Vol. 54: 209-211, 2003 O!SEASfS OF AQUATIC OJtGANISMSOls Aquat Org

Publlsbed April 24

Mikrocytos roughleyi taxonomie affiliationleads to the genus Bonamia (Haplosporidia)

N. Cochennec-Laureaut,4,., K. S. Reece2, F. C. J. Berthet, P. M. Hine3

'lnsUtut françab de Recherche pour l'ExploltillUon de la Mer (lfREMfRI, laboratoire de Génétique el Pathologie,PO Box 1346, 17390 La Tremblade, france

1\'1rglnl. 1llSUtute of Marine Science (VlMSJ, Aquaculture GeneUcs and Breedlng Technology Center, Gloucesler Point.\'Irglnla 23062, USA

~Aquatlc Animai DW!!ases, National Centre lor Dlsease Investlgatlon, Mlnlstry 01 Agrlcullure and flsherles IMAfjOperatlons, PO Box: 40.742, Upper Hull, 6007 Wellington, New Zealand

'Present IJddre55: IfREMER, Laboratoire d'Aquaculture Tropicale, SP 7004, 98719 Tuavao, french Polynesla

ABSTRACT: Mîcrocell·type parasites of oysters are assodated with a complex of diseases in differentoyster species around the world. The etiologicaJ agents are prolists of very small sue that are very dif·ficult to characterize taxonomieaUy. Assodaled lesions rnay vary according to the hasl spedes, andtheir occurrence rnay be relaled to variations in tissue structure. Lesion morphology eannot be used10 distinguish the dîfferent agents involved. UltrastructuraJ observations on Mikrocytos rOlJghleyireveaJed similarities with Bonamia spp., particularly in regard la the presence of electron-dense hap.losporosomes and mitochondria, wh05e absence from M. mackini also indieate thal M. rougbleyi andM. macldnj are not congeneric. A partial small subunit Issu) rRNA gene sequenee of M. roughJeyiwas delennîned. This partiaJ sequence, 951 nudeotides in length. has 95.2 and 98.4 % sequence sim·ilarities with B. ostreaeand B. e1dUoslJs ssu rONA sequences, respectively. Polymorpblsms among the55U rDNA sequences of B. ostreae, B. e1dUosus and M. roughleyi allowed identification 01 restrictionenzyme digestion patterns diagnostic for each species. Pbylogenetie anaJysis based on the ssu rONAdata suggested thal M. roughleyi belongs in the phylum Hapl05poridia and thal il is dosely relaledto Bonamia spp. On the basis of ultrastructural and molecular considerations, M. roughleyi should beconsidered a putative member of the genus Bonamja.

KEY WORDS: Mikrocytos roughleyi . Saccostrea glomerata . Bonamiosls . Mierocell . Tuonomy .SmaU subunil rDNA

----------ReuJe or repub/lc<tlion nOl permlned withoul wrlflen consenl of Ihe pubJisher----------

INTRODUCTION

Among the 10 OlE (Olfice International des Epi·zooties: the World Organization for Animal Health)·listed d.iseases of molluscs, 4 are eaused by non·spore·forrning organisms given the collective name of'microceU' (Farley el al. 1988). Of these, 1 d.isease,bonamiosis, 15 caused by al least 2 hapl05poridian pro·lozoans that infect the haemocytes of nat oyslers.Bonamia ostTe.te infects the European flal oyster Osueaedulis in Europe and in North America (Piehol et al.

. Email: m:ochennllitremer.ir

1980, Bannister & Key 1982, Polanco el al. 1984, Eistonel al. 1986, McArdle et al. 1991. Barber & Davis 1994),B. exitiosus infects the New Zea1and dredge oyster T.chilensis (Dinamani et al. 1987, Hine 1991, Hine et aJ.2001b), and Bon5Jltia·like organîsms also infect the flatoysters O. angasiinAustralia (Hine 1996) and T. chUen·sis in Chile (Kern 1993, Campalans et aJ. 2(00) (presentTable 1). A second disease, mikrocytosis, is caused by 2other 'microcell' protozoans: MiJerocyl05 mackinieauses Denman Island disease in the Pacifie oyslersCrassostrea gigas in British Columbia (Quayle 1961.

o lnter·Research 2003 . www.iot·res.com

210 Dis Aquat Org 54: 209-217, 2003

Table L Comparisons among pathogen species. natural and experimentlll hosts, gross signs, histological features and parasitelocation. nd: disease experimental reproduction not done

80namia ostreae BOll/lmia eritiosus Bonamia sp. Mikrocylos roughleyi M. mackini

Natural hosts Ostrea edulis riostrea chilellsis O. angasi Saccostrea glomerala Crassostrea gigasT. chilensis

Experimental hosts O. puelchana od od od C. virginicaO. concaphjla O. eduIisO. angasi O. concaphilaT. cbi/ensisC. rivularis

Gross signs Gill and manUe No sign No sign Abscesses and Abscesses andperforations or pustules on mantle pustules on manUeindentations or muscle or muscle

