558 IEEE SENSORS JOURNAL, VOL. 8, NO. 5, MAY 2008

A Disposable Plastic-Silicon Micro PCR Chip UsingFlexible Printed Circuit Board Protocols and Its

Application to Genomic DNA AmplificationDae-Sik Lee, Se Ho Park, Kwang Hyo Chung, and Hyeon-Bong Pyo

Abstract—This paper describes a novel disposable and portableplastic-silicon polymerase chain reaction (PCR) system usingmicrofabrication technologies for the realization of miniaturizednucleic acid analyses. The system consists of a polyimide-basedfilm microheating system, embedding with a microheater and atemperature sensor made entirely with flexible printed circuitboard (FPCB) process protocols, and a bulk-micromachinedsilicon reaction chamber. Reduction of the thermal mass byemploying a 25 m-thick polyimide film substrate, which haschemical and thermal resistance suitable for photolithographyprocesses, and integration of a temperature sensor as well asa heater on the film facilitates rapid and precise temperaturecontrol. The microfabricated PCR chip demonstrated preciseheat control and rapid thermal response in the chip. In addition,the chip successfully amplified a genomic DNA template (breastcancer suppressor gene, BRCA 1 127 base pairs), extracted fromthe human whole blood containing approximately 100 copies in a3 L-volume chamber within 18 min. Thus, it is applicable to aportable system for precise, fast, efficient and cost-effective nucleicanalysis, and can be utilized with microscale biochemical analysisand sensing systems as well.

Index Terms—Bio-microelectromechanical systems (bio-MEMS), disposable chip, genomic DNA amplification, micro-fluidics, polyimide film -based, polymerase chain reaction (PCR).

I. INTRODUCTION

MINIATURIZATION and the concomitant integrationof biological and biochemical analytic devices using

microfabrication protocols have played crucial roles in theprogress of biochemical analysis, single-cell-based analysis,and in diagnostic fields [1]. The development of a DNAlab-on-a-chip with a high-speed and low reagent volume iscritical for real-time genotyping, and diagnosis; the speed andefficiency of DNA amplification plays an important role inthe chip performance. Microfluidic polymerase chain reaction(PCR) chips, which can amplify DNA and can be integratedinto a fully automated DNA assay chip, are among the mostextensively studied microdevices, thus great progress has

Manuscript received September 2, 2007; revised October 15, 2007; acceptedNovember 23, 2007. This work was supported in part by the Ministry of Infor-mation and Communication (MIC), Korea. The associate editor coordinatingthe review of this paper and approving it for publication was Prof. MichielVellekoop.

The authors are with the BioMEMS Group, Electronics and Telecommunica-tion Research Institute (ETRI), Daejeon 305-350, Korea (e-mail: dslee@etri.re.kr).

Color versions of one or more of the figures in this paper are available onlineat http://ieeexplore.ieee.org.

Digital Object Identifier 10.1109/JSEN.2008.918923

demonstrated in the area of polymer chip fabrication, microflu-idic control schemes, and high degrees of integration [2]–[4].

Various types of micro PCR chips have already been intro-duced thus far. Many of them are made of silicon or glass, andhave well-established fabrication protocols. Recently, polymersubstrates have been employed in many microfluidic platformsdue to their low material and fabrication costs, as well as theirdisposability, ease of microfabrication, and reasonable biocom-patibility, compared with the silicon- or glass-based substrates[4], [5]. Moreover, polymer microfabrication protocols haveprogressed. Although polymer components for PCR chips havebeen reported [5], [6], most of them were for use with fluidic orpackaging parts. In these cases, as heating methods for the reac-tion, externally located heating modules were utilized [7]–[9].Few polymer components for heating substrates integrated withheaters and temperature sensors have been reported, as it istime-consuming to carry out PCR reactions and typically showspoor performance due to the very low thermal conductivity( 0.1 W/mK) and underdevelopment of the process protocols,compared with silicon or glass-based chips [9], [10].

