doi:10.1182/blood-2005-03-1139Prepublished online December 1, 2005;   

 Thomas S Kupper

andMichio Shibata, Nina Mirchandani, David A Jones, Deborah S Goddard, Sara Eapen, Hitoshi Mizutani Kei-ichi Yamanaka, Rachael Clark, Benjamin Rich, Rebecca Dowgiert, Kazuki Hirahara, Daniel Hurwitz, cutaneous T-cell lymphomaSkin-derived interleukin-7 contributes to the proliferation of lymphocytes in

(4217 articles)Neoplasia   � (5019 articles)Immunobiology   �

Articles on similar topics can be found in the following Blood collections

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

digital object identifier (DOIs) and date of initial publication. theindexed by PubMed from initial publication. Citations to Advance online articles must include

final publication). Advance online articles are citable and establish publication priority; they areappeared in the paper journal (edited, typeset versions may be posted when available prior to Advance online articles have been peer reviewed and accepted for publication but have not yet

Copyright 2011 by The American Society of Hematology; all rights reserved.20036.the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by    

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

1

Skin-derived interleukin-7 contributes to the proliferation of lymphocytes in

cutaneous T-cell lymphoma

Right running head: INTERLEUKIN-7 IN CUTANEOUS T-CELL LYMPHOMA

Left running head: YAMANAKA et al.

Kei-ichi Yamanaka12, Rachael Clark1, Benjamin Rich1, Rebecca Dowgiert1, Kazuki

Hirahara1, Daniel Hurwitz1, Michio Shibata1, Nina Mirchandani1, David A. Jones1,

Deborah S.Goddard1, Sara Eapen3, Hitoshi Mizutani2, Thomas S. Kupper1

1. Harvard Skin Disease Research Center, Department of Dermatology, Brigham and

Women's Hospital, Boston, MA, USA

2. Department of Dermatology, Mie University, Graduate School of Medicine, 2-174,

Edobashi, Tsu, Mie, 514-8507, Japan,

3. Biostatistics Core Facility, Dana Farber Harvard Cancer Center,

Department of Biostatistics, Dana-Farber Cancer Institute, Boston, MA, USA

Supported by a SPORE in Skin Cancer from the NCI/NIH.

Blood First Edition Paper, prepublished online December 1, 2005; DOI 10.1182/blood-2005-03-1139

Copyright © 2005 American Society of Hematology

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

2

Corresponding author: Thomas S. Kupper

Harvard Skin Disease Research Center,

Harvard Institutes of Medicine

77 Avenue Louis Pasteur

Boston, MA, 02115

Phone: (617) 525-5550

Fax: (617) 525-5571

E-mail address: tskupper@rics.bwh.harvard.edu

word count: 4022

Categories; Immunobiology

Key words: interleukin-7, cutaneous T cell lymphoma

Abbreviations: CTCL cutaneous T-cell lymphoma; CLA cutaneous lymphocyte

antigen; BV beta-variable; TREC T-cell receptor excision circle; IL interleukin; ELISA

enzyme-linked immunosorbent assay; RT reverse transcriptase; PCR polymerase chain

reaction; PCN/ Strep penicillin/ streptomycin; CFSE 5 (and 6)-Carboxyfluorescein

diacetate, succinimidyl ester; FITC fluorescein isothyocyanate ; Th T helper

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

3

Abstract

Cutaneous T-cell lymphomas (CTCLs) are malignancies of T cells that have a special

affinity for the skin. We have previously reported that much of the T cell receptor

repertoire is altered in CTCL, and both malignant and non-malignant clones are

numerically expanded, presumably in response to T cell trophic cytokines. We therefore

examined levels of the T cell trophic cytokines IL-2, IL-4, IL-7, IL-12, IL-13, and IL-15

in plasma in 93 CTCL patients and normal controls. Only IL-7 levels were elevated in

CTCL. We next looked at lesional skin from patients with CTCL, and found elevated

levels of IL-7 mRNA. Explant cultures of normal and lesional CTCL skin biopsies

revealed significantly more IL-7 protein production in CTCL skin. Additionally, cultures

of CTCL skin released greater numbers of T cells than normal skin; this was blocked by

the addition of an IL-7 neutralizing antibody. Finally, these cultures induced

proliferation of normal peripheral skin homing T cells that were added to the cultures.

These observations lead us to postulate that IL-7 produced by skin cells contributes to the

survival and proliferation of T cells within skin lesions, and is likely the source of

elevated circulating IL-7 in CTCL.

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

4

Introduction

Cutaneous T-cell lymphomas (CTCLs) are a heterogeneous group of lymphoproliferative

disorders of the skin1 and are regarded as a subset of extranodal non-Hodgkin's T cell

lymphomas of skin-homing memory T cells2. Among CTCL patients with peripheral

blood involvement, there are greater numbers of T cells expressing the skin-homing

cutaneous lymphocyte antigen (CLA) and the chemokine receptor CCR4 than are present

in healthy normal donors3. Furthermore, the CCR4 ligand CCL17 is highly expressed on

the endothelial cells in CTCL skin lesions3. These findings, together with the increased

expression of E-selectin and ICAM-1 in CTCL lesions4,5, suggest that the appropriate

microenvironment exists for the entry of skin-homing T cells into CTCL lesions3. These

malignant T cells may be found singly or collectively within the epidermis and admixed

with an infiltrate of mononuclear cells within the papillary dermis underlying the

involved epidermis.