Histologicalleatures Global haemocyte Global haemocyte Global haemocyte Focal haemocyte Focal haemocyteinfiltration infiltration infiltration infiltration infiltration

l.ocation Haemocytes and Haemocytes Haemocytes Haemocytes Haemocytes,cells epithelial myocytes,

connective cells

FarJey et al. 1988), and M. Toughleyjcauses wintermor­tality in the Sydney rock oyster Saccoslrea glomerata inSE Australia (Roughley 1926, Farley et al. 1988). Exper­imentally, Bonamia spp. can infect Ostrea spp. (Grizelet al. 1983, Le Borgne & Le Pennee 1983, Bougrieretal.1986, Pascual et al. 1991) and C. rivuJaris(Cochennec elal. 1998). M. mackinihas been shown to infect C. gigas,C. vjrgjnica, 0. eduljs and O. concaphila (Bower et al.1997) (present Table 1). Therefore, Bonantia spp. andMikrocytos spp. cannol be distinguished solely by thehosts whîch they Înfect. However, 10 date lhe geo­graphic distributions of the 2 Mikrocytos species ap­pear 10 be distinct, with M. mackini having been re­ported ooly in western Canada and M. roughleyi onlyin easlern Australia.

Several studies have included observations of Iheultrastructure of Bonamia ostreae (Comps el al. 1980,Pichot et al. 1980, Bréhelin et al. 1982, Grizel et al.1983, Grizel 1985, Chagot et al. 1992, Montes et al.1994) and B. exiliosus (Dinamani et al. 1987, Hine1991, Hine & Wesney 1994a,b, Hine et al. 2001b), bulthere are none on Bonamia sp. in OstTea angasi in Aus~

Iralia or Tiostrea chilensis in Chile. A recenl study onthe ssu rDNA gene sequences of B. ostreae (Carnegieel al. 2000, Cochennec et al. 2000) and Bonamia sp.from New Zealand showed thal they are congeneric,and a new spectes, B. exitiosus, was created (Hine elal. 200tb). An unpublished study on the ssu rDNAgene sequences of Bonamia sp. from Australia and B.exitiosus from New Zealand suggesls Ihat these 2 par­asites are conspecific, despite showing very differentpalhology În their respective hosts (R. D. AdJard pers.comm.).

The ultrastructure of Mikrocytos mackini confirmsthat this parasite is different from Bonamia spp.

because of the lack of organelles in mosl eukaryoticceUs inciuding mitochondria or their equivalents (Far­ley et al. 1988, Hine et al. 2001a). There have been nopublished sludies on the ultraslructure of M. roughleyi.The only Mjkrocytos sp. for which sequences from Ihessu rDNA gene ciusler have been published is M.roughleyi (Adlard & Lesler 1995).

Certification of slocks as free from specific diseaseagents prior 10 movemenl is the basis of disease controlin member counlries of the Office International desEpizootis. For this to be effective, listed etiologicalagents must be reliably delectable and identifiable.Heavy inlection by microcells may be detected by lightmicroscopy, but identification cannol be carried ouiwith any certainty. Also, light infection cannat reliablybe detected by light or electron microscopy. There isan urgenl need to characterize each 'mierocell' spe­des, and identify gene sequences that allow them to bedistinguîshed hom each other.

The aim of lhis study was the characlerization ofMilcrocytos roughleyj by means of ultraslructuralobservation and ssu rDNA gene sequence determina­tion ta ciarify taxonomie relationships with othermicrocell parasites.

MATERIALS AND METHOOS

Electron microscopy. 4 % glutaraldehyde (in 0.2 Mcacodylale buffer) fixed tissues from infected $ac­castrea glomerata were provided by R. Hand, NewSouth Wales Auslralia Fisheries Department. Theywere posl-fixed for 1 h in 1 % osmium letroxide (OS04)in 0.2 M cacodylale butfer. Tissues were then ciearedin propylene oxide and embedded in epon resin. Ultra-

Cochennec-Laureau et aL: Mikrocytos rougbleyi affiliation to Bv"amia spp.

~-------~~~~-

2>,

thin sections were made using copper grids and dou­ble-stained with uranyl acetate and lead dtrale. Thesewere then examined in a Jeol JEM 1200 EX trans­mission electron microscope.

DNA extraction. Cenomic DNA was extracted lromethanol-fixed, individually infected oysters. Tissueswere suspended in 10 volumes of extraction bulfer(NaCl 100 mM, EDTA 25 mM, pH 8, SOS 0.5%) withProteinase K (100 pg ml-Il. Following overnight incu­bation al 50°C, DNA was extracted using a standardphenoVchloroform protocol followed by ethanol pre­dpitation (Sambrook et al. 1989).

Polymerase chain reaction. The partial ssu rDNAwas amplified using the universal primer Suni and theBonamia ostreae specifie primer Bo-Boas (Cochennecel al. 2000). PCR was performed in 50 III volume con­laining about 10 ng of DNA with 5 pl of 10x PCRbulfer, 5 p.l of 25 mM MgCI2, 5 pl 01 2 mM dNTP, 0.5 plor each 100 IlM primer and 0.25 pl (1 U) of Taq DNApolymerase [Promega). Samples were denatured for5 min at 94°C and amplified by 30 cycles: 1 min al 94'Clor denaluration, 1 min at 55'C for primer anneaLing,and 1 min at noc lor elongation in a thermal cycleapparatus (Appligene). Polymerization at noc waseXlended for 10 min 10 ensure complete elongation ofthe amplified products. After amplification, 5 pl of thePCR products were analyzed by eleclrophoresis onethidîum bromide-staining agarose gel (2 % in Trisacetate EDTA buffer).