As temperature control in the reaction chamber is significantfor DNA amplification efficiency and analysis speed, the selec-tion of both materials for substrates and chip schemes is veryimportant for the realization of feasible properties in these areas.Temperature control in micro PCR chips can be considered interms of the local temperature precision, responding speed andspatial uniformity in the microchamber [11], [12]. To be oper-ated at microscaled volume on-chip PCR with more enhancedperformance and functionalities, the design and fabrication ofthe microdevices are important. In order to obtain practicallyuseful polymer substrates with integrated heaters and tempera-ture sensors, the choice of polymer materials, the developmentof polymer component fabrication protocols, and a reduction ofthe thermal mass for enhancement of the response speed mustbe considered. As thermal loss through thermal insulating ma-terials such as glass or polymer can generate significant temper-ature variations [11], highly thermal conducting materials at thewall of the reaction chamber would facilitate the temperatureuniformity resulting in enhanced reaction efficiency.

Thus, a novel microfluidic PCR chip consisting of flexiblepolyimide film-based microheating system is developed in thisstudy. It has a thickness of approximately 60 m, and is em-bedded with a microheater and a temperature sensor, as wellas a wet-etched silicon microchamber with high thermal con-ductivity (157 W/mK) for excellent spatial heat uniformity in aPCR. The characteristics of precise heat control, rapid thermal

1530-437X/$25.00 © 2008 IEEE

LEE et al.: A DISPOSABLE PLASTIC-SILICON MICRO PCR CHIP 559

Fig. 1. Schematic view of the PCR chip. (a) Projectional view. (b) Cross-sectional view and its magnified view.

response in the chip and even heat distribution were demon-strated. In the results, the PCR chip successfully amplified agenomic DNA template (breast cancer suppressor gene, BRCA1 127 base pairs), containing nearly 100 gene copies extractedfrom pure human whole blood in a 3 L-volume chamber within18 min.

II. EXPERIMENTAL

Many PCR microdevices are made of silicon or glass.Currently, polymer chips are increasingly used due to the ad-vantages of the polymer materials. Polymer is usually utilizedas a substrate not for heating components but microfluidiccomponents. Recently, polymer-based microfabrication pro-tocols have being developed [4], [13]–[15]. Here, our PCRmicrofluidic chip consists of a polyimide bottom substrate anda silicon top chamber component. A schematic view of thePCR device is shown in Fig. 1.

Heat-resistive polyimide via a simple manufacturing processat a low cost was employed in place of silicon or glass as theheating substrate [16], [17]. It also has good chemical resistanceto semiconductor process solutions, good heat resistance at theglass temperature of approximately 300 C, and good thermalisolation with a thermal conductivity of 0.12 W mK . A25 m-thick polyimide was utilized. It had an average surfaceroughness of nearly 10 nm and a peak-to-valley roughness ofa hundred nm in a m region, as measured usingatomic force microscope (AFM) imagery. The silicon, an ex-cellent thermal conductor with the thermal conductivity of157 W mK , was micromachined with one photomask for amicroreaction chamber. It was expected that most of the heatflux would transfer to the silicon microchamber with a rapidthermal response speed.

A fabrication chart of this process is shown in Fig. 2 [17].In order to fabricate a polyimide bottom component integratedwith a resistive heater, a temperature sensor, and a heat-diffusive

membrane, using flexible printed circuit boarding (FPCB) pro-tocols, a thin film of tin was sputtered to 100 nm on 25 m-thickpolyimide after cleaning and an 8 m-thick copper layer waselectroplated on both sides of the film. A 100 m-thick dryfilm resist was then laminated on, and patterned with two pho-tomasks using a double-sided-aligned mask aligner. Then themetal layers were wet-etched for a heater and a resistive tem-perature device (RTD) with a line-width of 70 m and the samepitch distance on the top side and a heat equalizer on bottomside. The remaining dry film resist was stripped out. An ad-hesive-coated 13 m-thick polyimide was then laminated forthermal and electrical isolation on a top polymer side, with theexception of the electrode pad part. As for pads part, a thin filmof nickel was sputtered to 100 nm and a 0.5 m-thick gold layerwas electroplated.