We recently reported that in all cases of advanced CTCL, and many cases of

early disease, there is a significant disruption of the diversity of the T cell repertoire in

peripheral blood6. T cell receptor beta-variable (BV) spectratyping revealed diminished

complexity in many BV families6, and this correlated with diminished T-cell receptor

excision circles (TREC) levels7. Both observations are consistent with the idea that some

normal T cells are being removed from circulation, and other T cells are proliferating to

fill the space that this removal creates in the T cell compartment. The idea that there may

be a proliferative stimulus in the peripheral blood of CTCL patients led us to examine

peripheral blood plasma for the presence of T cell trophic cytokines. Patients and normal

controls were studied, and plasma levels of Interleukin (IL)-2, IL-4, IL-7, IL-12, IL-13,

and IL-15 were measured. In preliminary studies, only IL-7 was reproducibly increased

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

5

in patients with CTCL as compared to normal controls.

It has been appreciated for many years that resident cells of skin, including

keratinocytes and fibroblasts, can produce a wide variety of cytokines8-11. One such

cytokine is IL-7. IL-7 is a single-chain 25-kDa molecule that is important for both T and

B cell growth and development12-18. It is unique in its ability to both increase the

generation of naive T cells by the thymus12-16 and promote the survival of mature T

cells19-22 in the blood and lymph nodes, thus maintaining homeostasis in the T cell

compartment. IL-7 increases the survival of T cells in part by increasing the expression of

anti-apoptotic factor Bcl-223. It is interesting that elevated levels of plasma IL-7 have

been found in conditions of T cell depletion, including after chemotherapy and HIV

infection24-26, and IL-7 levels are inversely correlated with CD4 levels24,25. These studies

support the notion that increased production of IL-7 may be a homeostatic mechanism for

regulating T-cell proliferation and possibly thymic output24,25. IL-7 is also involved in

the growth and survival of Sezary cells27,28. Because CTCL cells may remain restricted to

the skin during the course of the disease, locally produced IL-7 may be important for the

survival of T cells.

In this study, we investigated plasma IL-7 levels in 93 CTCL patients, and

further measured lesional IL-7 mRNA expression levels in skin lesions from 10 CTCL

patients; both were compared to normal plasma and skin, respectively. In addition, we

cultured explants of normal and CTCL skin on specialized matrices that we have

previously shown to support the survival of resident cells in normal skin*. These cultures

were assayed for IL-7 protein, and the ability of the conditioned medium to support T cell

growth. Our results show that IL-7 is significantly increased in the plasma of CTCL

patients, and that CTCL skin contains mRNA for IL-7 and produces protein identical to

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

6

that of IL-7. This IL-7 was shown to be functional, as its presence demonstrably

enhanced T cell growth and blocking IL-7 reversed this property. In summary, we have

analyzed IL-7 production in CTCL and normal skin and investigated its possible role in

production and proliferation of lesional lymphocytes.

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

7

Materials and methods

Patients and healthy donors

Patients with CTCL who provided informed consent were recruited from the Cutaneous

Oncology Clinic at the Dana-Farber Cancer Institute. 93 patients with CTCL (51 men

and 42 women; median age, 61 years, range 19-94) were recruited for analysis of

peripheral blood. The subject profiles were as follows: stage I (35 men and 28 women;

median age, 59.5 years, range 19-90), stage II (6 men and 2 women; median age, 66.5

years, range 31-82), stage III (8 men and 7 women; median age, 63 years, range 30-94),

stage IV (2 men and 5 women; median age, 65 years, range 50-78). Diagnoses were based

on clinical criteria as well as on histologic and immunohistologic assessment of skin

specimens. CTCL was classified according to the TNM (primary tumor, regional nodes,

metastasis) classification. Blood specimens obtained from 20 healthy volunteers (10 men

and10 women; median age, 40 years, range 24-53) were also studied for comparison.

After informed consent, biopsy samples were taken from skin lesions of 18 CTCL

patients (10 men and 8 women; median age, 62 years, range 29-94) under local lidocaine

anesthesia. None of the patients had received any ultraviolet treatment, systemic drug

therapy, or topical corticosteroids for at least 3 weeks before the investigation. Ten

normal human skin samples were obtained as discarded tissue from cutaneous surgeries

and were cut into 6- × 6-mm pieces, the same size as the biopsy specimens from CTCL

patients. All studies using blood and skin biopsy samples were approved by the

Dana-Farber Cancer Institute Institutional Review Board.

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

8

Plasma preparation

Plasma samples were isolated from heparinized venous blood by density gradient

centrifugation over Ficoll (Histopaque, Sigma, St. Louis, MO). All plasma samples were

stored at –80 oC prior to use.