DNA sequenclng. Amplicons (= PCR products) werecloned using the TA Cloning kit (Invîlrogen) fol1owingthe manulacturer's protocol. Two recombinant plas­mids with putative ssu rDNA inserts were sequencedby Appligene [Laboralory Qbiogen). Sequences werecompared for similarity with public databases lodgedin CenBank and EMBL using BLAST (Altschul et al.1990).

Restriction fragment length polymorphism (RfLP).A PCR was perlormed wilh primers designed foramplification of Bonamia ostreIJe: Bo-Boas [Cochennecet al. 2000). Template DNA was obtained fromMikrocyros roughleyi, inIected Saccostrea glomerata,B. exitiosus-infected Tiostrea chilensis and B. ostreae,infecled Ostrea edulis. RFLP analysis was performedby separate digestions of 10 pl of PCR product withBgll and Haell (Promega, France). The resulting frag.ment panerns were analyzed electrophoretically on2 % agarose gel.

PhylogeneUc analysis. Phylogenetic analyses wereconducted by aligning the Mikrocytos roughleyi ssurDNA sequence with 53 other protistan ssu rDNAsequences, induding those of dînoflagellates (Amphi­dinium carrerae: AF009211; Pliesteria pisdcida:AF077055; Prorocentrum minimum: Y16238; Alexan·drium lundyense: U09048; GonYlJulax spiniferIJ:

Af052190: Symbiodinium corculorum: LI3111); api­complexans (Babesia bovis: L19078: TheileriIJ parva:L02366: Eimeria tenella: U40264; SIJrcocystis hominis:AF006470: Toxoplasma gondii: U03070); ciliates (Eu­plotes crassus: AY007438; Oxytricha nova: X03948: 0.trüallax: AF164121; Entodinium CIJudatum: U57765;Paramecium tetraurelia: X03772; Tetrahymena pyrilor­mis: M98021: T. thermophila: X56165); fungi (Ajello­myces capsula tus: Z75301; Neurospora crassa: X04971:Jauyveromyces lactis: X51830; SIJccharomyces cere·visiae: J01353; Candida glabrata, X51831: Pneumo~

cystis carinii: S83267); slramenopiles (Fucus distichus:M97959: Ochromonas damca: M32704; Achlya bisexu­alis: M32705: Phytophthora megasperma: X54265:QPX; AF261664: Ulkenia prolunda: L34054); haplo­sporidians (Bonamia ostreIJe: AF192759; B. exitiosus:AF337563; Minchinia teredinis: U20319; HIJplosporid­ium nelsoni: U19538; H. cosrale: AF387122; H. loui­siana: U41851: Urosporidium crescens: U47852); Per­kinsus spp. IF. mIJrinus: AF042708; P. aUanticus:AF140295; P. chesapeaki: Af042101); and other proto·zoans (Emiliania huxleyi: M87327; Chlamydomonasreinhardtli: M32703; NiteUa fJexilis: U05261; Acantha­moeba palestinensis: L09599; Dictyostelium discoi­deum: XOOI34; Naegleria lowleri: U80059; Physarumpolycephalum: Xt3160; Trypanosoma cruzi: X53917;Euglena gracilis: M12677; Encephalitozoon cuniculi:L17072; Chondrus crispus: Z14140; ViJirirnorpha neca­tm: Y00266; Giardia lamblia: M54878). The sequenceswere aligned using the CLUSTAL-W algorithm(Thompson et al. 1994) in Ihe MacVector 7.0 DNAsequence analysis software package (Oxford Molecu­lar) with gap penalties of 8 lor gap insertions and 3 forgap extensions in both pairwise and multiple align~

ment phases. Parsimony jack-Imite analysis was per·formed using PAUp·4blO.0 (Swoflord 2002) with100 random additions of 100 jack-knife replicates.

RESULTS

Ultrastructural studles

Mikrocytos roughleyi cells were found in haemo­cytes withîn the gills and dîgestive gland. InIecledhaemocyles generally contained several parasites. Thestructure 01 sorne haemocytes was only slighUyaffected, while others were more profound1y alteredand displayed vacuolization (Fig. 1). The simplest formof the parasite was ovoid, about 3 to 5 pm in diameter,and bound by a unît membrane. The nudear envelopeconsisted of an inner and an outer membrane. Aperipherally located nucieoLus was sometimes present.The cytoplasm was densely packed with ribosomesand contained 1 or 2 mitochondrial profiles in section.

DI~AIIUIiI OI!J 5~ 20'1-217, 201l~

ln adt!lttOll. 1 10 Il haplosporosomcs, tltsplaymg {Inelectron-dense matril'. were observcd (Fig 21. Singlecyloplasllll(' Iipld dloplct!> wcre rdfely observcd. PldS­motliill fonns with 2 to ~ lIudei wcre rarely ohscrvc<t(Figs, 3 0& 4). Thcse ceUs wcrc larger and their nucleiand ccllutdrshapcs \Velc more irregul'lI lhan the unin­ucleate cells. They had cytoplasmic haplosporosomes,as did the sllIallcr cens, but llIore numerous mitochon­dn,l. Snwll strùnds of smooth endOI)laSlIllC relic:ultull''''Nf! somchmes obscrved

ONA SC(lllcncc

An c.mphcon 01 951 bl) WilS oblained. (GenBtlnkAc<:ession No = AF508801J. BLAST dllitlysis ot lhlssequence 'Igainsl plIbhc databases confinllcd lIli.lt il 15

<In ssu rRNA gcne sequence <U1d rcvcaled simil'Hltlcs\Vith 5511 IRNA gene sC<lucnccs Il! ta x.. in the l)hylulllIItllllospondi,l, particularly ""Ilh Ihose in the 9('O\L<;;BOnilllli<l. H. oslreile and O. exl/IOSIIS sequence simililr·llies wcre 95.2 ,ond !J8A %, rc~pccllvely.