In order to fabricate a silicon microreaction chamber, double-sided 600 m-thick silicon wafers were utilized. LPCVD sil-icon nitride of 300 nm was then deposited on the top wafer side.For the chamber, a positive photoresist (GA2) was spin-coated,developed, and then etched with a reactive ion etching system.The exposed silicon position was wet-etched using 26 wt.%KOH solution for 360 min at 85 C until approximately 10 mof silicon remained. The remaining silicon nitride layer wasreactively ion-etched. Low temperature 100-nm-thick siliconoxide was then deposited onto the silicon wafer using a PECVDsystem in order to prepare the surface friendly for PCR andto isolate it electrically. A reaction chamber with dimensionsof mm , containing a reaction well with area of

mm and thickness of 10 m at the bottom was uti-lized, and the bottom side of the silicon chamber was attachedto a 60 m-thick polyimide film in which a heater, a tempera-ture sensor, and thin-film metal layer for heat equalization wereintegrated.

Photographs of the microdevices fabricated on the flexiblepolyimide substrate, the metal patterns on the polyimide, thesilicon microchamber, and the resulting plastic-silicon PCRmicrochip are shown in Fig. 3(a)–(d), respectively. To coverthe chamber, a mineral oil was employed due to its ease ofuse and because few bubbles arise within this oil. The utilizedmineral oil is the light oil for molecular biology suitable foroverlaying aqueous reactions (Sigma-Aldrich). In order totransfer the heat of the polyimide heater to the silicon chamberefficiently, a thermal grease oil with high thermal conductivitywas applied on the polyimide film with a small metal plate.To perform on-chip PCR, the heater was thermally cycledwith a LabView-based laboratory-made program using a per-sonal computer with a PI control board, a digital multimeter(HP34401A) for the data acquisition system, and an externalDC power source (HP66312A).

The thermocycling performance in a Si/ polyimide microPCR chip was tested using a human cancer tumor-suppressingDNA sequence (BRCA 1, 127 base pair at the eleventh exon)that had been sampled from Topo vector DNA cloned afterdiluting human blood by 1/30, followed by amplification withprepared primers. Additionally, a genomic DNA of 200 L wasextracted directly from human whole blood using a QIAampDNA blood mini kit. The prepared BRCA 1 gene primers wereas follows: Forward, 5 tgcttgtgaattttctgagacggatg3 ; reverse,

560 IEEE SENSORS JOURNAL, VOL. 8, NO. 5, MAY 2008

Fig. 2. Cross-sectional view of the major process steps in a micro PCR chip showing the structures of microchamber, RTD and heater fabricated on the polyimidefilm using photolithographic protocols: (a) cleaning of Kaptone polyimide layer; (b) tin sputtering and Cu electroplating; (c) dry film lamination; (d) UV exposure(Mask # 1, 2) using a mask aligner; (e) developing; (f) metal etching; (g) dry film stripping; (h) cover layer lamination with adhesive; (i) Ni/Au plating for pads;(j) silicon substrate; (k) silicon nitride deposition and its patterning; (l) wet etching of silicon part and silicon nitride stripping; and (m) oxide deposition in the well.

5 aacagaactaccctgatacttttctgga3 . A 127 bp region of the genewas amplified.

The reaction mixture was prepared in a 100- L stock solutionaccording to the following mixture; PCR buffer 10 L, 2 mMdNTP, 2.5 units of Taq DNA polymerase, 0.1 M of each of thetwo oligonucleotide primers, 15 ng of DNA template, and steriledistilled water. The stock solution was divided into two parts,and then one part was used in the microfluidic PCR chip, whilethe other was utilized in a conventional thermocycler (Bio-Radi-cycler), separately.

