and Adipose Tissue Engineering J of
Biomaterials 2006 6052
Mescher A L 2010 Junqueiras Basic Histology Twelfth Edition The McGraw-Hill
Companies Inc
Masters R J Palsson O B dan Thomson A J 2007 Human Cell Culture 6
Embryonic Stem Cells Spinger Netherlands
National Institutes of Health US 2009 The Adult Stem Cell In Stem Cell
Information httpstemcellsnihgovinfoscireportpageschapter4aspx
Tanggal Akses 16 Maret 2016
Nurrsquoutami A D 2011 Metode Analisis Isolasi Identifikasi Salmonella Thyparium
Pada Susu Dengan Metode Real-Time PCR (Polymerase Chain Reaction)
Skripsi Institute Pertanian Bogor Bogor
Ogita M Rached M T Dworakowski E Bilezikian P dan Kousteni S 2008
Differentiation and proliferation of Periosteal Osteoblast Progenitors Are
Differentially Regulated by Estrogens and Intermittent Parathyroid Hormon
Adminiatration Endocrinology 149(11) 5713-5723
Phareks J dan Chanda S 2007 Antibacterial and Phytochemical Studies on Twelve
Species of Indian Medicinal Plants African Journal of Biomedical Research
10 175-181
Ponnusami V Aravindhan R Karthik N R Ramadoss G dan Srivastava S N
2009 Adsorpsion of Methylen Blue Onto Gilmohar Plant Leaf Powder
Equilibrium Kinetic and Thermodinamic Analysis Journal of Evironmental
Protection Science 3 1-10
Prayoga W dan Wardani A K 2015 Polymerase Chain Reaction Untuk Deteksi
Salmoella sp Kajian Pustaka Jurnal Pangan dan Agroindustri 3(2)
Price S A dan Wilson L M 1995 Patofisiologi Konsep Klinis Proses-Proses
Penyakit EGC Jakarta
Pryor W A Stahl W dan Rock C L 2000 Beta Carotene from Biochemistry to
Clinical Trials Nutrition Reviews 58 39-53
Roberts A B Flanders K C Heine U I Jakoule S Kondaiah P Kim S J dan
Sporn M B 1990 Transforming Growth Factor- acirc Multifunctional Regulator
Differentiation and Development Philosiphical Transaction of the Royal
Society of London 327 145-154
Sandhaanam S D Pathalam G Dorairaj S Savariar V amp Research Departement
of Advanced Zoology and Biotecnology 2013 Mesenchymal Stem Cell
(MSC) Identification Proliferation and Diferentiation A Review Article
Sardjono T Caroline Setiawan M Friska Saputra V dan Aniko A 2009
Application of a Modified Methode For Stem Cell Isolation from Lipoaspirates
in a Basic Lab Stem Cell Isolation From Lipoaspirates 18 (2)
Stevenson J S and Mars M S 2007 An Atlas of Osteoporosis Thrid Edition Informa
Healtcare London UK
Shabir G Anwar F Sultan B Khalid Z M Afzal M Khan Q M dan
Ashrafuzzaman M 2011 Antioxidant and Antimicrobial Attributes and
Phenolic of Different Solvent Extracts From Leaves Flowers and Bark of
Gold Mohar [Delonix regia (Bojer ex Hook) Raf] Molecules 16 (9) 7302-
7319
26
Shanmukha I Patel H P Patel J dan Riyazunnisa 2011 Quantification of Total
Phenol and Flavonoid Content of Delonix regia Flowers International Journal
of ChemTech Research 3 (1) 280-283
Singer FR dan Eyre D R 2008 Using Biochemical Markers of Bone Turnover in
Clinical Practice Cleveland Clinic Journal 75(10) 739-750
Singh S dan Kumar N S 2014 A Review Introduction to Genus Delonix World
Journal of Pharmacy and Pharmaceutical Sciences 3(6) 2042-2055
Steenis C G G J Bloembergen S dan Eyma P J 2013 Flora untuk Sekolah di
Indonesia Moeso S Soenarto H Soerjo SA Wibisono Margono P dan
Soemantr W Editor Cetakan VI Pradnya Paramita Jakarta halaman 35-49
169-172
Suryani I 2015 Pengujian Ekstrak Etanol Bunga Flamboyan Delonix regia (Boj ex
Hook) Raf Terhadap Proliferasi dan Diferensiasi Sel Punca Mesenkimal
Sumsum Tulang Mencit (Mus musculus) Skripsi Jurusan Biologi Fakultas
Matematika dan Ilmu Pengetahuan Alam Universitas Syiah Kuala Banda
Aceh
Tortora G J dan Derrickson B H 2009 Vision Principle of Anatomy and Physiology
12th Ed Philadephia Jhon Wiley and Sons Publisher 8 604
USDA (Uniteed States Departement of Agriculture) 2015 Delonix regia (Bojer Ex
Hook)RafRoyalPoinciana
httpplantsusdagovcoreprofilesymbol=DERE Tanggal akses 14 Januari
2016
Wardhana W 2012 Faktor-Faktor Risiko Osteoporosis Pada Pasien Dengan Usia Di
Atas 50 Tahun Skripsi Fakultas Kedokteran Universitas Diponegoro
Semarang
Widjiati Madyawati Sri P Rimayanti A dan Budiayanto A 2015 Terapi Sel
Punca Mesenkimal Sumsum Tulang Tikus dalam Meregenerasi Sel
Sitotrofoblas Nekrosis yang Dipapar Carbon Black Jurnal Veteriner 16 (2)
265-273
Wislow T 2001 httpstemcellsnihgovStatisticResourcesinfoscireportimage21
Jpg Tanggal akses 25 Januari 2016
Wobus A M dan Boheler K R 2006 Stem Cells Springer Germany
Yusuf H 2011 Delonix regia (Boj Ex Hook) Raf Badan Perbenihan Tanaman
Hutan Sulawesi
Yusuf Z K 2010 Polymerase Chain Reaction (PCR) Jurnal Saintek Staf Pengajar
Jurusan Kesehatan Masyarakat FIKK Universitas Negeri Gorontalo
Gorontalo 5 (6)
Zhang DW Cheng Y Wang NL Zhang J C Yang M S dan Yao X S 2008
Effect of Total Flavonoids and Plavonol Glycosides from Epimedium
Koreanum Nakai on The Proliferation and Differentiation of Primary
Osteoblast Phytomedicine 15(2) 55-61
Zur NiedenNI KempkaG AhrHJ 2003 In Vitro Differentiation of Embryonic
Stem Cells Into Mineralized Osteoblasts Differentiation 71 18ndash27
28
Lampiran 1 Format Biodata KetuaAnggota Tim Peneliti
BIODATA KETUA PENGUSUL
A Identitas Diri
1 Nama Lengkap (dengan gelar) Dr Kartini Eriani MSi
2 Jenis Kelamin P
3
2
Jabatan Fungsional Lektor
4 NIP 197004211999032001
5 NIDN 0021047001
6 Tempat dan Tanggal Lahir Banda Aceh 21 April 1970
7 Alamat Rumah Jl Purnawirawan No 11 Geuceu Komplek
8
9
9
Nomor HP 085277060751
9 Alamat Kantor Jl Syeh Abdurrauf No 3 Darussalam
SSyiah Kuala Darussalam Banda Aceh 23111 10 Nomor TeleponFax 065141793
11 Alamat e-mail Kartini_erianiunsyiahacid
12 Lulusan yg telah dihasilkan S1 = 19 orang S2 =1 orang S3 =
13
Mata Kuliah yg diampu 1 Struktur Hewan
2 Perkembangan Hewan
3 Pengantar Bioteknologi
4 Reproduksi Hewan
5 Endokrinologi
6 Bioteknologi Hewan
7 Imunologi (S2)
8 Kriopreservasi (S2)
9 Manipulasi Embrio (S2)
10 Sitogenetika (S2)
B Riwayat Pendidikan
S-1 S-2 S-3
Nama Perguruan Tinggi Universitas
Syiah Kuala
Institut Pertanian
Bogor
Institut Pertanian
Bogor
Bidang Ilmu Biologi Biologi Biologi
Tahun Masuk- Lulus 1989-1994 1995-1998 2000 ndash 2005
Judul
SkripsiThesisDisertasi
Pengamatan
Siklus Estrus
Melalui
Preparat Ulas
Vagina Mencit
(Mus musculus
albinus)
Pengaruh Penambahan
Asam Amino Dalam
Medium Kultur Bebas
Serum Terhadap
Perkembangan
Preimplantasi Embrio
Mencit In Vitro
Viabilitas Gamet
Setelah Preservasi
Ovarium dan
Epididimis Serta
Pemanfaatannya
Untuk Produksi
Embrio Kucing
Secara In Vitro
Nama
PembimbingPromotor
Dra Sunarti
MS
Prof Dr drh Yuhara
Sukra
Dr drh Hasim DEA
Prof Dr drh
Yuhara Sukra
Prof Dr drh Arief
Boediono
29
Drs Abdul
Hadi mahmud
MS
Dr drh Ita Djuwita
MPhil
Dr drh Ita Djuwita
MPhil
Dr Sony Heru
Sumarsono MSc
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
No Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta Rp)
1 2009 Pengaruh Asap Rokok terhadap Infertilitas
(Kualitas Spermatozoa Defek Makroskopis
dan Mikroskopis Testis) pada Mencit Jantan
(Mus musculus albinus)
Risbin
Iptekdok
Litbangkes
125
2 2015 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 70
3 2015 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 65
4 2016 Optimalisasi Potensi Kerbau dalam Usaha
Meningkatkan Ketahanan Pangan di Aceh
dengan metode Pembekuan Spermatozoa
Project 7in1 130
5 2016 Analisis Genomik dan proteomik
Plasmodium berghe sebagai Model Kajian
terhadap Infeksi Malaria pada Manusia
DIKTI 60
6 2018 Kripreservasi Sperma Ikan Depik (Rasbora
tawarensis) Spesies Endemik dan Terancam
Punah di Danau Laut Tawar Provinsi Aceh
DRPM
DIKTI
7 2018 Kriopreservasi Sperma Ikan Kawan
(Propuntius tawarensis) Pengujian Jenis Ikan
dan Konsentrasi Antioksidan
PNBP 86
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No Tahun Judul Pengabdian Kepada Masyarakat Pendanaan
Sumber Jml (Juta Rp)
1 2014 IbM Pemanfaatan Sampah Plastik di Perkampungan Tsunami Indonesia-Tiongkok Desa Neuhen Aceh Besar
Dikti 32
2 2015 Pemanfaatan Produk Ekstrak Daun Kedondong Pagar (Lannea coromandelica) untuk Meningkatkan Kesehatan dan Daya Tahan Tubuh Unggas
BOPTN 30
30
3 2015 Aplikasi Inseminasi Buatan Menggunakan Semen Beku Aceh dalam Meningkatkan Perekonomian Peternak di Aceh besar
BOPTN 20
E Publikasi Artikel Ilmiah Dalam Jurnal Alam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTah
un
1 Development of Domestic Cat
Embryo Produced by Preserved sperm
Hayati Journal of
Biosciences
ISSN 1978-3019
Scopus
1542008
2 Viabilas Spermatozoa yang Dikoleksi
dari Ejakulat Duktus Deferens dan
Epididimis Kambing Kacang (Capra
capri) setelah Kriopreservasi
Natural
ISSN 1141-8513
912009
3 The effect of cigarettes smoke
exposured cause fertility of male mice
(Mus musculus)
Natural
ISSN 1141-8513
102 2010
4 Pengaruh pemberian ekstrak etanol
akar anting-anting (Acalypha indica L)
terhadap kualitas spermatozoa mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
1812010
5 Potency of java gingseng (Talinum
paniculatum Gaertn) root exttract on
quality and viability of mice sperm
Natural
ISSN 1141-8513
1112011
6 The potential of jarak cina (Jatropha
multifida L) secretion in healing new-
wounded mice
Natural
ISSN 1141-8513
1112011
7 Produksi embrio kucing secara in vitro
dari spermatozoa hasil preservasi
melalui fertilisasi mikro
Jurnal Kedokteran Hewan
ISSN 0854-1159
712013
8 Efek ekstrak etanol akar anting-anting
(Acalypha indica L) terhadap Libido
mencit
Jurnal Kedokteran Yarsi
ISSN 0854-1159
2112013
9 A preliminary observation on the effect
of sperm extenders on the fertilization
and hatching rates of seurukan fish
(Osteochilus vittatus) eggs
ACCL Bioflux
ISSN 1844-9166 (online)
ISSN 1844-8143 (print)
Scopus
922016
10 The effect of equilibration time on semen
freezing of local swamp
buffalo (Bubalus bubalis) with
combination extender of lactose and
glycerol
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
DOI
1013057nusbioscin090113
912017
11 Fertilization and development of mice
(Mus musculus) embryo in vitro after
Nusantara Bioscience
ISSN 2087-3948
E ISSN 2087-3956
922017
31
supplementing the extract of Pandanus
conoideus
DOI
1013057nusbioscin090216
12 Effect of Temperature Shock on the
Triploidization Success of Seurukan Fish
(Osteochilus vittatus)
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
922017
13 Cryopreservation Of Acehnese Swamp
Buffalo (Bubalus bubalis) Semen With
Combination of Glycerol and Lactose
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
932017
14 Utilization of Oocytes Collected From
Preserved Ovarian for In Vitro
Production of Cat Embryos
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1012018
15 Quality Enhancement of Aceh Swamp
Buffalo (Bubalus bubalis) Frozen
Semen by Supplementing β-Carotene
Tropical Animals Science
Journal
2615-790X (Online)
2615-787X (Print)
scopus
4112018
16 Potensi Ekstrak Daun Flamboyan
[Delonix regia (Boj Ex Hook) Raf]
terhadap Peningkatan Aktivitas dan
Kapasitas Makrofag
Jurnal BioLeuser
2597-6753
132017
17 Immunostimulatory Effect of
Methanol Extract of Flamboyant Leaf
[Delonix regia (Boj ex Hook) Raf] in
Mice
Jurnal Natural
1411-8513 (Print)
2541-4062 (Online)
1812018
18 Neurogenic Differentiation of Bone
Marrow Mesenchymal-Like Stem Cell
Induced by Delonix regia Flowers
Extract
Biosaintifika
p-ISSN 2085-191X
e-ISSN 2338-76109
Acredited
1022018
19 Effect of glutathione on sperm quality
after shor-term cryopreservation in
seurukan fish Osteochilus vittatus
(Ciprinidae)
Theriogenology
ISSN 0093-691X
Jurnal Internasional
1222018
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No
Nama Pertemuan
IlmiahSeminar
Judul Artikel Ilmiah Waktu dan Tempat
1
Seminar Nasional
XXI Perhimpunan
Biologi Indonesia
Perkembangan Preimplantasi
Embrio mencit dalam Kultur
Bebas Serum
5 Maret 2012
Banda Aceh
Indonesia
32
2 Aceh veterinary
International
Adaptation Process of Simeulue
Wild Buffalo to Spermatozoa
Freezing as Aplication of
Artificial Insemination
12-13 Oktober 2015
Banda Aceh
Indonesia
3
Seminar Nasional
Masyarakat
Biodiversitas
Indonesia
Fertilisasi dan perkembangan
embrio preimplantasi mencit (Mus
musculus) secara in vitro setelah
pemberian ekstrak buah merah
(Pandanus conoideus)
17 September 2016
Bogor
Indonesia
4
The 6th Annual
International
Conference
Study of adaptation of simeuleu
wild buffallo behavior for semen
collection
4-6 Oktober 2016
Banda Aceh
Indonesia
5
The 6th Annual
International
Conference
Detection of erythrocyte
membrane protein of mice
infected plasmodium berghei by
using western blot analysis
4-6 Oktober 2016
Banda Aceh
Indonesia
6
Seminar Nasional
Biologi ke-5
Universitas Negeri
Semarang
Effect of temperature shock on the
successful of triploidization of the
Seurukan fish Osteochilus vittatus
29 Oktober 2016
Semarang
Indonesia
7
International
Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj Ex
Hook) Raf Extract on
differentiation of bone marrow
mesenchymal stem cell
proliferation
4-6 November 2016
Surakarta
Indonesia
8
SYMPOSIUM amp
WORKSHOP STEM
CELL FOR THE
FUTURE
MEDICINE FROM
BASIC TO CLINIC
2017
Alkaline Phosphatase Expression
Obtained with Mesenchymal Stem
Cells Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur 2017
Surabaya Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
- - - - -
H Perolehan HKI dalam 5-10 Tahun Terakhir
No JudulTema HKI Tahun Jenis Nomor PID
- - - - -
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya
dalam 5 Tahun Terakhir
33
No JudulTemarekayasa sosial
lainnya yang telah diterapkan Tahun
Tempat
penerapan
Respon
masyarakat
- - - - -