Quantification of cytokines

Cytokine levels in plasma and skin culture supernatants were measured by quantitative

sandwich enzyme-linked immunosorbent assay (ELISA). IL-2, IL-4, IL-7, IL-12, IL-13,

and IL-15 ELISAs were purchased from R&D Systems (Minneapolis, MN). Samples

were thawed at room temperature and assayed in duplicate. The reproducibility of the

ELISA was assessed through the incorporation of a control plasma sample in each assay.

Quantification of levels of cytokine mRNA

For quantitative reverse transcriptase (RT)-polymerase chain reaction (PCR) analysis,

biopsy specimens from 10 CTCL patients and 10 normal donors were snap-frozen in

liquid nitrogen until use. After the specimen was homogenized, total RNA was extracted

using the Clontech RNA purification kit (Clontech, Palo Alto, CA), according to the

manufacturer's instructions; 2–5 µg of total RNA (A260/A280 = 1.7-2.0) was reverse

transcribed with oligo-dT primers and PowerscriptTM Reverse Transcriptase (Clontech,

Palo Alto, CA) in a final volume of 20 µl; 1 µl of the cDNA was amplified by PCR in a

final volume of 50 µl with SYBR Green PCR Core reagents (Biosystems, Warrington,

UK) and 1 M of primers. Samples were screened for the expression of β-actin as a

housekeeping gene. The primer pairs specific for IL-7 and for β-actin were as follows

(5'-3'): IL-7: TGTTGAACTGCACTGGCCAG and GCAACTGATACCTTACATGG29;

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

9

β-actin: GTGGGGCGCCCCAGGCACCA and CTCCTTAATGTCACGCACGATTTC.

A series of standard dilutions of a plasmid were used to quantify cytokines and enzyme.

Specific signals for all transcripts were readily detected in human normal fibroblasts.

Standard dilutions are amplified with pGEM-T Easy Vector Systems (Promega, Madison,

WI) from the PCR amplifiers above. PCR was conducted with 40 cycles, which were

within the linear amplification range for PCR reactions. For all of these samples, PCR

was conducted twice. The specificity of the PCR products was confirmed by sequence

analysis.

Preparation of keratinocyte and fibroblast cell cultures from skin biopsy

Keratinocytes were isolated by incubation of normal control skin specimens in 2.4 U/ml

dispase II (Roche, Indianapolis, IL) overnight at 4oC; subsequent removal of the

epidermis sheet with tweezers was followed by incubation for 5 min at 37oC in PBS

containing 0.25% trypsin and 0.1% EDTA. Keratinocytes were grown in

Keratinocyte-SFM (Gibco, Carlsbad, CA) supplemented with 75 µg/ml bovine pituitary

extract (Gibco), 0.2 ng/ml EGF (Gibco), 0.3 mM CaCl2, 100 IU/ml penicillin, and 100

µg/ml streptomycin (PCN/Strep). Fibroblasts were isolated by mincing normal donor

dermal skin fragments and incubating the fragments in HBSS with 2.5 mg/ml trypsin and

5 mg/ml collagenase for 1 hour. Fibroblasts were cultured in DMEM/F12 (Gibco)

supplemented with 15% FCS (Sigma, St. Louis, MO), 10 ng/ml EGF, and PCN/Strep*.

Third-passage samples from normal keratinocytes and fibroblasts were used to quantify

cytokine mRNA. After cells were harvested for 2 days, they were washed twice with PBS

and collected, and mRNA was purified as described above.

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

10

Preparation of three-dimensional skin explant cultures

To analyze cytokines produced by skin in a culture condition which mimics

lymphocyte-tissue interactions in the skin, we developed a three-dimensional skin

explant culture system (details in *). Briefly, 9- × 9- × 1.5-mm Cellfoam matrices

(Cytomatrix, Woburn, MA) were autoclaved and incubated in a solution of 100 µg/ml rat

tail collagen I (BD Biosciences, Bedford, MA) in PBS for 30 min at 37oC. A punch

biopsy was taken from lesional CTCL skin or from normal discarded skin, subcutaneous

fat was removed, and the tissue was minced into explants approximately 2 × 2 × 2 mm.

Three skin explants were placed on the surface of each matrix, and the culture was

maintained in Iscove’s modified medium (Mediatech, Herndon, VA) with 10%

heat-inactivated FBS (Sigma), PCN/Strep, and 3.5 µl/L β-mercaptoethanol. The culture

was maintained for 5 weeks, and one-half of the skin-culture supernatant was collected

and replaced three times weekly. The produced T cells were collected once a week for up

to 5 weeks. In this system, keratinocytes and dermal fibroblasts grow and spread into

Cellfoam matrices, and skin-residing T cells are observed to spill out of the matrices into

the culture wells. Skin lesions themselves are simulated for more than 5 weeks. We also

cultured these skin explants with anti-human IL-7 neutralizing antibody or recombinant

human IL-7, IL-4 and/ or IL-13; anti-IL-7 antibody (25 ng/ml) or recombinantIL-7, IL-4

and IL-13 (25 ng/ml) was mixed in the culture medium from day 1. Eight CTCL skin

samples and eight control samples were collected for this experiment.