The silicon reaction chamber was filled with 3 L of the stocksolutions. Three flushed of the mixture were used to get rid ofany air bubbles that may have been trapped when filling thechamber. The chamber was then sealed using a mineral oil. Thethermocycling conditions were as follows: 95 C for 60 s for theinitial denaturation of the DNA, 30 cycles of 95 C for 5 s, 53 Cfor 5 s, and 73 C for 5 s, followed by 30 s at 73 C for a finalextension. The proper annealing temperature was determined

empirically according to the length and sequence of the primersbeing used.

The remainder of the PCR mixture was utilized in a controlexperiment using a conventional thermocycler. A polymer tubecontaining 15- L of the mixture solution was run on a fast com-mercial thermocycler and cycled using the same temperatures,times, and number of cycles as in the experiments with the mi-crochamber, except for the ramping rates set at the thermocy-cler (1.3 Cs when hitting, and 1 Cs when cooling down).The collected samples were analyzed by running on a 2.5%agarose gel electrophoresis, which is stained with ethidium bro-mide after running.

III. RESULTS AND DISCUSSION

In order to observe the performance of the fabricated PCRchip, the thermal properties of the heating elements on the poly-imide-based film device, including the temperature-consump-tion power and the time response curve, were investigated. Two

LEE et al.: A DISPOSABLE PLASTIC-SILICON MICRO PCR CHIP 561

Fig. 3. Photographs of the fabricated microdevices: (a) a heating system integrated with a heater and a temperature sensor on the flexible PI film; (b) the micropat-terns of components for the heating system; (c) a silicon microchamber; and (d) the polyimide-silicon microfluidic PCR chip fabricated in the form of attachingthe silicon microchamber to the flexible polyimide-based heating system.

copper resistive lines were utilized as a heater and a temper-ature sensor, separately. The copper resistive temperature sen-sors showed linearity between the temperature and resistancefor 20 100 C and an approximate temperature coefficient ofresistance (TCR) of 3000 ppm/K was determined, which wasfit to the Calendar Van-Dusen equation. Using the copper re-sistive lines, the surface temperature of the heating membranewas monitored and fed back for accurate control of the temper-ature. Copper film on the backside of the polymer was utilizedas a heat-equalizing pad when cooling and heating. As severaldegrees of temperature deviation exist between the Si chamberand the RTD on a polymer film, the differences were calibratedbefore thermal-cycling using a Pt wire thermocoupler.

With only resistive heating and passive cooling of thechamber, a low-power consumption of under 1 W, even duringthe denaturation step, is required to elevate the temperature ofthe microchamber, as shown in Fig. 4. This is significant whenapplying the device with a battery-powered handheld system.The much reduced thermal mass of the microfabricated polymerheating film and very high thermal conductivity together com-bined to facilitate fast heating and cooling, even when using apolymer substrate with very low thermal conductivity.

Fig. 4. Temperature versus consumption power curve on the microfluidic PCRchip.

Thermal cycling of the microchip with 3 L of DNA mix-ture fluid is shown in Fig. 5, showing fast heating and coolingemploying an integrated plastic-heating system. In the results, a

562 IEEE SENSORS JOURNAL, VOL. 8, NO. 5, MAY 2008

Fig. 5. Thermal cycling curve of the microchip with 3 �l fluid, showing aheating rate of 6 Ks and a cooling rate of 5 Ks employing an integratedpolyimide-heating system.

heating rate of approximately 6 C/s and a cooling rate of nearly5 C/s were determined during the thermal cycling of the PCR.The 60 m-thick polyimide film with a heat-equalizing pad anda silicon chamber with a 10 m-thick bottom facilitate the fastresponse and spatial heat uniformity.