J Penghargaan dalam 10 Tahun Terakhir (dari pemerintah asosiasi atau
institusi lainnya)
No
Jenis Penghargaan
Institusi Pemberi Penghargaan Tahun
Darussalam 06 Juni 2018
Pengusul
Dr Kartini Eriani MSi
NIP 19700421 1999032001
mahfudhah25gmailcomgt
34
BIODATA ANGGOTA PENGUSUL 1
A Identitas Diri
1 Nama Lengkap (dengan gelar) dr Ichsan MSc
LP 2 Jenis Kelamin L
3 Jabatan Fungsional Asisten Ahli IIIa
4 NIP 197710062003121001
5 NIDN 0006107704
6 Tempat dan Tanggal Lahir Banda Aceh 06 Oktober 1977
7 E-mail drIchsangoegmailcom
8 Nomor TeleponHP 081269201523
9 Alamat Kantor Fakultas Kedokteran UNSYIAH Jl
Kopelma Darussalam
10 Nomor TeleponFaks -
11 Lulusan yang Telah Dihasilkan S1= 2 orang S2= - S3= -
13
Mata Kuliah yg Diampu
1 Mikrobiologi
1 Fisiologi Mikroba
2 Mikologi
3 Mikrobiologi Industri
4 Pengantar Biologi
1 Bioteknologi Hewan
2 Imunobiologi
3 Parasitologi
4 Biologi Molekuler
5 Bioteknologi
2 Anatomi
3 Histologi
4 Bakteriologi
5 Imunologi
B Riwayat Pendidikan S-1 S-2
Nama Perguruan Tinggi Universitas Syiah
Kuala
Georg-August-University
Goettingen Jerman
Bidang Ilmu Pendidikan Dokter Biologi Molekuler
Tahun Masuk- Lulus 1996-2002 2006 ndash 2008
Judul
SkripsiThesisDisertasi
- Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on Ancient
Bone Material of Several
Samples
(Establishment Of The PCR)
Nama
PembimbingPromotor
- Prof Dr med Uwe Groszlig
DR phil nat Raimond Luumlgert
C Pengalaman Penelitian Dalam 5 Tahun Terakhir
N
o Tahun Judul Penelitian
Pendanaan
Sumber Jml (Juta
Rp)
1 2014 Antibiotic susceptibility profile of
microorganisms causing blood stream infection
in Indonesia 2008-2013
Mandiri -
35
2 2014 Pre Feasibility Study of Project ldquoRe-
Engineering Hospital and Health Facilities In
Selected Aceh Districtsrdquo
Swasta 300
3 2016 Induksi ekstrak etanol bunga flamboyan [
Delonix regia (boj ex hook) raf] terhadap
proliferasi dan diferensiasi sel punca
mesenkimal sumsum tulang mencit (Mus
musculus)
DRPM 50
D Pengalaman Pengabdian Kepada Masyarakat dalam 5 Tahun Terakhir
No
Tahun
Judul Pengabdian
Pendanaan
Sumber Jumlah
(Juta Rp)
E Publikasi Artikel Ilmiah Dalam Jurnal Dalam 5 Tahun Terakhir
No Judul Artikel Ilmiah Nama Jurnal Volume
NomorTahun
1 Identification of thymocyte subset by
multicolour flow cytometry analysis
(ED LSR II) - FACSDriva - FlowJo
software
Indonesian Journal of
Biotechnology 13 1044-
7 2089-2241
13 1044-7
2089-
22412008
2 The roles of microRNAs on
tuberculosis infection Meaning or
myth
Tuberculosis (Edinb) 93
596-605 1472-9792
93 596-605
1472-
97922013
3 Host genome polymorphisms and
tuberculosis infection What we have
to say
Egyptian Journal of Chest
Diseases and
Tuberculosis 62 173-
185 0422-7638
62 173-185
0422-
76382014
F Pemakalah Seminar Ilmiah (Oral Presentation) dalam 5 Tahun Terakhir
No Nama Pertemuan
IlmiahSeminar Judul Artikel Ilmiah
Waktu dan
Tempat
1
DAAD-Indonesian-German-
Springschool on ldquoTropical
Medicine Infectious Diseases
and Molecular Biologyrdquo
Application of PCR ndash Tb in
ancient bones
08-22 March
2009 Goettingen
- Germany
2 International Symposium on
Moleculare Tropical Medicine
Detection Of Tuberculosis
Staphylococcus Aureus and
Salmonella Thyphi on
Ancient Bone Material of
Several Samples
(Establishment Of The PCR)
17 ndash 18 Maret
2010
UGM ndash
Yogyakarta
Indonesia
36
3 International Conference on
Biodiversity
The induction of flamboyant
flowers Delonic regia (Boj
Ex Hook) Raf Extract on
differentiation of bone
marrow mesenchymal stem
cell proliferation
4-6 November
2016
Surakarta
Indonesia
4
SYMPOSIUM amp
WORKSHOP STEM CELL
FOR THE FUTURE
MEDICINE FROM BASIC
TO CLINIC 2017
Alkaline Phosphatase
Expression Obtained with
Mesenchymal Stem Cells
Induced by Flamboyant
Flower Extract Delonix regia
(Boj Ex Hook) Raf
13-14 Agustur
2017
Surabaya
Indonesia
G Karya Buku dalam 5 Tahun Terakhir
No Judul Buku Tahun Jumlah
Halaman Penerbit
1 Global Health
A Challenge for
Interdisciplinary Research
2012 406
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
047-7 )
2 Maternal Child Health
Interdiciplinary Aspects
within the Perspective of
Global Health
2013 546
(collaborative
writers)
Universitaumltsverlag
Goumlttingen
( ISBN 978-3-86395-
084-2 )
H Perolehan HKI dalam 10 Tahun Terakhir
No
JudulTema HKI
Tahun
Jenis
Nomor PID
1
2
Dst
I Pengalaman Merumuskan Kebijakan PublikRekayasa Sosial Lainnya dalam
10 Tahun Terakhir
No JudulTemaJenis Rekayasa Sosial
Lainnya yang Telah
Diterapkan
Tahun Tempat
Penerapan
Respon
Masyarakat
1
2
Dst
J Penghargaan dalam 10 tahun Terakhir (dari Pemerintah Asosiasi
atau Institusi lainnya)
No
Jenis Penghargaan Institusi Pemberi
Penghargaan
Tahun
1
2
37
Dst
Semua data yang saya isikan dan tercantum dalam biodata ini adalah benar dan
dapat dipertanggungjawabkan secara hukum Apabila di kemudian hari ternyata
dijumpai ketidaksesuaian dengan kenyataan saya sanggup menerima sanksi
Demikian biodata ini saya buat dengan sebenarnya untuk memenuhi salah
satu persyaratan dalam pengajuan penugasan Penelitian Lektor tahun 2018
Banda Aceh 11 Desember 2018
Pengusul
(dr Ichsan MSc)
NIP 197710062003121001
38
BIODATA ANGGOTA PENGUSUL 2
A Identitas
a Nama Lengkap Silmi Mariya
b Jenis Kelamin P
c NIP 19700212 199403 2 001
d NIK 3271055202700012
e Hp 08161138304
f E-mail mariyasilmigmailcom
g Jabatan Struktural Kepala Program Biomedis PSSP IPB
h Jabatan Fungsional Staf peneliti
i Bidang Kepakaran Kultur Sel Hewan dan Sel punca
j Institusi Asal Pusat Studi Satwa Primata IPB
k Alamat Institusi Jalan Lodaya II no 5 Bogor
l TelponFaks Institusi 0251-83136370251-8360712
m Alamat Rumah Vila Bogor Indah Blok AA6 no 36
Kedung Halang Bogor
n TelponFaks Rumah 0251-8666375
B Pendidikan
Program Sarjana Magister Doktoral Perguruan Tinggi
Asal Universitas
Pakuan Bogor
Institut Pertanian
Bogor
Institut Pertanian
Bogor Konsentrasi Ilmu Biologi Primatologi Primatologi
Tahun Lulus 2004 2010 2018 Judul Tugas Akhir
(skripsitesisdisert
asi)
Produksi
Poliklonal
Antibodi
Parvovirus asal
Telur Ayam Arab
Diferensiasi
Kardiomiosit asal
Sel punca
mesenkimal
Wharton Jelly
Monyet Ekor
Panjang
Kultur mamosfir
kelenjar susu
monyet ekor
panjang dan
responnya
terhadap
pemberian
genistein
C Pengalaman Riset 5 (lima) Tahun Terakhir (diurut berdasarkan
tahun terakhir)
Judul Riset
Tahun
Riset
(dari
dan
sampai
dengan)
Nilai
Pendanaa
n Riset
Sumber
Pendana
an Riset
Peran
Posisi
Mitra
Riset
39
The Effect of
Soy Isoflavone
on mammary
gland stem
cells for the
protection
against breast
cancer risk
2015-2018 200000000
per tahun
selama 3
tahun
Insinas Kultur sel
punca
kelenjar susu
Monyet ekor
panjang dan
uji senyawa
genisiteinAn
ggota Peneliti
Primate
Research
Center
Wake Forest
University
PENGEMBA
NGAN
KULTUR SEL
EPITEL
DAN SEL
PUNCA
KELENJAR
SUSU
BERSUMBER
JARINGAN
PAYUDARA
SATWA