.......~-•

•

I:'(J~ 1 ID ~ S.~rr(IÇfmll ylumeri,t., nalllmlly U1'l'rl~1l \\',Ih fl ',krnryl/l~ mUY'JI"J'I. Ell'ctlOn 1],lr,'oscopy r:.!iLl...lnlartefl Ilyslc' "lIow­ill(J lIumerous Jlilr<iSllCS wilhin h('Inl){Tte cytolliusm (IIrTowl [:I<:ille hM '" 11''''1. Fig. 2. ~1l"'lsile sllowing mlcll.'u~wlth exœnt'ic nu·cleoluJi INl, elec1ron·dense hllpiosJloroSOIlle5 (1-I11!i(':#Ile heU ~ 200 nllii FIC! 3. Diplokllry'ltlc cell shoWH1!1 mîlochondriil (ml (stnle

hlll" 200 nllIl. !:!9.:..:!c Multllluch,ate plusnlodl<ll ~lil!Je wlth 4. nuC'll.'llslJlrsll~cJlle bd' "" 500 'IIU}

B.eririoJusM.rollghl~yi

B.OSlrtO~

B.a:iliosusM.rough/~yi

B.OJlr~o~

B.exiliosu!M.roughleyiB.oslr~ae

8.t:ritiosu$M.rougMeyiB.oJlrMt

8.oitiosu!M.roughltyiB.oslrtal:

B.exitiosu!M.rougMtYIB.os/rr:oe

CCATITAATIGGTCGGGCCGCTGGTCCTOATCcrtTAC'J11'OAGAAAA'ITAAAGTGCTCACCA1TT'AATIGGTCGGGCCGCTGGTCCTOATCcrrrACTITGAGAAAATTAAAGTGCTCACCATITAATrGGTCGGGCCGCfOOTCCTOATCCTTTAcrITOAOAAAA11'AAAOTGCTCA

Haell,AAGCAGGCTCGCGCCTGAATGCATTAGCATGGAATAATAAGACACOAcrrCGGCGOCGCCAAGCAGGCTCGCGCCTGAATGCATfAGCATGOAATAATAAGACACGACiTCGGCACCGCCAAGCAGGCTCOCGCCTGAATGCATfAGCATGGAATAATAAGACACGACITCGGCGCCGCC

ACl'CGTGGCGGGTGTI"'GTIGGTlTIGAGC'TOGAGTAATGAiTOATAGAAACAATIGGGACTCGTGGCGGGTG'fTITorrGG1TlTGAGCTGGAGTAATGATIGATAGAAACMTIGOG.- TC--GGCGGTIGTITIGTrOOTITrGAGCTGGAGTAATGArrGATAGAAACAArrGGG

Ao~1

GOTOCTAGTATCGCCGGGCCAGAGGTAAAATIcnTAAlTCCQGTGAGACTAACITATGCGUïQCfAGTATCGCCGGGCCAGAGGTAAAA11'crrrAA1ï(''CGGTGAGACTAACTrATGCGGTGCTAGTATCGCCGGGCCAGAGGTAAAATfCJTfAATfCCGOTGAGACI'AAcrrATGC

OAAAGCATTCAOCAAGCGTGTITTcrrrAA1LAAGAACTAAAGTTOGQGGATCGAAGACGGGAAGCA'rrCACCAAGCGTG1TITCITfAATCAAGAACTAAAGTIGGGGGATCGAAGACGGAAAGCATfCAOCAAGCGTG'fTITCTTTAATCAAGAACTAAAGTTGGGGGATCGAAGACG

ATCAGATCAGATCAO

213

fi,! !) BOlltlfmll O$lr;.>,l.... IJ ...xlrwsu.ç and "tlkroq'fOS rOl/gh/l'yl IJo:I-BO/I~ st.'lIIlCrKI' llhglllnclIl (rI.USTAI.WI "'osillons ot IllcOfJnr.Uon Slle~ 01 restriction en"l'mes IJgII and 1'neU llldicalcu 1)y Mfowhellds

Assessmenl of ssu rDNA polymorphlsm

CLUSTAL·W lIlulliplc aligllmcnt program showed apolynlorphlc reglon 01 6 base pAirs. This region \'lasIOC.llPd wilhlll Ihe <;peC"ifl(' 80nmnm gcnus Ho-Boaspnmel' amphfJed se<luence (Fig. SI. Resulls or RFLPanillYSls of n. ostrei:le. B. exillOsus and !<lJkrocylosrol/ghley' l'CR produclS Me giVC!1l ln Fig. 6. The Ilostre,'c profile C<lnslstccl or 2 bands (120 and 180 pblfor Hgll and 2. bands (115 and 1851lb) lor I-/ac Il. whilcthe B. cxifiosus IJrofllcconslsled 01 1 band 1304 pbl and2 bands (\17 and 187 pb), respcctivcly. The M. rOllgh­/eyiprohle conSlsted al a uni<lue band (304 pbllor bath0911 and/Ille U.