At first, a human cancer tumor-suppressing DNA sequence(BRCA 1, 127 bps) cloned into a Topo PCR 2.1 vector, cor-responded to approximately DNA copies when calculatedbased on the molecular weight of the template DNA, on theproposed micro PCR chip was amplified through the thermocy-cling. The thermocycling conditions were as follows: 96 C for60 s for the initial denaturation of the DNA, 30 cycles of 96 Cfor 5 s, 53 C for 5 s, and 72 C for 5 s, followed by 30 s at 72 Cfor a final extension, for a total of 18 min. The thermal cyclingconditions were confirmed using the PCR products processed ina rapid commercial thermocylcer (Biorad, i-cycler) with iden-tical temperature conditions of 96 C for 60 s for the initial de-naturation of the DNA, 30 cycles of 96 C for 5 s, 53 C for 5 s,and 72 C for 5 s, followed by 30 s at 72 C for a final extension,for a total of 48 min. Agarose gel electrophoresis photographs ofthe PCR products from the BRCA 1 gene are shown in Fig. 6.Lanes 2 and 3 show the PCR results from the PCR chip anda conventional machine, respectively. Successful amplificationof the vector DNA on the polymer-based micro PCR chip wasdemonstrated in 18 min.

Finally, the human genomic gene, which can be considereda difficult template as it has high sequential and spatial com-plexity, when extracted from human whole blood at very lowamounts, corresponding to 100 DNA copies when calculatedbased on the molecular weight of the template DNA, was ampli-fied in a PCR chip with a polyimide film-based heating system.Electrophoresis gel photographs of the PCR products beforeand after the thermal cyclings are shown in Fig. 7. Lane 2 isa template obtained after extracting directly from human wholeblood, indicating the complexity in length and space, and Lane3 is a template from a mixed stock solution containing the ge-nomic DNA template as a starting solution for the PCR reac-tion. It contains 100 DNA copies when calculated based on themolecular weight of the template DNA. Lane 3 and Lane4 are

Fig. 6. Gel electrophoresis of the PCR products using vector BRCA 1 DNA(Lane 1: 25 bp marker; Lane 2: PCR products amplified in the microchip in18 min; Lane 3: PCR products amplified in a rapid commercial thermocyclerwith the same temperature conditions in 48 min; and Lane 4: a starting mixturestock solution before amplification).

Fig. 7. Gel electrophoresis of the PCR products using genomic DNA (Lane 1:25 bp marker; Lane 2: raw genomic DNA sample extracted directly from humanblood before amplification; Lane 3: a starting mixtured stock solution before am-plification; Lane 4: PCR products amplified in the microchip in 21 min; Lane5: PCR products amplified in the microchip in 18 min; and Lane 6: PCR prod-ucts amplified in a rapid commercial thermocycler with the same temperatureconditions in 48 min).

photographs of the PCR products from the chip PCR. The ther-mocycling conditions for Lane 4 are as follows: 95 C for 60 sfor the initial denaturation of the DNA, 30 cycles of 95 C for7 s, 53 C for 7 s, and 73 C for 7 s, followed by 30 s at 73 Cfor a final extension, and it took about 21 min. The thermocy-cling conditions for Lane 5 were as follows: 95 C for 60 s for

LEE et al.: A DISPOSABLE PLASTIC-SILICON MICRO PCR CHIP 563

the initial denaturation of the DNA, 30 cycles of 95 C for 5 s,53 C for 5 s, and 73 C for 5 s, followed by 30 s at 73 C for afinal extension, and it took 18 min totally. The thermal cyclingconditions were confirmed using the PCR products performedin a rapid commercial thermocylcer (Biorad, i-cycler) as shownin Lane 6 with identical temperature conditions of 95 C for 60 sfor the initial denaturation of the DNA, 30 cycles of 95 C for5 s, 53 C for 5 s, and 73 C for 5 s, followed by 30 s at 73 C fora final extension, and it took approximately 48 min totally. Al-though the polymer film containing the heater and sensor hasvery low thermal conductivity, it is believed that the preciseand rapid temperature control is possible due to use of boththe silicon chamber with very high thermal conductivity andthe heat-equalizing metal film beneath the polymer device. Thefigure shows the good DNA amplification results in microchipssimilar to machine PCR results. The resulting amplification timewas reduced by approximately 2–3 times without cooling unitscompared with those using commercial instruments.