PRIMATA
2015 200000000 Hibah
Publikasi
Kerjasama
Luar Negeri
Kultur sel
epitel kelenjar
susu Monyet
ekor panjang
Anggota
Peneliti
D Prestasi (yang relevan dengan judul riset)
1 Publikasi
(1) Williams JK SMariya M Furth A Atala S Soker 2013
Isolation and Characterization of Non Human Primate Amniotic Fluid-
Derived Stem Cells Research Paper Journal and Science Application
Biomedicine Vol 1 Issue 1
(2) Kamal A F Iskandriati D Dilogo I H Siregar NC Hutagalung
EU Yusuf A A Mariya S Husodo K 2013 Comparison of cultured
mesenchymal stem cells derived from bone marrow or peripheral blood
of rats Journal of Exp Itgr Med
(3) Surya M Iskandriati D Mariya S Saepuloh U Permanawati Sajuthi
D Pamungks J 2016 Primary Tupaia javanica hepatocytes culture
as in vitro replication system for ape hepatitis B viruses Vol 10 No
22016
(4) Silmi Mariya Fitriya Nur Annisa Dewi Irma Herawati Suparto
Gregory K Wilkerson J Mark Cline Permanawati Diah Iskandriati
I Nengah Budiarsa Dondin Sajuthi 2017 Mammary Gland Cell
Culture of Macaca fascicularis as a Reservoir for Stem Cells
HAYATI Journal of Biosciences 24 136 -141
40
(5) J Koudy Williams Silmi Mariya Irma Suparto 2017 Gender Age
and Differences in Stem Cell Expression and Efficacy Journal of
Stem Cell Research amp Therapeutics Volume 3 Issue 2 ndash 2017
Bogor 30 Oktober 2019
Anggota Pengusul
Dr Silmi Mariya MSi
NIP197002121994032001
Flower Delonix regia extract in induced alkaline phosphatase expression
1
ALKALINE PHOSPHATASE EXPRESSION FROM MICE MESENCHYMAL STEM 1
CELLS INDUCED BY FLOWER (Delonix regia) EXTRACT 2
3
Kartini Eriani1 Debi Anggraini1 Yudha Bintoro2 Ichsan Ichsan3 Silmi Mariya4 and Al 4
Azhar5 5
6
1Department of Biology Faculty of Mathematics and Natural Science Universitas Syiah Kuala Jl 7
Syech Abdurrauf No 3 Banda Aceh 23111 Indonesia 8
2Department of Molecular Biology Faculty of Medicine Abulyatama University Jl Tgk Tanoh 9
Abee Darussalam-Banda Aceh 23111 Indonesia 10
3Department of Microbiology Faculty of Medicine Univesitas Syiah Kuala Jl Tgk Tanoh Abee 11
Darussalam-Banda Aceh 23111 Indonesia 12
4Primate Research Center Bogor Agricultural University Jalan Lodaya II5 Bogor 16151 13
Indonesia 14
5Faculty of Veterinary Medicine Universitas Syiah Kuala Jl Tgk Hasan Krueng Kalee No4 15
Banda Aceh 23111 Indonesia 16
17
Corresponding author e-mail kartini_erianiunsyiahacid 18
19
ABSTRACT 20
Flamboyant flower (Delonix regia) extract can increase proliferation and differentiation 21
rates of mesenchymal stem cells into specific cells such as bone nerve and fibroblast cells The 22
extract possess metabolic compounds that may act as antibiotics anti-inflammatory antimicrobial 23
diuretic anthelmentic astringent leucorrhoea and potentially increase the bodys metabolism 24
normally This study aimed to investigate expression level of alkaline phosphatase (ALP) by mice 25
mesenchymal stem cells treated with flamboyant flower extract in vitro Here mice bone marrow 26
Flower Delonix regia extract in induced alkaline phosphatase expression
2
cell cultures were treated with flamboyant flower extracts of 06 mgml (P1) 07 mgml (P2) 08 27
mgml (P3) and 09 mgml (P4) Untreated cell culture was used as negative control (P0) 28
Expression of alkaline phosphatase gene was measured by RT-qPCR method The results showed 29
mice mesenchymal stem cell could differentiate into bone nerve and fibroblast cells The addition 30
of flamboyant flower extract range from 06-09 mgml significantly (plt005) influenced the 31
expression of alkaline phosphatase by differentiating mesenchymal stem cells The highest 32
expression was found at the stem cells treated with flamboyant flower extract of 08 mgml 013 33
times compared with control In conclusion flamboyant flower extracts treatment might increase 34
the expression of alkaline phosphatase in differentiating mesenchymal stem cells 35
36
Keywords Alkaline Phosphatase Actin Beta flamboyant flower extract qPCR 37
38
INTRODUCTION 39
Flamboyant (Delonix regia) is a medicinal plant with potential to be used as a traditional 40
medicine Previous phytochemical analysis showed that the plant contains terpenoids tannins 41
cardiac glycosides and anthroquinones that may act as antioxidants anti-diarrheals anti-42
inflammatories hepatoprotectives and antimicrobials (Singh amp Kumar 2014) Flower extract 43
contains carotenoids that function to regulate enzyme activities and communication between cells 44
as well as to provide immune response neoplastic transformation and growth control (Pryor et al 45
2000) 46
Previous studies have identified the role of flamboyant flower extract in improving human 47
health (Wang et al 2016) and in particular extracts from the flower may be beneficial in curing 48
degenerative diseases (Eriani et al 2019) In general degenerative diseases are difficult to cure and 49
the involvement of this plant can play a role in the development of new medical advances in the use 50
of stem cells to cure disease This flower extract has been predicted (Eriani et al 2019) to increase 51
the rate of cell culture differentiation in vitro The number of compounds contained in the flower 52
Flower Delonix regia extract in induced alkaline phosphatase expression
3
extract is positively correlated with the rate of cell growth within the culture medium Based on 53
morphological observations Eriani et al (2018) reported that the addition of flamboyant flower 54
extract to culture media was able to promote differentiation of mice stem cell into fibroblasts and 55
nerve like cellsThis previous research focused on determining optimal dosage of flamboyant flower 56
extract for the induction of cell culture differentiation based on morphological observation with a 57
standard microscopic method using hematoxylin eosin (HE) staining The results showed that an 58
increase in flamboyant flower extracts was able to induce cell differentiation into osteoblasts These 59
cells had a dark rounded nucleus located either on the side or at the edge of the cell Accuracy of 60
determining stem cell differentiation based on morphological evaluation however might be limited 61
by morphological similarities of different cells Additional methods are therefore needed to 62
provide more convincing results such as by examining expression of specific genes or molecules 63
involved in and required for cell division Measuring the changes in expression of these molecules 64
by actively differentiated cells could provide biochemical markers of cell differentiation 65
Alkaline phosphatase is among the molecules exhibiting increased expression at the time of 66
cell cleavage and differentiation (Singer amp Eyre 2008) This enzyme is able to accelerate the 67