Ilhylogcnelic analysls

Phylogenehc relalionships of Mikrocytos rougfllc)'iwcre mferred by parsimonl' 'lnalysl5 01 55U rDNAsequences Irom M. roughJeyi and 53 oUler cukaryolict..xn The ,,",1. rouY/l/ey; :.etlue.nce grouped with lhesC(luences for lax,l III Ihe phylum HaplosJ)ondlél, par­tlCUllll"ly wHh the S<!(luences trom Bonllm;(j ostrCIlf',1nd

2 3 4 5 6 7 8 9 10

Fig b T'wQ % aD"ros<'" gel eleclrophoresls_ LIlne 1: IOQ 1)1'molecular welghl uunkér lllnes 2 10" specil\r. Bnnllmfilgenus !'CRI !..ane 2' Joo bp l'Iodllel ohlOined wllh Il. osfre<l('DNA; Lnnc J: J04 bp Ilroduct obllllrwd ""ilh H. exir,/J$us DNA;!.aue 4 304 bp producl oblained w'lh '''',krocyfos raugMey,DNA: L.me!> 5 10 10. RJ'LP resulls; u.nC'S 5 /lnd 8 8. nstrcne1)ll"lnie s/mwlll9 2 lkmds bolh rvr fltJll und / Ilft'lI, L... le5 G,111(19 8. Cl'ltll)SU.• prvlli/! 5110",lng 1 I><md lor Bg/land 2 b,mds lorHlfell, !Anes 1 and 10: M. roughleyi l)rQflle shvwllIg 1 b<llld

10rl>o1h Hg/I /lnd I-fllt'Il

21. Pis A1llltll Org 54: 209-217, 2003

il cxitioslis. The bootstrap support value lor groupingn. eYlrioSIlS with M. rtmg/lley, was 69 and 10U% lor lheIl Qslreae/B. exiliostls! fo.-I. rolJglIJeJ,j clade (Fig. 7). 11lisclade is lound nesled with.in Ihe Haplosporidia, whichis monophylelic with il suppOrl v,llue of 100%.

DISCUSSION

The Laxonomy of DOl/amia SPI). and MikrocyIO.,; spp,rClIlalns t1ndear, imd their relalionships with other

prolislans arc poorly understood. Imliany, IVI. rot/gll.ley/ W<lS considered to be il distinct genlls tromBOni/llli" on Ihe oasis of gross slgns 01 the diseaseseac:h causes, as.'iociated histologieal lesions and hostspecies affecled (Farley etaI. 1988). Therc is somo evi­dence lhal gross signs and lesions depend on Ihe spc­cies of host, r<tlher 1han the species 01 parasile. B. exi­/iosus in Tiostrea chilellsis in New Zealalld doselyresembles Bonilmiil sp. in Os/reil ilJlgilSi in Auslralia,and the)' milY be conspecific. Il exi/ioslJs only infectshaemocy1es, does nol C<luse gill lesions, ami henvy

69 Microcytes roughleyiBonllm/II e~WosusBonllmill os/re3Hap/osporid/um castilleMinchiniD leredlnlsHap/osporidium ncltroniHaplosporidium louis/enaUrosporid/um crcscensUll<enTII prolundaQPXPhytophlhora megaspermaAch/YII blsDllulllisOchromonlls danTclIFucus distichusSaccharomycll'$ eerevisilltlCand/dJ glllbratJJK/uyverC1nyces/llctisNllurospor<J crassaAjellomycl's capsu/alusPnl'umocys/is cllrinHNUelia f1exlITsChlamydonlOtlaS reinhardlifEm/lisnfa hUltll'yiAcanlhamoeba p,1/es,inensi~

Toltop/i15mll gond;/Sarcocystis honlinisEimer/II IlInol1l1Theilerlll fJJIrvll8abl'sill bov/sSymbiod/nium corculoromGonyau/lIx splnUeroA/exandrium fundYf!ns"Prorocenlrum minimumPfieslerill pisciddllAmphidinium cllrtCfllePerfcinsus nrllrinusPerfcillsus lIt1l1nlicusPerfcillsus chesapael<lTelrahymenll IhermophllilTtllrnhymena pyriformlsPllnlmecium retraurellaOKytrichll lritallalt01t)'lriChD novlIEup/otes crllSSUSEnlodin/um cllud:llVmChondrus crispusDyctiosreliunr discoickwnrPhySllrum poIyeephlllumTrypanosomll cruziEug/rlnll gracmsNaeglerill fowleâGiardill/llmblillV.irimorpha nocalrixEncephlllltozoon cunieuli

~8497

100

100 .....-100 1 100

" 69

..!'- ~86~

100 100

~ 9951

10 100

79100

7878 " ~85~ 98 6792 ~

'-'" 88100

99100

~96 o 100

ÀF

~ "96

FIg. 7. l'"rsimony boolSlr<lll œnscnsus lree gcnCf"le<! lly phylogcncllc anillysls 01 the I\flkrocyl05 roug/lley;:s:su rJ)NA sequencewilh 53 othel represenlillive. liJxonomÎClIlly rli\'m'Se. euk,uyole ~surJ)NAsequences. Boolstrtlp support Y/l1ueslIoove 50 <Ire shown011 Uri/ndles. Anll1ysIs WIlS (jonc wlth 100 bOOlslr<tp replkalCS 01 100 rilmtoru tlddilions and 9i1ps w~re Ife<\tI)d as tnlSlllnu dillil