IV. CONCLUSION

A novel polyimide film-based microheating system, in-tegrated with a microheater, a temperature sensor, and aheat-equalizing film is proposed. It was applied to a PCRsystem combined with a silicon reaction chamber for genomicDNA amplification. The microfluidic PCR system demonstratedprecise heat control with the integrated heater and temperaturesensor, with only a passive cooling scheme, and showed a rapidthermal response, as evidenced by heating and cooling ratesin the range of 5–6 C/s, which were experimentally achievedin the chip. Moreover, the chip successfully amplified a ge-nomic DNA template (breast cancer suppressor gene, BRCA1 127 base pairs), extracted from human whole blood, in a3 L-volume chamber within 18 min after 30 thermal cyclingtrials. The reduced thermal mass of the polyimide film andvery high thermal conductivity of the silicon chamber togethercombined to facilitate fast heating and cooling, even whenusing a polymer substrate with very low thermal conductivity.The embedding of a temperature sensor and a heat-equalizingmetal film in the polyimide substrate is also served to controlthe chamber temperature precisely and evenly, resulting in suc-cessful genomic DNA amplification. The polyimide film-basedmicro PCR chip is applicable to a lab-on-a-chip for cost-effec-tive, precise, fast, and efficient DNA analyses, including thoseinvolved with biochemical/biomedical applications.

REFERENCES

[1] P. S. Dittrich, K. Tachikawa, and A. Manz, “Micro total analysissystems. Latest advancements and trends,” Anal. Chem., vol. 78, pp.3887–3907, Jun. 2006.

[2] M. G. Roper, C. J. Easley, and J. P. Landers, “Advances in polymerasechain reaction on microfluidic chips,” Anal. Chem., vol. 77, pp.3887–3894, Jun. 2005.

[3] P.-A. Auroux, Y. Koc, A. deMello, A. Manz, and P. J. R. Day, “Minia-turized nucleic acid analysis,” Lab Chip., vol. 4, pp. 534–546, Oct.2004.

[4] C. Zhang, J. Xu, W. Ma, and W. Zheng, “PCR microfluidic devices forDNA amplification,” Biotechnol, Adv., vol. 24, pp. 243–284, Jun. 2006.

[5] Y. Sun and Y. C. Kwok, “Polymeric microfluidic system for DNA anal-ysis,” Anal. Chim. Acta., vol. 556, pp. 80–96, Sep. 2006.

[6] D. Lee, S. Park, K. Chung, H. Yang, T. Yoon, S. Kim, K. Kim, and Y.Kim, “Bulk-micromachined submicroliter-volume PCR chip with veryrapid thermal response and low power consumption,” Lab Chip, vol. 4,pp. 401–407, Jul. 2004.

[7] B. C. Giordano, J. Ferrance, S. Swedberg, A. F. R. Huhmer, and J. P.Landers, “Polymerase chain reaction in polymeric microchips: DNAamplification in less than 240 seconds,” Anal. Biochem., vol. 291, pp.124–132, Feb. 2001.

[8] J. Yang, Y. Liu, C. Rauch, R. Stevens, R. Liu, R. Lenigk, and P.Grodzinski, “High sensitivity PCR assay in plastic micro reactors,”Lab Chip., vol. 2, pp. 179–187, Nov. 2002.

[9] R. H. Liu, J. Yang, R. Lenigk, J. Bonanno, and P. Grodzinski, “Self-contained, fully integrated biochip for sample preparation, polymerasechain reaction amaplification, and DNA microarray detection,” Anal.Chem., vol. 76, pp. 1824–1831, Apr. 2004.

[10] J. El-Ali, I. R. Perch-Nielsen, C. R. Poulsen, D. D. Bang, P.Telleman, and A. Wolff, “Simulation and experimental validation ofa SU-8 based PCR thermocycler chip with integrated heaters andtemperature sensor,” Sens. Actuators A—Phys., vol. 110, pp. 3–10,Jan. 2004.

[11] D. Braun, N. L. Goddard, and A. Libchaber, “Exponential DNA repli-cation by laminar convection,” Mod. Phys. Rev. Lett., vol. 91, no. 15,pp. 158103-1–158103-4, Oct. 2003.

[12] J. Singh and M. Ekaputri, “PCR thermal management in an integratedLab on chip,” J. Phys.—Conf. Series, vol. 34, pp. 222–227, 2006.

[13] H. Becker and L. E. Locascio, “Polymer microfluidic devices,” Talanta,vol. 56, pp. 267–287, Feb. 2002.

[14] D. Lee, H. Yang, K. Chung, and H. Pyo, “Wafer-scale fabricationof polymer-based microdevices via injection molding and pho-tolithographic micropatterning protocols,” Anal. Chem., vol. 77, pp.5414–5420, Aug. 2005.

[15] M. Yu, M. Fico, S. Kothari, Z. Ouyang, and W. J. Chappell, “Polymer-based ion trap chemical sensor,” IEEE Sens. J., vol. 6, pp. 1429–1434,Dec. 2006.

[16] J. S. Han, Z. Tan, K. Sato, and M. Shikida, “Thermal characteriza-tion of micro heater arrays on a polyimide film substrate for fingerprintsensing applications,” J. Micromech. Microeng., vol. 15, pp. 282–289,Jan. 2005.

[17] D. Lee, S. Park, K. Chung, and H. Pyo, “Plastic-silicon PCR amplifica-tion system made using microfabrication technologies,” in Proc. IEEESensors’06, Oct. 2006, pp. 592–595.

Dae-Sik Lee received the B.Eng., M.Eng., and Ph.D.degrees from Kyungpook National University, Taegu,Korea, in 1995, 1997, and 2000, respectively.

Since 2000, he has been a Senior Researcher withthe BioMEMS team in the IT-BT group, Basic Re-search Laboratory, Electronics and Telecommunica-tion Research Institute (ETRI), Daejeon, Korea. Hiscurrent research interests are bio-MEMS, lab-on-a-chips, and biochip instrumentations.

Se Ho Park received the B.Sc. degree in microbi-ology from HanKook University of Foreign Study,Yongin, Korea, in 1995 and the M.Sc degree inmicrobiology from Seoul National University,Seoul, Korea, in 1997. He is working towards thePh.D. degree at the Department of Life Science,GwangJu Institute of Science and Technology(GIST), GwangJu, Korea.

Since 1997, he worked as a researcher for abiotech company and a governmental researchinstitute (ETRI-Electronics and Telecommunications

Research Institute). His major research interests include DNA or proteinbiosensors and bioconjugation for drug delivery.

564 IEEE SENSORS JOURNAL, VOL. 8, NO. 5, MAY 2008

Kwang Hyo Chung received the M.S. and Ph.D.degrees in mechanical engineering with a special-ization in thermofluidic engineering from the KoreaAdvanced Institute of Science and Technology(KAIST), Daejeon, Korea, in 1997, and 2002,respectively.

From 2002, he has been working as a ResearchEngineer at Electronics and Telecommunications Re-search Institute (ETRI), Daejeon, Korea, where heis responsible for the design and fabrication of mi-crofluidic systems and bio-MEMS.

Hyeon-Bong Pyo received the Dr. rer. nat. from theUniversität Hamburg, Hamburg, Germany, in 1995.

He is currently a Research Scientist at the Elec-tronics and Telecommunications Research Institute(ETRI), Daejeon, Korea. His major research in-terests include surface plasmon resonance (SPR)sensor, localized SPR, plasmon-enhanced fluores-cence, surface-enhanced Raman scattering (SERS),nanophotonics, chemical and biological sensorsbased on plasmonics.