formation of cell framework increase cell links and induce metabolic processes Alkaline 68
phosphatase is closely related to the regulation of cell cycle body minerals and cell growth It is 69
possible that the change in alkaline phosphatase gene expression might provide a specific molecular 70
marker for the differentiation of mesenchymal stem cell cultures induced by different dosages of 71
flamboyant flower extract Therefore this study was conducted to investigate the potential of 72
flamboyant flower extracts to induce bone cell differentiation by analyzing the expression rate of 73
alkaline phosphatase gene by the actively differentiated mesenchymal stem cells 74
75
MATERIALS AND METHODS 76
Flamboyant flower extraction 77
Flower Delonix regia extract in induced alkaline phosphatase expression
4
Flower extracts were prepared by maceration using ethanol 96 as a solvent Briefly 78
simplicia powders (500 grams) were soaked in 15 liters of ethanol 96 for three days Filtrate was 79
obtained by filtering macerate using a filter paper and stored in a bottle container at room 80
temperature The entire filtrate was concentrated using a rotary vacuum evaporator at 60 degC and 80-81
90 rpm for three days Subsequently the extracts were weighed and stored in a sealed dark 82
container 83
84
Animals 85
Animals used in this study were male mice Balb-C strain aged two months old with an 86
average body weight of 30 g The mice were kept in cages sized 48 cm x 36 cm x 13 cm containing 87
dry rice husk Food and drink were given ad libitum 88
89
Preparation of Mesenchymal Stem Cell (MSCs) cultures from bone marrow 90
Petri dishes (35 mm diameters) were coated with gelatin 01 for one hour at room 91
temperature Petri dishes were cleaned from gelatin by rinsing them in a 1x modified phosphate 92
buffer saline (mPBS) solution and dried for 5 minutes Each petri dish was then filled with 2 ml of 93
modified Dulbeccorsquos modified eaglesrsquos medium (mDMEM) and incubated at 37 degC in a 5 CO2 94
incubator for 1 hour 95
96
Isolation of primary culture of bone marrow MSCs 97
The mice were anaesthetized using a combination of 001 ml of ketamine (Troy 98
Laboratories PTY Limited) and 001 ml of xylazine (Troy Laboratories PTY Limited) All mice 99
were dissected for femur and tibia bones collection Under a sterile condition the bones were 100
cleaned from muscles washed in mPBS and cut on both the ends The bone marrows were flushed 101
out from bone cavity with mPBS using the syringe Bone marrow suspensions were collected in a 102
petri dish by repetitive pipetting and spun at 3000 rpm for 10 minutes Cell pellets were washed 103
Flower Delonix regia extract in induced alkaline phosphatase expression
5
four times with mPBS and once with mDMEM The cells were resuspended in mDMEM final 104
concentration of 1x106 and incubated for 24 hours Cells that adhered to plastic were considered as 105
mesenchymal stem cell (MSC) (Halim et al 2010) In duplicate MSC-like cells were cultured in 106
mDMEM medium supplemented with D regia extracts of 0 (mv) (control) 04 (mv) (P1) 107
06 (mv) (P2) and 08 (mv) (P3) and 09 (mv) (P4) Cell mixtures were then incubated at 37 108
degC in a 5 CO2 incubator for 7 days with mDMEM replacement every two days On day 8 cell 109
pellets were harvested and subjected for RNA analysis by using RT-PCR 110
111
RNA Analysis 112
RNA isolation was performed using ReliaPrepTM RNA Cell Miniprep System (Promega 113
Z6011) In brief cell cultures was transferred to a 15 ml micro-tube and spun at 300 rpm for 5 114
minutes Cell pellets were washed in a sterile cold PBS and spun at 300 rpm for 5 mins 115
Supernatants were added with BL and TG buffers (250 microl each) and mixed by short vortexing 116
Isopropanol 85 microl was added to the mixture and homogenized by short vortexing All solution was 117
transferred to a minicolumn (in a collection tube) and spun at 14000 pm for 10 minutes After 118
discarding filtrate minicolumn was put back to the collection tube added with 500 microl of RNA Wash 119
Solution and spun at 12000-14000 rpm for 30 seconds DNase I incubation (30 microl) was added to 120
minicolumn and incubated at 20-25 degC for 15 mins The column was added with 200 microl of Wash 121
Solution and spun at 12000-14000 rpm for 15 seconds RNA Wash Solution (500 microl) was added 122
dan the column was respun at 12000-14000 rpm for 30 seconds The minicolumn was transferred 123
to a new collection tube added with 300 microl of RNA Wash Solution and spun at 14000 for 2 mins 124
Minicolumn was transferred to a new elution tube added with 30 microl of nuclease-free water and 125
spun at 14000 rpm for 1 min Purified RNA obtained was stored at -70 degC 126
127
cDNA Synthesis 128
Flower Delonix regia extract in induced alkaline phosphatase expression
6
The cDNA formation process was performed using the GoScript Reverse Transcription 129
System (Promega A5000) Here a RNA reaction mixture was prepared by mixing 1 microl of RNA 130
sample 01 microl of random primer and 39 microl nuclease free water and heated at 70 degC for 5 minutes 131
Reverse transcription reaction mixture was prepared by mixing 4 microl of GoScriptTM5 reaction buffer 132
12 microl of MgCl2 1 microl of PCR nucleotide mix 05 microl of RNasin ribonuclease inhibitor recombinant 133
1 microl of GoScriptTM reverse transcriptase and 73 microl of nuclease free-water Reverse transcription 134
master mix 15 microl was added to each reaction sample reverse transcription reaction was run using a 135
BioRad thermal-cycler at the following condition annealing at 25degC for 5 mins extension at 37degC 136
for 1 hour and reverse transcriptase inactivation at 70 degC for 15 mins The cDNA solutions 137
obtained were stored at -20 degC 138
139
qPCR master mix preparation 140
The RT-qPCR process is performed using the GoTaqreg qPCR Master Mix (Promega 141
A6001) Briefly a 25 μl reaction mixture was prepared by mixing 125 microl of GoTaqreg qPCR master 142
mix 75 microl of nuclease free-water 2 microl of each primer and 3 microl of cDNA samples The qPCR 143
reaction was run at a Biorad RT-PCR machine Alkaline phosphatase primers used were 5-144
CAGACCCTCCCCACGAGT-3 (forward) and 5-GTCTTGGAGAGGGCCACAAA-3 (reverse) 145
Beta actin gene amplified using forward primer 5-ATGAAGATCCTGACCGAGCG-3 and reverse 146
primer 5-TACTTGCGCTCAGGAGGAGGC-3 was use as a reference 147
148
Ethics 149
This research used the protocols approved by the Research Ethics Committee of the Faculty 150
of Veterinary Medicine Syiah Kuala University 151
152
Statistical Analysis 153
Flower Delonix regia extract in induced alkaline phosphatase expression
7
Data of gene expression was statistically analyzed using unpaired singe tailed t-test with 154