T cell proliferation

5 (and 6)-Carboxyfluorescein diacetate, succinimidyl ester (CFSE) was purchased from

Molecular Probes (Eugene, OR). Peripheral blood mononuclear cells were obtained from

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

11

discarded donated blood separated by density gradient centrifugation over Ficoll. T cells

were purified with magnetic bead selection using the pan-T cell isolation kit (Miltenyi

Biotec, Arburn, CA). CLA+ subsets were isolated by subsequent incubation of T cells

with fluorescein isothyocyanate (FITC) conjugated anti-human CLA antibody (BD

Pharmingen) followed by anti-FITC microbeads and magnetic selection. Positively

selected cells were collected as the CLA+ enriched fraction. These cells were then washed

with ice-cold PBS and labeled by CFSE (final concentration 1 µM) in PBS. Cells were

incubated for 15 min at 37°C, washed once, and incubated again for 30 min at 37°C in

Iscove’s modified medium. Cells were resuspended to a concentration of 1 × 106 in 40 µl

in Iscove’s modified medium. Cellfoam matrices colonized with either normal or CTCL

skin cells were transferred to empty tissue culture wells and CFSE labeled CLA+ T cells

were injected into the matrices and incubated for 1 hour at 37°C. Finally, 2 ml of Iscove’s

modified medium was added carefully and the culture was incubated at 37°C for 1 week.

One-half of the medium was removed and replaced every other day, and produced T cells

were collected on day 7. Cells were acquired in a FACScan, and CFSE levels were

analyzed using CellQuest software (both Becton Dickinson, Mountain View, CA). We

also cultured the skin explant with anti-human IL-7 neutralizing antibody (25 ng/ml)

from day 1.

Statistical analyses

Linear regression models were fitted to the plasma IL-7 data from all patients. The

models included the log10 of the plasma IL-7 levels as the dependent variable and age,

gender, and stage as the independent variables. The Wilcoxon-Mann-Whitney test was

used to evaluate differences in mRNA expression levels, IL-7 concentration in the

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

12

supernatant from skin explants and normal skin cells, and T cell yields between CTCL

and normal control skin samples.

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

13

Results

Plasma cytokine levels

Plasma cytokine levels of 93 patients and 20 controls were measured by ELISA. Levels

of IL-2, 4, 12, and 13 were all below the level of detection. In contrast, IL-7and IL-15

were both detectable in plasma of most patients and controls. There was no significant

difference in the circulating levels of IL-15 between normal controls and CTCL patients

(data not shown). However, IL-7 values from plasma were elevated in patients with

CTCL, and these results were further analyzed. The log transform, when applied to the

plasma IL-7 data, made the data symmetric. Therefore, a linear regression model was

fitted to the log10 of plasma IL-7 data, with age, gender, and stage as covariates (Figure 1).

All stages of CTCL showed significant differences compared with the normal cohort, but

no significant differences were seen for age and gender. A multiple comparison procedure

was used to determine the differences between the stages; however, no significant

differences were seen. Therefore, patients with staging data were combined into a single

group and compared to the group of healthy volunteers. The linear regression model was

fitted again with the following covariates; age, gender and presence or absence of disease,

defined as CTCL vs. normal. The results are shown in Figure 1. Only the patients’

identity as CTCL vs. normal was a significant covariate.

Expression of IL-7 mRNA in skin

We next studied the expression of IL-7 mRNA by quantitative PCR analysis. Figure 2A

shows the levels of mRNA expression in normal skin (n=10) and CTCL lesional skin

(n=10). The nonparametric two-sided Wilcoxon-Mann-Whitney test was used to compare

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

14

the cytokine levels of CTCL lesions with those of normal skin samples; the two-sided

p-values were 0.0001. These data demonstrate that the message for IL-7 is constitutively

expressed at a low level in human normal skin, but at a significantly higher level in CTCL

skin lesions. We found no statistically significant differences between the expression of

IL-7 by keratinocytes and fibroblasts cultured from normal skin (p-value = 0.3823)

(Figure 2B); thus, the source of IL-7 in CTCL skin is obscure.

IL-7 concentration in supernatants from CTCL and normal skin explant cultures

Supernatants from three-dimensional skin explant culture systems were collected at week

3 and analyzed for IL-7 production by ELISA. The two-sided Wilcoxon-Mann-Whitney

test was used to assess the differences between 8 normal controls and 8 CTCL patients.

The IL-7 concentration in medium conditioned by CTCL explants was significantly

higher than in normal controls (p-value = 0.0001) (Figure 3). Lesional lymphocytes in

CTCL produce T helper (Th) 2 cytokines, and we reasoned that the production of these in

situ might increase the levels of IL-7 present. However, levels of IL-7 from normal skin

explant cultures, treated with or without Th2 cytokines, were never as high as those

observed in CTCL samples. In addition, we found no detectable levels of IL-2 and IL-15

in skin explant cultures from either normal or CTCL skin (data not shown).