Cochennec-Lllure.... u et ilL: Mikrocylos foughleyi affiliation to Bcnamia spp. 215

parasite burdens are associated with this disease. Aus­tralian &namia sp. infects gill epithelial cells andhaemocytes. causes gilliesions, and a relatively smallnumber of lhese parasites are capable of causingsevere disease. B. ostreae is intennediate in that ilinfects both haemocytes and epithelial ceUs. il causesgilliesions. but only heavy parasite burdens are 8SS0­cialed with disease (Comps et al. 1980, Pichot et al.1980, Balouel et al. 1983, Montes et al. 1994). Absenceof gilliesions in B. e.ritiosus-infected T. chilensis maybe due to Jack of injection of gill epithelium or to thegreater roDagen conlent of T. chilensis gUis comparedto other Tiostrea species; this in tum mllY be relate<! tothe long larval brooding period of 3 wk between thegUis (Hine 1991. Hine & Wesney 1994a,b).

Ultrllstructural studies showed that Mikrocytosroughleyi presents more similarilies to Bonamlaos/reae and B. eJdtiosus than to its congener M. mack­ini. Particularly notable are the presence of haplo­sporosomes and mitochondria in Bonamla spp. and M.roughleyi, and their absence from M. macklnl (Hine etal. 2oo1a). Diplokaryotic plasmodia were rare in thisstudy, but tetra-nuC!eate plasmodia were observedsimilar to those described in B. ostreae and B. eJdUosus(8rehélin et al. 1982, Hine et aL 2001b). The largemultinudeate stage that OCCUIS in HapJosporidlumspp. and Minchinla spp., and the characteristic sporesof thase genera, were not obseeved.

The lack of concordance between genotypic andphenotypic traits herein is not confined to haplosporid­ians and does not always mean that apparently ultra­structuraUy diverse species may be congeneric. Micro­sporidian parasites of the genus P/e15tophora spp.appear ultrastructurally to be dosely related, althoughthey infect insects and fishes. However, rDNA se­quencing has shown that the Pleistophora spp. infect­ing fishes are polyphyletic, and that Pleistophora spp.in insects are not related to the species in rishes (Nilsenet al. 1998). Ultrastructural characters considered im­portant in microsporidian classification appear to havearisen several times during evolution. Similarly, thehaplosporosomes and haplosporosome-like bodies thatoriginally characterized ascetosporans only are nowknown to occur in paramyxeans and vegetative stagesof a primitive clade of mYI-Ozoans (Anderson et al.1999), and cannot be considered as characteristic ofhaplosporidians ooly.

The preliminary u1trastructural description providedhere was not solfident ta eIuddate relationships ofMikrocytos roughleyi with Bonamla spp. Therefore,the ssu rDNA gene was sequenœd. This gene hasbeen widely used in the taxonomic study of oysterpat.hogens including B. ostreae and B. eJdtiosus andHaplosporidJum spp. (Fong et al. 1993, Ko et al. 1995,Stokes et al. 1995, Flores et al. 1996, Carnegie et al.

2000, Cochennec et al. 2000, Hine et aL 2oo1a). Adlard& lester f1995) proposed a M. roughleyi-diagnosticmethod based on amplification of a segment of theinternai transcribed spacer region (ITS) within theribosomal gene duster IrRNA}. However, altempts tosequence the gene were unsuccessful. The ssu rDNAsequence of M. roughleyi obtained in Ibis studyshowed strong similarity to thase of B. ostreae and B.eJdtiosus, and also to H. nelsoni, H. costale and M.teredJn.is, suggesting that M. roughleyi shares homolo­gies with the phylwn Haplosporidia. These resulls COIl­

fum earlier studies indicating that Bon"mia spp. arerelated to the genus Haplosporidium (Carnegie et al.2000, Cochennec et al. 2000). ln addition, sorne diver­gent reg10ns among the Bonamia spp. and M. rough­Jeyi were evident. This polymorphism was confirmedby RFlP analysis, and allowed a rapid molecular assayfor the discrimination of these 3 parasites. .

This additionalgenomic information, combined withthat on Bonamla ostre"e and B. eJdrJosus, suggests thatBonamla and MiJuocytos roughleyl should be includedin the phylum Haplosporidia. Such results indicate thedilficulty in explaining phenotypic features, indudingthe lack of a known spore stage in Bonamla spp. lIndthe presence of a vacuolated stage in B. exJtiosus (Hineet al. 2001b), but ils apparent lack in B. ostreae andHapJosporidJum spp. Therefore, il is important to carryout further ultrastructural and genetic studies. Particu­larly, there is a need to complete the ssu rDNAsequence to eliminate possible analysis artefacts.5equencing of other genes of phylogenetic interest willtest our hypot.hesis (Baldaol et al. 2000). Such work,using 2 apprOllches, is essential as Il lirsl step towardselucidation of microœU relationships and taxonomy,and one of the benefits of such studies will be thedevelopment of specific identification toois for eachparasite species.

In conclusion, based on our ultrastructural and mole­cular results, we propose a revision of Mikrocytosrougheyi taxonomy, and that M. roughleyi be consid­ered as a putative member of the phylum Hap­losporidia. More molecular Or ultrastructural data areneeded to confidently determine whether M. roughleyishould be placed in the genus Bonamla.

Acjœowledgements. The lIuthon thank Ros Hllnd trom theNew South Wales Fisheries Department for providing MiIcJ'o.cytos roughJeyi-lnfected Saccostrea gJomerat". The tluthorsalso adtnowledge Noelia Carr.uco lor tecbnîcal tl$sistanœ.

UTERATURE CITED

Adlard RD, Lester RJG (t995) Development 01 tl ditlgnostlclest lor MiJcrocytos roughleyi, the lleüological agent ofAustraüan ....mler mortlliity of the commercial rock of$ler,

'" Dis Aquat Org 54: 209-211, 2003

Saccoslrea commerôa/is (Iredale &: Rougllley). J Fish Dis18:609-614

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990)Basic local alignment search tool. J Mol Biol 215:403-4\0

Anderson CL, Canning EU, Okamura B (1999) Molecular dataimplicate bryozoans as hoots for PKX (phylum Myxozoa)and identify a dade of bryozoan parasites within theMyxozO(l. Parasitology 119:555-561

Baldauf SL, Roger AJ, Wenk-Siefertl, Doolillle WF (2000) Akingdom·level phylogeny 01 eukaryotes based on com­bined protein data. Science 290:972-917

Balouel G, Poder M, Cahour A 11983) Haemocytic parasitosis:morphology and pathology of lesions in the French flatoyster, Oslrea edulis L. Aquaculture 34:1-14

Bllnnister C, Key D (1982) Bonamia. a new tnreat to the nativeoyster fishery. Fishes Notes. Ministry of Agriculture, Fish­eries and Food Directorate, Lowestoft

Barber BJ, DllVis C (1994) Prevllience of 80namia ostreae inOs/rea eduIis populations in Maine. J Shelllish Res 13:298-302

Bougrier S, Tigé G, Bachère E, Grizel H (1986) Ostrea angasiaroimlltizlltion to French c()asts. Aquaculture 58:151-154

Bower SM, Hervio D, Meyer GR (1997)lnfectivity of Mikro·cytos mackinj, causative agent of Denman Island disellscin Pacifie oyslers Crassostrea gjgas, to various species 01oysters. Dis Aquat Org 29:111-116

Brehélin M, Bonllffii JR. Cousserans F, Vivarès CP (1982J Exis·tence de lormes plasmodiales vraies chez Bonamia oslreaepllrllsite de l'huître plate Ostrea edulis. C R Hebd SéancesAcad Sei 295:4548

Campalans M, Rojas P, Gonzalez M (2000) Haemocytic para­silosis in the farmed oyster TiTios/rea chiJensis. Bull EurAssac Fish PathoI20:31-33

Carnegie RB, Barber BJ, Culloty SC, Figueras AJ, Distel DL(2000) Development of a PCR assay for detection of theoyster pllthogen 80namia ostl"eae and support for ils indu·sion in the Haplosporidia. Dis Aquat Org 42:199-206

Chagot D, Boulo V, Hervio D, Mialhe E. Mourton C, Grizel H(1992J Interactions between 80namia os/reae (protozoa:Ascetospora) llnd hemocytes of Oslrea edulis and Cras­sostrea gjgas (Mollusca: Bivlllvia): entry mechanisms.J Invertebr Pllthol 59:241-249

Cochennec N, Renault T, Boudry P, Chollet B, Gerard A(1998) Bonamia-like parasite lound in the Sumînoe oysterCrassos/rea rivuJarjs reared in Frllnce. Dis AqUllt Org 34:193-197

Cochennec N, Le Rou::< F, Berthe F, Gerard A (2000) Detection01 80namia ostreae based on smaU suburùt rlbooomaiprobe. J Invertebr Pathol 76:26-32

Comps M, Tigé G, Grizel H (1980] étude ultrastructurale d'unprotiste parllsite de l'huître Ostrea edulis L. C R AClld SOParis 290:383-384

Dinamllni P, Hine PM, Jones JB (1987) Occurrence llnd char.llcteristics of the hllemocyte pllrasite Bonam;a sp. in theNew Zellland dredge oyster Tiostl"ea lU/llria. Dis AquatOrg 3:37-44

Eiston RA. Fadey CA, Kent ML (1986] Occurrence and signif­iCllnce of bonamiasis in European flat oysters OstreaeduIis in North America. Dis AqUllt Org 2:49-54

Farley CA, WoU PH, Elston RA (1988) A long-term study of'microceU' disease in oysters with li description of newgenus Mikrocy/os (g.n.), and two new species, Milcrocytosmackini (sp.n.) and Mjkrocytos rDughleyi {sp. n.J. Fish Bull(Wash OC) 86:581-593

Flores BS, Siddllll ME, Burreson EM (1996) Phylogeny of theHaplosporidill (Eukaryota: Alveolata) based on smail sub·unit ribosomlll RNA gene sequence. J Parasitol 82:616-623

Fong D. Chan MM, Rodriguez R, Chen CC, Liang Y, Little·wood DT, Ford SE (1993) Smllil subunit ribosomlll RNAgene sequence 01 the parllsite protozoan Haplosporjdiannelsoni provides a moleculllr probe for the oysler MSXdisease. Mol Biochem ParasitoI62:139-142

Grizel H (1985) étude des reœntes epi'l:ooties de l'huitre plaIeOstl"ea edulis Linné et de leur impact sur l'ostreicultureBretonne. PhD thesis, Academie de Montpellier, Univer­sité des Sciences et Teclmiques du Languedoc

Grizel H, Comps M, Raguenes D, Leborgne y, Tigé G, MartinAG (1983) Bilan des essais d'acclimatation d'TIostl"eachUensis sur les côtes de Bretagne. Rev Trav Inst Pêchesmarit 46:209-225

Hine PM (1991) Ultrastructural observations on the annualinJection pllttern of 80namia sp. in fiat oysters, TIostreachilensis. Dis Aquat Org 11 :163-171

Hine PM (I996J The ecology 01 80namia and decline ofbivalve molluscs. NZ J EcoI20:109-116

Hine PM, Wesney B (199411] Interaction 01 phagocytosedBonamia sp. (Haplosporidia) with haemocytes of oysters(TIostl"ea chiJensis). Dis Aquat Org 20:219-229

Hine PM. Wesney B (1994b} The functiOOllI qtology 01Bonamia sp. (Haplosporidill] infecting oysters (nos/reachilensis): an ultracytochemical study. Dis Aquat Org 20:207~217.

Hine PM, Bower SM. Meyer GR, Cochennec-Laurellu N,Berthe FCJ (200laj The ultrastructure of Mjkrocy/osmaclcini, the cause 01 Oenman Islllnd disease in oystersCrassostrea spp. and Ostrea spp. in British Columbill,Canada. Dis Aquat Org 45:215-227

Hine PM, Cochennec-Laureau N, Berthe FCJ (2001b).Bonamia exiüosus n. sp. (Haplosporidill) infeeling flat oys­lers Tiostl"ea chilensis in New Zealand. Dis AqUllt Org 47:63-72

Kern FG (1993) ShelUish health inspections of Chilean andAustralilln oysters. J Shellfish Res 12:366

Ko YT, Ford S, Fong 0 (1995) Characterization of the smllUsubunil ribosomlll RNA gene of the oyster parasite Hap­losporidium costale. Mol Mar Biol BiotechnoI4:236-240

Le Borgne Y, Le Pennee M (1983) Elev!lge expérimental del'huitre asilllique Ostrea denseJamellosa {Lischke). VieMar 5:23-28

McArdleJF, McKiernan F, Foley H, Jones OH (1991) The cur~

rent status of Bonamill disease in Ireland. Second Meetingon bonamiosis. IjmlÙden. Spe Iss Bonarniosis. Aqullculture93:273-278

Montes J, Anlldon R, Azevedo C (1994) A possible life cydefor 80nllmill ostl"elle on the basis 01 electron microscopy.J Invertebr PathoI63:1-6

Nilsen F, Enctresen C, Hordvik 1(1998) Molecular phyJogenyof microsporidillOs with particulllr reference to speciesthat infect muscles of fish. J Eukllryol Microbiol 45:535-543

Pascual M, Martin AG, Zamp"tti E, Coatanea D, Defosse'l: J.Robert R (1991) Testing of the Argentina oyster, Os/reapuelchana, in several French oyster fanning sites. IntCOUDC Explor Sea Comm Meet (Shelllish, Benthos Comm)K, 26 Sepl-4 Oct 1991

Pichot y, Comps M, Tigé G. Grizel H, Rabouin MA (1980)Recherches sur Bonamia ostreae gen. n., sp. n., parasitenouveau de l'huître plate Ostl"ea edulis. Rev Trav InstPêches Marit 43: 131-140

PolllOco E, Monles J, Oulon MJ, Melendez MI (1984) Situa­tion pathologique du stock d'huitres plates en Galice enrelation llvec Bonamia ostreae. Haliolis 14:91-95

Quayle DB (1961) Denman Island oyster disease llnd mortal.ity, 1960. Fish Res Board Can Manuscr Rep Ser 713: 1-9

Cochennee'Ulureau et al.: MiJuocytos roughleyi a!liliation to Bonamill spp. 217

--.-- -_. ._-----

Roughley T 119261 An investigation of the UU5e of an oystermort4lity on the Georges River, New South Wales,1924-25. Ploc; Linn Soc NSW 51:446-491

Sambrook J, Fritsch EF, Manilltis T 11989} MoIec:ul1lf cloning:Il IlIbolll'tory DtIInual. Cokl Spring H4J:oor UlbordtoryPl~, Cold Spring H&rbot, NY

Stokes NA. SiddaU ME, BUlTe50D EM 11995} sman subUDit ri­bosomIII RNA geM! sequence of Minchinid teredini5 (Hap­kJsporidia: HllpIo$poridüdaeJ and a specifie ONA probe and

Editorial respolUibility: Albert Spoub,SeaWe. W.uhington.. USA

PCR primen 10ril$detectJon. J Invenebr Pllthol6S:30G-308Swofford DL (2002) PAUP'. Phylogenetic <lOaIysis using par·

simony (" and other methods): version 4. Sinauer As5oci­ates. Sunderland, MA

Thompson JO, ffiggins DG. GibsonTl (t994) CLUSTAl. W: im.proving the sensitivity of progressive multiple sequencealignment tJuough sequence weigbting. po$ition_spe<:ificgap ~tiesand weigbt malri.J: cboice. Nucleic Acids Res22:4673-4680

SubmiUed: MilY 21, 2002; Aocepled: Odober 2 J. 2002Prools received trom IIUtbor(S}: Apri/IO. 2003