level of significance of 005 155
156
Bioinformatics Analysis 157
Primary prediction of alkaline phosphatase were analyzed in silico to see RT-qPCR 158
amplification optimization using online resources namely httpgenatlasmedecineuniv-paris5fr 159
and httpprimer3pluscomcgibindevprimer3pluscgi 160
161
RESULTS AND DISCUSSION 162
Stem cell differentiation 163
Microscopic analysis showed morphological characteristics of cells differentiated from 164
mesenchymal stem cells (Figure 1-2) Three cells might differentiate from the mice originated bone 165
marrow stem cells were fibroblasts nerve cells and bone cells As shown in Figure 1A-B fibroblast 166
like cells had morphology characteristic of branching in cytoplasm oval-shaped large-pore and 167
pale oval cores accumulated by rough endoplasmic reticulum Most fibroblasts have components of 168
collagen fibers that function to maintain the integrity of cell membranes 169
Morphologically cells resemble to nerve cells had cytoplasmic elongations in some parts 170
and a centrally located nucleus These protein-rich cells normally play important roles in electrical 171
polarization of cells by forming a synapse bridge along neurons for signal transduction Young 172
nerve cells had more cytoplasmic components but relatively short streaks The development of 173
young nerve cells into mature nerve cells required many organic components especially proteins 174
that are important for maintaining integrity of cell membrane This is contrast to adult nerve cells 175
that already have a relatively stable cytoplasmic volume and many axons and dendrites 176
accompanied by long 177
Morphological characteristics of bone cells are similar to that of osteoblasts namely round 178
shaped cells have a large centrally located nucleus (Figure 2) The transformation phase of 179
Flower Delonix regia extract in induced alkaline phosphatase expression
8
osteoblast cells into osteocytes was accompanied by decreased cell diameter cytoplasm elongation 180
less bulky apparatus and reticular endoplasmic reticulum but had more lysosomes compared to 181
osteoblasts 182
183
184
185
Figure 1 Morphology of fibroblast and nerve like cells in culture media Above images show 186
fibroblast cell nucleus (A) and cytoplasmic elongation (B) Bottom images showed 187
morphology of young (C-1) and adult nerve cells (C-2) a Cell nucleus b Cytoplasma c 188
Axon 189
190
The expression of alkaline phosphatase gene 191
To provide more accurate cell differentiation validation one osteoblast differentiated from 192
mesenchymal stem cells was subjected to RT-qPCR method for quantification of alkaline 193
phosphatase (ALP) gene expression Previous studies on osteoblast formation indicated that ALP is 194
progenitor of osteoblast cell development (Singer amp Eyre 2008)5 Here beta actin mRNA was used 195
as a positive control for gene expression The results showed that ALP gene amplification was seen 196
through the PCR amplification curve of osteoblast differentiated from mice MSCs treated with all 197
four doses (06 mgml 07 mgml 08 mgml and 09 mgml) of flamboyant flower extracts (Figure 198
Flower Delonix regia extract in induced alkaline phosphatase expression
9
3A-C) The highest ALP expression occurred at cells treated with flamboyant flower extract 08 199
mgml (Figure 4) 200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
Figure 3 The qPCR amplification of ALP gene expressed by mice MSCs treated with D regia 217
flower extract of 06 mgml 07 mgml 08 mgml and 09 mgml The blue and purple 218
curves show the expression of alkalin phosphatase (ALP) and beta actin genes 219
respectively A Melting peak of DNA template B Melting curve of DNA template and 220
C Amplification cycle starts from cycle 20 to 36 221
222
As illustrated in Figure 3-C the ALP amplicons were formed in cycle 36 and that of beta-223
actin was amplified in cycle 20 Amplification of ALP started at cycle 30 whereas that of beta actin 224
Flower Delonix regia extract in induced alkaline phosphatase expression
10
began at cycle 20 Melting peak of amplification curves (Figure 3-A) indicated variation in 225
temperature requirements for elongation (annealing) of the two protein DNAs Melting peak of beta 226
actin amplification was about 85 C and those of ALP ranged from 75-85 C 227
228
229
Figure 4 Level of ALP expression among stem cells treated with different doses of flamboyant 230
flowers extract 231
232
This study is an early stage performed to find out potential use of alkaline phosphatase 233
(ALP) as a specific marker for successful mesenchymal stem cells differentiation induced by 234
flamboyant flower extract Systematically preliminary studies were done to investigate effects of 235
flamboyant flower extract on mesenchymal stem cell differentiation based on morphological 236
observation Standard microscopic examination using hematoxylin eosin (HE) staining protocol 237
showed that the administration of flamboyant flower extract in the concentrations ranged from 06-238
09 mgml successfully induced the differentiation of mice mesenchymal stem cells into fibroblast 239
nerve cell-like cells and bone cell-like cells (Figure 1-2) The results obtained therefore support 240
findings previosly reported by Eriani et al (2018) that flamboyant flower extract was able to induce 241
the differentiation of mice bone marrow originated mesenchymal stem cells into fibroblast and 242
Flower Delonix regia extract in induced alkaline phosphatase expression
11
nerve cells The study presented additional data about potential of the extract to stimulate 243
differentiation of bone marrow mesenchymal stem cells into bone cells 244
Next moleculer analysis was done to validate cell differentiation and to identify to potential 245
of alkaline phosphatase (ALP) as a molecular marker for bone stem cells differentiation This was 246
done by qPCR using forward and reverse primers specific for ALP gene Samples used were mRNA 247
extracted from fibroblast differentiated from mesenchymal stem cells Beta actin DNA amplified 248
using appropriate primers was used as positive control The approach successfully observed ALP 249
expression in all treatment groups (Figure 3A-C) Mesenchymal stem cells treated with flamboyant 250
flower extracts of 06 mgml 07 mgml 08 mgml and 09 mgml expressed 009 013 023 and 251
012 times alkaline phosphatase more than that of untreated controls These were significant 252
(plt005) compared to that of negative control The best treatment for the highest ALP expression 253
was the administration of 08 mgml flamboyant flower extracts (Figure 4) Altogether results 254