Production of T cells by skin matrix explant cultures

We have reported elsewhere that skin explants cultured on matrices gradually release

large numbers of skin resident T cells into the medium over a period of weeks*. We

harvested and counted the T cells produced by skin matrix cultures from both normal and

CTCL patients once each week. The two-sided Wilcoxon-Mann-Whitney test was used to

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

15

assess the differences between 8 normal controls and 8 CTCL patients. The number of T

cells released from CTCL skin matrices was significantly higher than that released from

normal skin cultures (p-value = 0.0019). Normal skin cultures treated with the Th2

cytokines IL-4 and IL-13 did not produce more T cells; however, as we expected, normal

skin cultures treated with recombinant human IL-7 released increased numbers of T cells.

These cultures released T cells at levels close to those seen in CTCL skin explants. We

hypothesized that IL-7 produced by the CTCL explant cultures could be responsible for

the increased number of T cells observed. Consistent with our hypothesis, the addition of

anti-human IL-7 neutralizing antibody to CTCL skin matrix significantly decreased the T

cell yield from these cultures (Figure 4).

Proliferation of normal T cells induced by CTCL skin cells

The data obtained thus far suggested that CTCL skin is an environment that supports

proliferation of T cells. To test the comparative ability of normal and CTCL skin explant

cultures to support proliferation of a relevant population of normal T cells, we labeled

normal peripheral blood CLA+ T cells with CFSE and incubated them for one week in

matrices colonized with either normal or CTCL skin cells. CD3+ CLA+ CFSE+

lymphocytes incubated in CTCL skin matrices divided up to three times during the

culture period (open histograms, bold line) (Figure 5); this cellular division of T cells

could be blocked significantly by addition of antibodies to IL-7 (open histograms, broken

line). Normal skin matrices did not support the proliferation of T cells (solid histograms).

Similar results were obtained in three independent experiments.

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

16

Discussion

In this study, we measured the levels of T lymphotropic cytokines in the plasma

of normal controls and a large population of CTCL patients. Of six cytokines measured,

only IL-7 showed statistically significant and reproducible elevations in patients with

CTCL. These elevations were found at all stages, and in fact stage was not a significant

covariate. We further demonstrated that increased levels of IL-7 mRNA were present in

lesional CTCL skin as compared to normal skin, and that explants of CTCL skin released

more IL-7 into the medium than did normal skin explants. In parallel, CTCL explant

cultures resulted in the release of many more T cells from skin than normal explants.

Importantly, this yield of T cells from CTCL explants could be reduced significantly if

antibodies to IL- 7 were added. Finally, we demonstrated that CTCL explant cultures

could support the presumably antigen independent proliferation of normal skin homing

memory T cells, while normal skin explants could not. This too could be blocked by

antibodies to IL-7. Taken together, these data point to production of IL-7 by CTCL skin

as an important feature of this disease.

IL-7 is thought to be produced predominately by epithelial and stromal cells in

the thymus, lymph nodes, and bone marrow30-32, and is a critical factor in both B- and

T-cell development12-18,33,34. Furthermore, it enhances both thymic and extra-thymic

lymphopoesis in the context of diseases that result in lymphopenia. IL-7 treatment can

induce the expansion of naive T cells without antigenic stimulation35,36 or differentiation

into memory T cell37,38.

We reported previously that the diversity of the T-cell repertoire in CTCL is

significantly contracted6, despite the presence of a relatively normal absolute T cell

counts39,40. We have postulated that this contraction of the T-cell repertoire contributes to

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

17

the immune suppression and significant infection-related mortality that characterizes

advanced disease. We also reported that the levels of TRECs in patients with CTCL were

decreased, even in early stage disease7. Especially in patients with advanced-stage CTCL,

TRECs levels in normal non-malignant T-cells were clearly reduced, a finding consistent

with the interpretation that many normal T cells had been removed from the T cell

compartment and that the remaining cells had expanded clonally to fill the empty space

created by their removal7. These results led us to consider the presence of IL-7 and other

T cell trophic cytokines in CTCL patients. Plasma levels of IL-2, IL-4, IL-7, IL-12, IL-13,

and IL-15 were examined in CTCL patients and normal controls. Only IL-7 and IL-15

could be reproducibly measured in the plasma of patients and controls. While IL-15

levels did not differ between patients and controls, plasma IL-7 levels were significantly

higher in CTCL patients than in normal controls. This increase appeared to be

independent of stage, though there was a trend towards higher levels in patients with

stage II and III disease. We next investigated whether CTCL skin could be the source of

the increased circulating levels of IL-7 in these patients. Using a sensitive and specific

quantitative PCR assay, we found higher levels of IL-7 mRNA in CTCL skin than in

normal skin.

Because cytokine mRNA expression and protein production do not always

correlate, we felt it was necessary to measure cytokine protein production in CTCL skin.