obtained showed potential of ALP as the specific marker for mesenchymal stem cells differentiation 255
into osteoblast cells 256
Most celullar biological processes in the body require the involvement of chemical 257
metabolites encoded gene and related pathways During differentiation process several molecular 258
messengers are synthesized to initiate the cascade of cell formation The OKTO4 SSEA3 SSEA4 259
SSEA1 TRA-1-60 and TRA-1-81 are among molecules play important roles in cell differentiation 260
[10] Previous study using human embryonic stem cell found increased synthesis of OCT4 261
NANOG ALP and stage-specific embryonic antigen-1 (SSEA1) during cell differentiation in vitro 262
(OrsquoConnor et al 2008)[10] Therefore differentiation of mesenchymal embryonic and 263
hematopoeietic stem cells might be traced based on the presence of these signaling molecules in 264
cells 265
Activation of these so called transcriptional factors might accelerate differentiation process 266
initiate cell division and speed up cellular metabolisms Mediator 1 (Med1) for example was able 267
to induce Noct1 signal stimulates the transcription of alkaline phosphatase gene probably by 268
Commented [D1] Apakah ini sama dengan OCT4 di bawah Apakah masing-masing singkatan ini tidak diberi kepanjangannya
Commented [D2] OKTO4
Flower Delonix regia extract in induced alkaline phosphatase expression
12
facilitating the interaction between transcription factors and RNA polymerase The importance of 269
Med1 in the formation and differentiation control of most cells including hematopoietic cells lumen 270
cells and epidermal tissue keratine has been reported (Yue et al 2011)[9] 271
Alkaline phosphatase is one of molecules plays an important role in the growth and 272
differentiation of bone cells digestive system organs and tissue formation Under normal 273
conditions concentration of alkaline phosphatase appears to incease in the formation of ATP 274
osteoblast immune response and food digestive organs as well as in cell division Increased ALP 275
expression proportional to exponential increases of bacterial populations indicated its function as 276
one of important factors for cell growth (Behera et al 2017[7] The enzyme belongs to 277
orthophosporic monoester phosphohydroxylase family was almost detectable in all parts of the 278
bodyrsquos developing cells (Pramanik et al 2016)[6] Molecular examination detects ALP presence in 279
the newborn serum placenta renal plasma pregnant women and gastrointestinal organs (Behera et 280
al 2017)[7] 281
The involvement of ALP in phosphate regulation and other chemicals metabolism as well as 282
in regulating activity of cells tissues and organs has been reported At the beginning of cell 283
development ALP concentration increases to meet cellular requirement for active bone and teeth 284
mineralizations The formation of cell frameworks becomes more robust and important to enhance 285
cell integrity essential for the continuity of metabolic processes of living cells At the end of 286
differentiation cellular ALP decreases because the enzyme is degraded into simple compounds that 287
then excreted into body circulation One study reported that ALP concentration decreases to near 288
normal when healing process of fractures was near perfect indicating a complete calcification 289
(OrsquoConnor et al 2008) [10] 290
The ability of flamboyant flower extract given to induce and activate growth factors might 291
be related to chemicals content of the plant Flamboyant flower extract contains auroxantine 292
mutatochrome and pyruvic acid that serve as diurectic anthelmintic astrigent and leucorrhoea 293
medications According to Jahan et al (2010) lupeol epilupeol β-sitosterol stigmasterol and p-294
Commented [D3] Tolong dicek ulanghellip
Flower Delonix regia extract in induced alkaline phosphatase expression
13
methoxybenzaldehyde from flamboyant flower extracts can suppress microbial populations and 295
degrade toxic properties of chemical compounds High concentration of the extract however might 296
be toxic Administration of 28 mgml of flamboyant flower extract affects the density of 297
Plasmodeum breghei in vivo [8] 298
Results of analysis on the formation of melting peak curves showed that in samples test of 299
U1 U2 U3 and U4 there were osteoblast cells because the sigmoideal graph of melting peak curve 300
existed above threshold base line whereas osteoblast cells were negative in control sample (U0) 301
Selain itu it can be said that cells that morphologically resemble to osteoblast cells in MSCs treated 302
to D regia extract of 06 mgml 07 mgml 08 mgml and 09 mgml were osteoblast cells based 303
on gene expression whereas in control sample that also morphologically showed osteoblast presence 304
was categorized negative based on gene expression These explained that methanol extract of D 305
regia flower was able to induce proliferation and differentiation of MSCs into osteoblast as shown 306
by a detectable ALP gene 307
Among chemicals contained in the flower of D regia that were able to trigger osteoblast 308
differentiation is flavonoid as reported by Zhang et al (2008) that flavonoid compounds could 309
trigger osteoblast differentiation so that the application of the extract in appropriate doses might be 310
able to make MSCs differentiate into osteoblast In addition flamboyant plant belongs to legumes 311
from the Fabacea family that was predicted to have phytoestrogen a compound resembles to 312
estrogen Important phytoestrogens contained in the flamboyant flowers are isoflavonoids named 313
genistein and daidzein Genistein could stimulate differentiation of bone marrow stem cells into 314
osteoblast The differentiation occurs due to increased Cbfa-1 (Ducy 2000) and transforming 315
growth factor beta-1 (TGF-1)(Heim et al 2004) Cbfa-1 is a transcriptional factor in the 316
differentiation of progenitor cells into osteoblast and plays a role in controlling developmental 317
differentiation and maturation processes of osteoblast (Ducy 2000) The TGF-1 regulates gene 318
transcription in cells via receptor signaling (Roberts et al 1990) Ogita et al (2008) reported that 319
genistein and daidzein also could enhance osteoblast proliferation via protein synthesis by 320
Flower Delonix regia extract in induced alkaline phosphatase expression
14
controlling the synthesis of Cbfa-1 and bone morphogenic protein-2 (BMP-2) (Federici et al 321
2004) 322
Study performed by Eriani et al (2018) that also used ethanol extract of D regia flowers 323
found morphologically osteoblast like cells differentiated from mice bone marrow mSCs treated by 324
D regia ethanol extract of 08 mgml Based on the results of this study therefore it can be 325
assumed that ethanol extracts of D regia flowers 08 mgml and 09 mgml were proved to be able 326
to induce proliferation and differentiation of MSCs into osteoblast Based on aforementioned 327
information ethanol extract of D regia flower in the doses of 08 mgml and 09 mgml can be used 328
as induction factors for MSCs proliferation and differentiation into osteoblast in the culture media 329
The osteoblast cells resulted might be applied in stem cell therapy for osteoporotic patients in the 330
future 331
332
Potential conflicts of interest 333
The authors declare that there are no conflicts of interest regarding the publication of this article 334
335
CONCLUSIONS 336
The study showed that administration of flamboyant flower (D regia) extracts ranged from 337
06-09 mgml (mv) successfully induced differentiation of mice originated bone marrow 338
mesenchymal stem cells into fibroblast nerve and bone cells The potential use of alkaline 339
phosphatase gene as specific marker for mesenchymal stem cell differentiation in vitro was showed 340
by significant increased (plt005) of gene expression by the treated cells compared to that by 341
untreated control cells 342
343
ACKNOWLEDGEMENTS 344
345
Flower Delonix regia extract in induced alkaline phosphatase expression
15
This research was supported by the Research Institute of Universitas Syiah Kuala through 346
Lector Research Grant (Contract Number 522UN11SPKPNBP2019) 347
348
REFERENCES 349
Singh S Kumar NS 2014 A Review Introduction to Genus Delonix WorldJ Pharmacy 350
Pharmaceut Sci 3(6) 2042-2055 351
Pryor WA Stahl W and Rock CL 2000 Beta carotene from biochemistry to clinical trials Nutr 352
Rev 58 39-53 353
Kurniawati Y Adi S Achadiyani Suwarsa O Erlangga D and Putri T 2015 Culture of primary 354
fibroblast A preliminary research Artikel Penelitian 38(1) 34 355
Singer FR Eyre DR 2008 Using biochemical markers of bone turnover in clinical practiceCleve 356
Clin J Med75(10)739-50 357
Wang LS Lee CT Su WL Huang SC and Wang SC 2016 Delonix regia Leaf Extract (DRLE) A 358
Potential Therapeutic Agent for Cardioprotection Plos One PLOS ONE 359
|DOI101371journalpone0167768 December 9 201 360
361
362
363
364
Article within a journal 365
Andrade CC Young KI Johnson WL Villa ME Buraczyk CA Messer WB Hanley KA 2016 366
Rise and fall of vector infectivity during sequential strain displacements by mosquito-borne 367
dengue virus J Evol Biol292205-18 368
Zhang J 2016a Coinfection with type 1 and type 2 PRRSV Vet Rec 178(12)288-90 369
Zhang J 2016b Porcine deltacoronavirus Overview of infection dynamics diagnostic methods 370
prevalence and genetic evolution Virus Res 22671-84 371
Flower Delonix regia extract in induced alkaline phosphatase expression
16
Article within a journal supplement 372
Meharena HS Fan X Ahuja LG Keshwani MM McClendon CL Chen AM hellip Taylor SS 2016 373
Decoding the interactions regulating the active state mechanics of eukaryotic protein 374
kinases PLoS Biol Suppl1-23 375
In press article 376
Voong LN Xi L Sebeson AC Xiong B Wang JP Wang XZ Insights into nucleosome 377
organization in mouse embryonic stem cells through chemical mappingCell in press 378
Published abstract 379
Rijsdijk KF de Louw PGB Meijer HJM Claessens LPAM Florens FBV Baider C hellip de Boer EJ 380
2016 Restoring and conserving the remains of the ecosystem of the Dodo lessons from a 381
4200 year old multitaxic bone bed [Abstract]Island Biology 2016 279-80 382
Article within conference proceedings 383
Cao H Guo W Qin H Xu M Lehrman B Tao Y Shugart YY 2016 Integrating multiple genomic 384
data sparse representation based biomarker selection for blood pressure In Rowles T 385
editor BMC proceedings 2016 Genetic analysis workshop 19 p 283-8 386
Tran Q Gao S Vo NS Phan V 2016 Repeat complexity of genomes as a means to predict the 387
performance of short-read aligners In BICOB 2016Proceedings 2016 Apr 6-4 Las Vegas 388
Winona (US) International Society for Computers and Their Applications (ISCA) p 135-389
42 390
Book chapter or article within a book 391
Faith DP 2016 The PD phylogenetic diversity framework linking evolutionary history to feature 392
diversity for biodiversity conservation In Pellens R Grandcolas P editors Biodiversity 393
Conservation and Phylogenetic Systematics Cham (ZG) Springer International Publishing 394
p 39-56 395
Complete book 396
Flower Delonix regia extract in induced alkaline phosphatase expression
17
Reddy PP 2016 Sustainable intensification of crop production Singapore (SG) Springer 397
Singapore 398
Monograph or book in a series 399
OrsquoToole D Sondgeroth KS 2016 Histophilosis as a natural disease InHistophilussomni Edited 400
by Inzana TJ Cham (ZG) Springer International Publishing p15-48 [Compans RW 401
Honjo T et al (Series Editors) Current Topics in Microbiology and Immunology Vol 402
396] 403
Book with institutional author 404
Food and Agriculture Organization 2016 The State of Food and Agriculture 2016 (SOFA) 405
Climate change agriculture and food security Rome (IT) Food and Agriculture 406
Organization of the United Nations 407
Dissertation 408
Ayloo S 2016 Molecular and cellular approaches toward understanding dynein-driven motility 409
[Dissertation] Retrieved from University of Pennsylvania Repository (Paper 410
AAI10124524) 411
Electronic Journal Article with DOI 412
Morzillo AT Kreakie BJ Netusil NR Yeakley JA Ozawa CP Duncan SL 2016 Resident 413
perceptions of natural resources between cities and across scales in the Pacific Northwest 414
Ecol Soc [Internet] [cited 2016 Nov 30] 21(3)14 Available from 415
httpwwwecologyandsocietyorgvol21iss3art14 doi 105751ES-08478-210314 416
Electronic Journal Article Non DOI 417
Hamzah A Hapsari RI Wisnubroto EI 2016 Phytoremediation of cadmium-contaminated 418
agricultural land using indigenous plants Int J Environ Agric Res [Internet] [cited 2016 419
Dec 20] 2(1)8-14 Available from httpwwwijoearcomPaper-January-2016IJOEAR-420
JAN-2016-2pdf 421
Webpage 422
Flower Delonix regia extract in induced alkaline phosphatase expression
18
Michigan State University [Internet] 2016 Just add water New discovery in plant-disease 423
mechanism Rockville US ScienceDaily [updated 2016 Nov 23 cited 2016 Dec 10] 424
Available from httpswwwsciencedailycomreleases201611161123140238htm 425
Webpage with Personal Author 426
Cowie S [Internet] 2016 The Pantanal is national heritage protecting the worlds largest wetlands 427
London (UK) TheGuardiancom [updated 2016 Nov 12 cited 2016 Dec 22] Available 428
from httpswwwtheguardiancomglobal-development-professionals-429
network2016nov12pantanal-conservation-wetlands-brazil-paraguay-bolivia 430
Lampiran 3 Foto Kegiatan