Direct quantitative IL-7 protein measurements from skin were impractical, so we

employed a three-dimensional matrix skin explant culture system to simulate intact

normal and CTCL skin*. Periodically, the medium conditioned by these explants was

sampled and tested for cytokines including IL-7. Our results indicated that IL-7 was

produced at much higher levels in CTCL explant cultures as compared to normal skin

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

18

explant cultures.

CTCL is thought to be a Th2 disease, and clonal CTCL cells produce Th2

cytokines41-44. To assess whether Th2 cytokines produced by clonal CTCL cells can

stimulate IL-7 production by resident skin cells, we incubated normal skin explant

cultures with the Th2 cytokines IL-4 and/or IL-13. We found no production of IL-7 at

levels comparable to those observed in CTCL explant cultures (Figure 3), suggesting that

these T cell cytokines do not stimulate skin cells in the explant cultures to produce IL-7.

When fibroblasts and keratinocytes from CTCL lesions were grown in two-dimensional

culture in the absence of lymphocytes, these cultures produced only low levels IL-7 (data

not shown). Subsequent addition of autologous CD3+ T cells to these two-dimensional

CTCL skin cell cultures did not restore IL-7 production (data not shown). These results

suggest that close cell-to-cell interactions between lymphocytes and skin-construct

fibroblasts and keratinocytes in a three-dimensional arrangement might be required for

efficient production of IL-7. We have reported previously that explants of skin placed on

the Cellfoam three-dimensional matrices produce significant numbers of T cells that

maintain a CLA+CCR4+ skin-homing phenotype*. CTCL skin explant cultures produced

eight-fold more cells than cultures of normal skin (Figure 4). Treatment of normal skin

explant cultures with IL-4 and/ or IL-13 did not significantly increase T cell yields.

However, treatment of normal skin explants with IL-7 increased T cell production to

levels observed in CTCL skin. Lastly, addition of anti-human IL-7 neutralizing antibody

to CTCL explants dramatically decreased the number of cells produced (Figure 4).

Interestingly, when we cultured psoriasis skin on the same matrix, IL-7 levels in the

supernatant were as low as those from normal skin explants, and the number of T cells

produced from psoriasis skin explants was similar to that from normal skin explants (data

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

19

not shown).

These data demonstrate that skin-derived IL-7 can promote the proliferation of

lymphocytes in CTCL skin lesions. To confirm that CTCL-skin derived IL-7 can induce

the proliferation of skin-homing T cells, we added CLA+ T cells from peripheral blood to

matrices colonized with skin cells from either normal or CTCL skin. Skin homing T cells

present in normal skin also express high levels of CLA3,45. Our data clearly demonstrated

that IL-7 produced in CTCL skin can support the proliferation of CLA+ T cells derived

from peripheral blood, a process that can be inhibited by antibody to IL-7 (Figure 5). We

performed the same experiment with psoriasis skin, however we did not detect any

proliferation for the CLA+ T cells cultured on the psoriasis skin explants. Thus, the

contribution of IL-7 to lymphocytes proliferation appears to be unique to CTCL skin. In

conclusion, in CTCL skin lesions where T cells may remain restricted to the skin

throughout the course of the disease, local production of IL-7 can strongly influence their

survival and proliferation.

Acknowledgments

The authors would like to thank Dr. Abrar Qureshi, Marianne Tawa and Carrie E.

Wechsler for sample collection and Nancy K. Voynow for critical reading of this

manuscript. Samples of normal human skin were graciously provided by Dr. Thomas

Cochran of the Boston Center for Plastic Surgery.

* A novel method for the isolation of skin resident T cells from normal and diseased

human skin Rachael A. Clark, Benjamin Chong , Nina Mirchandani, Kei-ichi Yamanaka,

Rebecca Dowgiert and Thomas S. Kupper (under revision)

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

20

References

1. Qin JZ, Zhang CL, Kamarashev J, Dummer R, Burg G, Dobbeling U. Interleukin-7 and interleukin-15 regulate the expression of the bcl-2 and c-myb genes in cutaneous T-cell lymphoma cells. Blood. 2001;98:2778-2783 2. Robert C, Kupper TS. Inflammatory skin diseases, T cells, and immune surveillance. N Engl J Med. 1999;341:1817-1828 3. Ferenczi K, Fuhlbrigge RC, Pinkus J, Pinkus GS, Kupper TS. Increased CCR4 expression in cutaneous T cell lymphoma. J Invest Dermatol. 2002;119:1405-1410 4. Fivenson DP, Douglass MC, Nickoloff BJ. Cutaneous expression of Thy-1 in mycosis fungoides. Am J Pathol. 1992;141:1373-1380 5. Uccini S, Ruco LP, Monardo F, La Parola IL, Cerimele D, Baroni CD. Molecular mechanisms involved in intraepithelial lymphocyte migration: a comparative study in skin and tonsil. J Pathol. 1993;169:413-419 6. Yawalkar N, Ferenczi K, Jones DA, et al. Profound loss of T-cell receptor repertoire complexity in cutaneous T-cell lymphoma. Blood. 2003;102:4059-4066 7. Yamanaka K, Yawalkar N, Jones DA, et al. Decreased T-cell receptor excision circles in cutaneous T-cell lymphoma. Clin Cancer Res. 2005;11:5748-5755 8. Heufler C, Topar G, Grasseger A, et al. Interleukin 7 is produced by murine and human keratinocytes. J Exp Med. 1993;178:1109-1114 9. Mohamadzadeh M, Takashima A, Dougherty I, Knop J, Bergstresser PR, Cruz PD, Jr. Ultraviolet B radiation up-regulates the expression of IL-15 in human skin. J Immunol. 1995;155:4492-4496 10. Bonifati C, Trento E, Cordiali-Fei P, et al. Increased interleukin-7 concentrations in lesional skin and in the sera of patients with plaque-type psoriasis. Clin Immunol Immunopathol. 1997;83:41-44 11. Grone A. Keratinocytes and cytokines. Vet Immunol Immunopathol. 2002;88:1-12 12. Vella A, Teague TK, Ihle J, Kappler J, Marrack P. Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cells: stat6 is probably not required for the effect of IL-4. J Exp Med. 1997;186:325-330 13. Schluns KS, Kieper WC, Jameson SC, Lefrancois L. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat Immunol. 2000;1:426-432 14. Tan JT, Dudl E, LeRoy E, et al. IL-7 is critical for homeostatic proliferation and survival of naive T cells. Proc Natl Acad Sci U S A. 2001;98:8732-8737 15. Vivien L, Benoist C, Mathis D. T lymphocytes need IL-7 but not IL-4 or IL-6 to survive in vivo. Int Immunol. 2001;13:763-768 16. Rathmell JC, Farkash EA, Gao W, Thompson CB. IL-7 enhances the survival and maintains the size of naive T cells. J Immunol. 2001;167:6869-6876 17. Namen AE, Schmierer AE, March CJ, et al. B cell precursor growth-promoting activity. Purification and characterization of a growth factor active on lymphocyte precursors. J Exp Med. 1988;167:988-1002 18. Namen AE, Lupton S, Hjerrild K, et al. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature. 1988;333:571-573 19. Kondrack RM, Harbertson J, Tan JT, McBreen ME, Surh CD, Bradley LM. Interleukin 7 regulates the survival and generation of memory CD4 cells. J Exp Med.

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

21

2003;198:1797-1806 20. Li J, Huston G, Swain SL. IL-7 promotes the transition of CD4 effectors to persistent memory cells. J Exp Med. 2003;198:1807-1815 21. Kieper WC, Tan JT, Bondi-Boyd B, et al. Overexpression of interleukin (IL)-7 leads to IL-15-independent generation of memory phenotype CD8+ T cells. J Exp Med. 2002;195:1533-1539 22. Seddon B, Tomlinson P, Zamoyska R. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat Immunol. 2003;4:680-686 23. Kim K, Lee CK, Sayers TJ, Muegge K, Durum SK. The trophic action of IL-7 on pro-T cells: inhibition of apoptosis of pro-T1, -T2, and -T3 cells correlates with Bcl-2 and Bax levels and is independent of Fas and p53 pathways. J Immunol. 1998;160:5735-5741 24. Fry TJ, Connick E, Falloon J, et al. A potential role for interleukin-7 in T-cell homeostasis. Blood. 2001;97:2983-2990 25. Napolitano LA, Grant RM, Deeks SG, et al. Increased production of IL-7 accompanies HIV-1-mediated T-cell depletion: implications for T-cell homeostasis. Nat Med. 2001;7:73-79 26. Boulassel MR, Smith GH, Gilmore N, et al. Interleukin-7 levels may predict virological response in advanced HIV-1-infected patients receiving lopinavir/ritonavir-based therapy. HIV Med. 2003;4:315-320 27. Dalloul A, Laroche L, Bagot M, et al. Interleukin-7 is a growth factor for Sezary lymphoma cells. J Clin Invest. 1992;90:1054-1060 28. Dobbeling U, Dummer R, Laine E, Potoczna N, Qin JZ, Burg G. Interleukin-15 is an autocrine/paracrine viability factor for cutaneous T-cell lymphoma cells. Blood. 1998;92:252-258 29. Benjamin D, Sharma V, Knobloch TJ, Armitage RJ, Dayton MA, Goodwin RG. B cell IL-7. Human B cell lines constitutively secrete IL-7 and express IL-7 receptors. J Immunol. 1994;152:4749-4757 30. Peschon JJ, Morrissey PJ, Grabstein KH, et al. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med. 1994;180:1955-1960 31. Moller P, Bohm M, Czarnetszki BM, Schadendorf D. Interleukin-7. Biology and implications for dermatology. Exp Dermatol. 1996;5:129-137 32. Fry TJ, Mackall CL. Interleukin-7: from bench to clinic. Blood. 2002;99:3892-3904 33. Abdul-Hai A, Or R, Slavin S, et al. Stimulation of immune reconstitution by interleukin-7 after syngeneic bone marrow transplantation in mice. Exp Hematol. 1996;24:1416-1422 34. Bolotin E, Smogorzewska M, Smith S, Widmer M, Weinberg K. Enhancement of thymopoiesis after bone marrow transplant by in vivo interleukin-7. Blood. 1996;88:1887-1894 35. Soares MV, Borthwick NJ, Maini MK, Janossy G, Salmon M, Akbar AN. IL-7-dependent extrathymic expansion of CD45RA+ T cells enables preservation of a naive repertoire. J Immunol. 1998;161:5909-5917 36. Webb LM, Foxwell BM, Feldmann M. Putative role for interleukin-7 in the maintenance of the recirculating naive CD4+ T-cell pool. Immunology. 1999;98:400-405 37. Hassan J, Reen DJ. IL-7 promotes the survival and maturation but not

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

22

differentiation of human post-thymic CD4+ T cells. Eur J Immunol. 1998;28:3057-3065 38. Boise LH, Minn AJ, June CH, Lindsten T, Thompson CB. Growth factors can enhance lymphocyte survival without committing the cell to undergo cell division. Proc Natl Acad Sci U S A. 1995;92:5491-5495 39. Wu CJ, Chillemi A, Alyea EP, et al. Reconstitution of T-cell receptor repertoire diversity following T-cell depleted allogeneic bone marrow transplantation is related to hematopoietic chimerism. Blood. 2000;95:352-359 40. Raaphorst FM, Schelonka RL, Rusnak J, Infante AJ, Teale JM. TCRBV CDR3 diversity of CD4+ and CD8+ T-lymphocytes in HIV-infected individuals. Hum Immunol. 2002;63:51-60 41. Dummer R, Heald PW, Nestle FO, et al. Sezary syndrome T-cell clones display T-helper 2 cytokines and express the accessory factor-1 (interferon-gamma receptor beta-chain). Blood. 1996;88:1383-1389 42. Nickoloff BJ, Fivenson DP, Kunkel SL, Strieter RM, Turka LA. Keratinocyte interleukin-10 expression is upregulated in tape-stripped skin, poison ivy dermatitis, and Sezary syndrome, but not in psoriatic plaques. Clin Immunol Immunopathol. 1994;73:63-68 43. Rook AH, Vowels BR, Jaworsky C, Singh A, Lessin SR. The immunopathogenesis of cutaneous T-cell lymphoma. Abnormal cytokine production by Sezary T cells. Arch Dermatol. 1993;129:486-489 44. Vowels BR, Lessin SR, Cassin M, et al. Th2 cytokine mRNA expression in skin in cutaneous T-cell lymphoma. J Invest Dermatol. 1994;103:669-673 45. Fuhlbrigge RC, Kieffer JD, Armerding D, Kupper TS. Cutaneous lymphocyte antigen is a specialized form of PSGL-1 expressed on skin-homing T cells. Nature. 1997;389:978-981

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

23

Figure Legends Figure 1. Levels of IL-7 in plasma from patients with CTCL. Plasma samples were collected from 93 CTCL patients and 20 normal controls. IL-7 levels were measured by ELISA. IL-7 levels were significantly higher in plasma samples from patients with CTCL. p< 0.001, ** p< 0.01 Figure 2. Expression of IL-7 mRNA in normal and CTCL skin (A), and in normal keratinocytes and fibroblasts (B) was analyzed by quantitative PCR. The data are shown as a relative quantification of IL-7mRNA expression levels divided by levels of β-actin mRNA. Expression of IL-7 mRNA was significantly higher in CTCL skin lesions than in samples of normal skin (A). * p< 0.001 Figure 3. IL-7 concentration in supernatants from skin explant cultures. Normal and CTCL skin explants were cultured under various conditions. The concentration of IL-7 in the supernatant was analyzed by ELISA. IL-7 levels were significantly higher in CTCL samples than in normal controls. Treatment with the Th2 cytokines IL-4 and/or IL-13 did not significantly increase IL-7 production. Figure 4. Production of T cells by skin matrix explant cultures. CTCL and normal skin explants were cultured under various conditions and T cell production was assayed. The number of T cells produced from CTCL skin explants was significantly higher than from normal skin explants. Normal skin explants treated with Th2 cytokines IL-4 and/or IL-13 did not produce more T cells. Normal skin explants treated with recombinant human IL-7 produced more T cells than untreated cultures. The addition of anti-human IL-7 neutralizing antibody to CTCL skin explants decreased the numbers of T cells produced. Figure 5. Proliferation of normal blood CLA+ T cells incubated in matrices colonized with skin cells from CTCL lesions or normal skin. CFSE-labeled CLA+ T cells were isolated from peripheral blood and incubated for one week in matrices colonized with skin cells from either CTCL or normal skin. T cells were analyzed by flow cytometry. CD3 + CLA+ CFSE + lymphocytes divided up to three times in CTCL skin matrices (open histograms, bold line); this cellular division of T cells could be blocked significantly by addition of antibodies to IL-7 (open histograms, broken line). Normal skin matrices did not support cell proliferation (solid histograms).

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

24

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

25

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

26

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

27

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

28

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom