(12) Patent Application Publication (10) Pub. No.: US 2010 ...

(19) United States US 20100135970A1

(12) Patent Application Publication (10) Pub. No.: US 2010/0135970 A1 Kishore et al. (43) Pub. Date: Jun. 3, 2010

(54) METHODS FOR REPROGRAMMING ADULT (86). PCT No.: PCT/US07/22716 SOMATIC CELLS AND USES THEREOF

S371 (c)(1), (2), (4) Date: Jan. 6, 2010

(75) Inventors: Raj Kishore, Chicago, IL (US); Douglas W. Losordo, Chicago, IL (US)

Correspondence Address: EDWARDS ANGELL PALMER & DODGE LLP P.O. BOX SS874 BOSTON, MA 02205 (US)

(73) Assignee: Caritas St. Elizabeth Medical Center of Boston, In, Boston, MA (US)

(21) Appl. No.: 12/447,091

(22) PCT Filed: Oct. 26, 2007

Related U.S. Application Data (60) Provisional application No. 60/854,946, filed on Oct.

27, 2006, provisional application No. 60/922,221, filed on Apr. 6, 2007.

Publication Classification

(51) Int. Cl. A6II 35/12 (2006.01) CI2N 5/00 (2006.01) CI2N 5/071 (2010.01) CI2N 5/079 (2010.01) A6IP 9/00 (2006.01)

(52) U.S. Cl. ...................... 424/93.21: 435/375; 435/366: 435/371; 435/368

(57) ABSTRACT

As described below, the present invention features methods for reprogramming Somatic cells and related therapeutic compositions and methods.

Patent Application Publication Jun. 3, 2010 Sheet 1 of 27 US 2010/0135970 A1

Figure 1

reas.

t 3T3


T p<0.001

3T3/D3 +

Nanog SCF SSEA1 Oct-4 c-Kit

B Oct4 DAPI Merge C Lamin B Lamin A/C

Figure 2


Figure 3

A 3T3/D3. 3T3 ge Ston

S; for ATG U D s - Til I L III 1 - s 3 :

OOOOOO 3T3/D3 OOOOOO OOOO D3

1: 1. O diMeK9H3 p-0.01

0.5 D3 grg grips


- Apoptosis

2 linkaown 3 Catalytic activity 4. Cell cycle " 5 Ce differentation 6 Ce growth 7 Cell proliferation 8 Chronatin architecture 9 Cytoskeleton 10 development

intracellular 12 Kinase activity 13 Metabolis 14 Methyltransferase activity 5 Nucleic acid binding 6 Physiological process 7 Protein modification

18 Regin of transcription 9 Sigma transduction 2O Other

Figure 4

Patent Application Publication

ProbeSeid 1415671 at 1424.263 at 1419883 sat 1416831 at 1437835 a.at 1455930 at 1415900 a. at 1436050 xat 1423424 at 1418528s at 1430355 a at 1423468 at 1424740 at 1424741 sat 1449875 at 1415928 a at 1415929 at 1453960s at 1428942 at 1417108 at 1418999 at 1424.728 at 1422478 at 1439030 at 14199798 at 1448.905 at 1431385a at 1423495 at 1456377 at 1417071s at 1416988aat 1423075 at 1448200 at 1416274 at 1418371 at 1452148 at 1426894 sat 14266.97a at 1451204 at 1452770 at 1426313 at 1417945 at 14245.23 at 1415907 at 1450899 at 1450955 sat 1418331 at 1448,308 at 144973 sat 1420088 at 1449378 at 1418607 at 1454288.aat 1416948a at 1458011.x at 1422468 at 141598 at 1424828 a at 1454798 at 1425344 at 1451678 at 1417492 at 1448754 at 1418133 at 1422587 at 1418072 at 1436928 at 1428083 a at 1426893 at 142358 sal 1448415a at 1418298 at 1448291 at 1450117 at 1431843 a at 1421014a at 1423382 at 1417491 at 1416552 at 1427143 at 14481.94 a at 1424295 at

Figure 4D

Jun. 3, 2010 Sheet 5 of 27

Table S2: List of top 500 upregulated transcripts in 3T3ID3 cells compared to 3T3 control cells Gene Name Gene Symbol 3T3 3. 3T3D3 ATPase, H+ transporting lysosomalVO subunit d1 Atp6vod1 162976 0.453855 04.10837 REKEN cDNA281OCO3C17 gene 28.10003C17Rik -1.81876.4 c.68.515 .31265 ATPase, hi-transporting lysosomal visubunit 82 Atp6v1b2 1,604492 0.51814. O390943 neurarninidase 1 Neu1 -1584531 0.73962 0.1012.7 RIKEN conAC81001114 gene oS10011L14Rik -1557373 0.534594 0.151962 NA NA -1.352579 1,124597 0.298021 kit oncogene Kit 1.543067 0.126327 0974888 hairy and enhancer of split 8 (Drosophila) Hess 1.585937 0.349842 0.819942 zinc finger protein of the cerebellum 3 Zag 1.552143 0.18O344 0.9882S2 defender against cell death 1 Dad -1.568911 0.294.806 0.97d122 STEAP family member 3 Steap3 -1.564337 0.1742 0.967704 STEAP family member 3 Steap3 1589559 0,265,783 0.854ss cAMP responsive element binding protein 3 Creb3 -157605 0.47815 0.92484 cAMP responsiye element binding protein 3 Ceb3 1,523.377 0.37474 1028117 histocompatibility 2, Tregion locus 10 - H2-10 -1.494,518 0.298096 1.18479 microtubule-associated protein 1 light chain 3beta Maplc3b -1.524893 0.273453 1.080183 microtubule-associated protein 1ght chain 3beta Mapic3b -1.500.478 0.354.184 .077673 capping protein (actinfilament) muscle 2-line, beta Capab -1.5.125 0.413287 1.036093 metallothionein 2 M2 -1439845 0.14990 1.55214 kinesin light chain 4 Kica. 1484.09 0.722988 0.8553 sphingomyelin phosphodesterase 2, neutral Smpd2 -1.505627 O656852 0.888221 cDNA sequence BC014685 Co14685 1.561071 0515356 ob42267 interferon gamma inducible protein 30 30 -1.546,204 0.081258 0.780851 GDP-mannose pyrophosphorylase B Gmppb -1556.234 0.199948 0.829876 cAMP responsive element binding protein 3 Cab3 -1.566O2 0.465138 0.816714 expressed in non-metastatic cells 3 Ne3 1600638 0.4943 0.628.192 membrane-bound transcription factorpeptidase, site 1 Mbps1 -1.445783 0480495 0.942848 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal Dect2 -1490,965 O.8S141 0.690283 LM domain containing 2 Limd2 -1.45107 1.034751 0.488915 cytochrome P450, family 4, subfamily v, polypeptide 3 Cyp4v3 1.456028 0.90923 0.672373 hydroxy-delta-5-steroid dehydrogenase sd37 -158894 0.856816 0,581,047 lectin, mannose-binding 2 traf2 -15522 D.85316 0.642.57 transcobalanin 2 cr2 -1.511823 1.022118 0.542834 cystrosis, nephropathic Crs -1581301 0.85618 d.43304 apolipoproteind Apod 1.016079 0.381903 .37824 low density lipoprotein receptor-related protein pap -0.99632 O.243195 .43288 RIKEN cDNAC230093N12 gene C23093N12Rik -1.114217 0.258263 1.4098.72 low density lipoprotein receptor-related protein associated protein pap1 -1069265 0,148875 .456554 scavenger receptor dass A member 5 (putative) Scaras -1.13164 0.391027 .32859 vitamin Kepoxide reductase complax, subunit 1 Wkorc1 -1.255102 0.316583 1.332877 brain and reproductive organ-expressed protein Bre -1.107135 0504713 1276836 POU domain, dass 5 transcription factor 1 Pau51 -1, 18353 0.446949 1.224.064 engulfment and cell motifty 1, ced-12 homolog(C. elegans) no1 1,152149 0,149253 .372615 cyclin D3 Conds -1298853 0.18036 1.30.1122 selendum binding protein 1 Selenbpt -1.77672 0.813341 ogsstas sort 1 Sort1 -1.104919 0.548949 1.185984 RIKEN conA 1110031102 gene 11032Rik -1.325,708 O667282 1.05798 nuclear factor of kappa tight chain gene enhancer inhibitor, alpha N?kbla 129168 0604803 1.14913 nuclear factor of kappa tight chaingena enhancer Inhibitor, alpha Nikbia .1.367385 0.78089 0.9996.1 nuclear factor of kappa ?ight chain gene enhancer inhibitor, alpha N?kbia ...285525 0.78156 0.990431 col1 Mich -1445729 0.697605 0,98529

zinc finger protein 99 Zip89 -435552 0.686828 0.981061 cytochrome b-245, alpha polypeptide Cyta -1481337 0541988 0.987687 acetyl-Coenzyme A acyltransferase 1A Acaata -1.3595 0.5988 1.993.4 acetyl-Coenzyme A acyltransferase 1A Acaa1a -1.484.976 O,53722 1.015616 ?tudeoredoxin Nxn 1.421853 0.634658 0.99.3976 integral membrane protein2C 2c -1,384.437 O,358988 121432 RIKEN conA 1500032D6 gene 1500032D16Rik -1.4O7815 0.414273 1.192099 DNA segment Chr5, ERATOdo 40, expressed D5E?td4e -1.37.1054 0.522976. 1086562 nuclear prelamin A recognition factor Narf -13075 0635752 1.0846ss rudear prelamin A recognition factor Naff -1.742.22 0.534074 1.204938 cathepsine Csb -1.246996 066604S 1.10957 retino binding protein 1, cellular Rbp1 -1.265381 0.703122 1116968 B-cell leukemialymphoma 3 B3 -1.190222 0.640188 1.130013 transmembrane protein 45a Therasa 0.963787 0.827219 1026425 histone 1,2bc Hist2tic -1.207227 0.824151 0.933697 estrogen related receptor, beta Est -0.879541 0.506995 1242336 GTPbinding protein gene overexpressed in skeletal muscle) Gern -0.97B788 0.379988 1.295061 RIKEN conAC2300g3N2 gene C2300.93N2Rik 0.96153 0.261598 1.3223 nidogen 2 Nd2 -0,898.182 1,058669 0.844988 serra domain, inmunoglobulin domain (g) Sema3b 1.00994 0.93176 O.95735 matrix metallopeptidase 9 Mmp9 -0.91186 0.82O37 .04177 matrix metallopeptidase 9 Mmpe. -0,804922 0.851608 O.999814 transcription factor 3 tes 0.875901 0,863.046 0.994474 modear factor kappa light polypeptide enhancer inhibitor, epsilon Nifkbie -1.11062 1.12638 0.708442 citrate-lyase beta Eke Clybil -1.188708 0.89.8875 0.950s83 softn 1 Sort -0,990.871 0.7068 1.14819 cathepsin B Clso 0.793.348 1.091449 0.73836s developmental pluripotency-associated 5 Dppa5 -0.72686S 1.461272 0.22751 Jumonji, ATrich interactive domain 1B (Rbp2 Ike) Jardb -0.824449 1.4761 - 0.213182 H19 fetaliver RNA H19 , 0.807701 1.523269 0.096924 development pluripotency-associated Dppa3 -0,908346 1.456863 0.227.305

US 2010/0135970 A1

1.650737488 1,405241488 1.370762651 158578522

1.3424,2689 1.494.882903 1.944597-365 1.39527893 . 1427507261 1.352098.276 2.418127374 1852353743 1.4859.08898 4276.09376 1.70672.9127 1.4828048.25 1661897909 1.352932583 1.362365.119 1.341283.975 336780244

1.64S160563 1,445137138 .332O3012S 1.59088061 1.28372.2825 222 1951818 14888.20139 1,322,78103 1422429394 1.34202350.9 1.2939.93758 2.871030,385 1.329069586 3.338,3043S4 177569.432 B7657975

1468178918 29.1975.9889 1918.299591 1.3994.72887 18300SO192 13852654.06 1.307752716 1.535.727892 1315109634 1,576251172 1.428132944 1.444194806 .351927922 156394,719

146443.2386 352,202855

1349SO68 1.309055462 1565,345.505 1982955419 15746,71592 1511515244 1898570587 1.636516401 182897 1323 1.630753927 1.47946705

185216095 1.79897335 1.378797997 1350941458 1.58739345

4.331938S4 2.2628869 20594,22757 1.9269165

1890.95142 1.397822.01 1.372.786419 i.782533049 15089.52218 1.816524285 1.4654.02565 25296908

1.671669853


Figure 4D (cont)

1418434 at 1429388 at 14242208 at 1449231 at 1421924 at 1449288 at 1416188 at 1416547 at 1418345 at 1432143 sat 1449732 at 1450180 at 1437874s at 1417963 at 1453559a at 1449028 at 1430421a at 1450828 a at 1424010 at 14256S8aat 1451148 at 1449304 at 1460634 at 1449.027 at 1422527 at 142O150 at 1437406 at 1437405 a at 1423756s at 1426238 at 1421992 a at 1423757 at 1455965 at 1451132 at 1450208aat 1448747 at 1426288 at 1452141a at 1421288 at 141798da at 141750Ca at 1419782 at 1425580aat 1425840 a. at 1420508 at 1456005 a at 1435449 at 1435448 at 14165gs at 1433428 xat 1437277 xat 1455900 xat 141845 at 141775s a at 1448908 at 1415935 at 1426155 a at 1418000 a. at 1439060s at 1460295s at 1418511 at 1448792a at 1418601 at 141B488 at 1423817s at 1451130 at 1416889 at 1427058 at 1425444 a at 1415931 at 1417789.st 1419100 at 1434379 at 1451691 at 1422926 at 1434378aat 1450784 at 1422208 a at 1416322 at 1449D82 at 1449398 at 1423865 at 1418448 at 1416418 x at

makorin, ring fingerprotein, 1 nanog porcupine homolog(Drosophila) iduronidase, alpha-l- solute carrier family 2 (glucose transportermember 3 retrin G GM2 gangioside activator protein branched chain ketoacid dehydrogenase E1, alpha polypeptide tumor necrosis factor (?igand) superfamily, member 13 high mobility group box transcription factor 1 zinc fingerproliferation 1 hexosamidase 8 hexosarinidase B phospholipid transfer protein Se1 (suppressor of in-12) 1 homolog(C. elegans) rashomologgere family, memberu cDNA sequence BC010787 serum amyloid A3 microfibrillar-associated protein 4 ST3beta-galacoside alpha-23-stalyltransferase 4 PTEN induced putative kinase 1 RIKEN cDNA 2310061JO3 gene raguanine nucleotide dissociation stimulator ras homologgene family, member U histocompatibility 2, dass, locus DMa spAryanodine receptor domain and SOCS box containing insulin-like growth factor binding protein 4 insulin-like growth factor binding protein 4 insulin-like growth factor binding protein 4 bone morphogenetic protein 1 insulin-like growth factor binding protein 4 insulin-like growth factor binding protein 4 a disintegrin-like andmeadopeptidase, thrortbospondin type 1 pre-B-celleukemia transcription factorinteracting protein 1 engulfment and cell motility 1, ced-12 homolog(C. elegans) F-box only protein 32 low density lipoprotein receptor-related protein 4 selenoprotein P, plasma, 1 UDP-glucose ceramide glucosyltransferase insuffin Induced gene2 transglutaminase 2, Cpolypeptide ubiquitind S100 calcium binding protein A18 sema domain, immunoglobulin domain (g), (semaphorin)3F sema domain, immunoglobulin domain (g), (semaphorin)3F BCL2-like 11 (apoptosis facilitator) BCL2-like 11 (apoptosis facilitator BCL2-like 11 (apoptosis factitator GLIS family zinc finger2 transglutaminase 2, Cpolypeptide transglutaminase 2, Cpolypeptide transglutaminase 2, Cpolypeptide Emrunoglobulin superfamily containing leucine-rich repeat lymphocyte specific 1 phosphatidic acid phosphatase type 28 SPARC related modular calcium binding 2 odd-skipped related 2 (Drosophila) integral membrane protein2B Wd repeat domain, phosphoinositide interacting 1 interleukin 6 signal transducer derinatopontin cytochrome P450, family 2, subfamily f, polypeptide 2 aldehyde dehydrogenase fally 1, subfamily A7 aldehyde dehydrogenase family 1, subfamily A1 RIKEN cDNA 201031.5L10 gene RIKEN cDNA 201031510 gene troponin, skeletal, fast 2 a disintegrin-like and metallopeptidase, thrombospondin type 1 transforming growth factor, beta receptor insulin-like growth factor 2 Small chemokine (C-C motif) ligand 11 serine (or cysteine) peptidase inhibitor, dade A member 3N Max dimertzation protein 4 endothelin receptor type A melanocortin2 recaptor Max dimerization protein 4 reversion-inducing-cysteine-rich protein with kaza motifs guanine nudeotide binding protein, beta 5 proline arginitie-rich end leucine-rich repeat microfibrillar associated proteins amine oxidase, copper containing 3 solute carrier family 44, member 1 Harvey rat sarcoma oncogene, subgroup R glutathlone S-transferase, mu

Mkn Nanog Poch 2p296 Sca G3 Gm2a Beckha Tnsf13 Hbp1 Zipro Hedb Hext Pip Seth Rho ecca Saa3 Mfap4 St3gal4 Pink1 2310D6103Rik Ralgds Rhou H2OMa Spsb1 tgfbpa gfbpa gfbpa Bmp1 lg?tp4 lgfbpa Adamtsa Pixip

r Foxes2 up4 Sepp1 Ugog insig2 Tgm2 Ub Soa18 Seaf Seakf B211 B211. B211 Gis? tgm2 Tgm2 Tgm2 s sp Ppap2b Smoc2 Ost2 tn2b Wipi 6st opt

Adha 201315-10Rik 201315L1OREk Tnr2 Adants 15 Tg?b2

C11 Serpinasm Mixd4 Edira Mc2

Reck

Prelp Mfap5

Ras Gstm

-0923722 .5687.2 0.93918 1581533

-0.951388 1.5og349 -1.026082 39S472 0.835883 1.40748 -1030658 127910s .132.105.7 1217627 -1215282 1.355193 -1.28.29s. 1.211682 1.195878 1.194853 1.09834 129985 1.27576 1.415.458 1267.42 1.405428 1,304901 1375.583 134195 78.933 -0808147 ozs4.293 0.933955 0.42835 0.730772 0.23247 -0.64309 -0.322569 0.755868 -0.323,255 0.876774 -0.246438 0.76761 -0.396768

0.741861 O.259,387 -0,875763 -0.373964 0.813421 .33319 0.555.734 -o,424774 0.5795.03 -0.309891 0.700792 0.261464 -0.592532 -0.419254 0.777813 -0.274445 -0.648312 -0.581449 -0.60639 -0.46513 0.606803 -0.62578 -0.790961 -bogas 0.67.0137 -31967 0.671708 -os.1768 0.565557 -0, 18542 0.389.51 .244.454 -0.50391 -0.181673

-0.339862 -O2S2585 0.937269 .18557 -0.8057 0.1350.08 0.933.371 0.341409 0.505177 O.114371 -0,554.12 0.1051.45 0.74.7874 .21307 -0.68.0076 O204747 -0.644852 0.189365 O6s1324 odo?95 O91s5 o202288 -0.874715 0.284.297 0.827129 0.12221 -0.383644 -0.678222 0.420957 O.S39234 0.315817.598197 -0.231822 -0.765952 0.440,567 -0.571676 -0.522684 -0.567O6 -0.464.301 -0.530012 0.451502 0.71958 -0.569629 -0.519884 0.504.872 -0.63S744 0.536507-08707.43 -0.508,187 -0.533.63 0.618906 -0.523019 0,588.58s. 661738 -0,562553 -0.59652 -0672757 -0.514532 -0.694872 -0.531688 -0.668129 0.5576SS 0.537544 0.5897.45 0.4345.33 -0.811237 -0.385455 0.739439 o,311192 .535

-0.40.1007 -0.708762 0.465.617 -o,689536 -O.302635 -0.753177 0.325.394 -0.833023 0.402716 los2755 0.411299 -0.940114 0.424742 -0.86635 0.261646 -).949.442 -0,2884.51 -1577 0.3550830,957532

Jun. 3, 2010 Sheet 6 of 27

-0.0305.02 0.17355 0.083289 0.237784 0.367.35 0,521471 0.382.28S 0.308248 0.535949 0.56528S 0.444093 0,034599 0.004077 -0.6024 0.4146.79 1572.78 1.53017 1610,299 1.603599 1.694.99 1605,781 161757 1,617444 1,632678 1583855 1583.789 1.58527 157031 1591765 1571278 16081.63 1.618579 1.616565 15.34924 1.59387 555193

1505282 1553077 1526962 1557878 1.453098 1,450899

1.3629 1556918 1.478242 1.498883 146365 1.459762 1.502502 1.460655 1.427.445 1.501691 1.640976 1,637.913 1630722 1596914 1,647687 1.84303

1.632569 1.63307

1.647881 1651258 1641988 163.1909 1624222 1635054 1645722 1.89483 1.641493 1.S10993 163507 1.612006 1.82129 1590283 1,617764 1.634983 1.603394 1,60923.3 1.62396

15745.08 1582231 1582209 562747

1571674

US 2010/0135970 A1

1.403.395.264 1.3O84SO793 1445425022 1480519049 1321020334 20938.28838 1.559180425 21135129 2,48425595 1.385.453553 1.444481256 1.704502086 1.525300186 1.390769041 1.333,293.317 .628.26547

1.479.31972 3.610485942 2419684263 2,045281748 .8779285.43 1,485254044 207,280316.3 .50938653.3 1,3335.7394 37143482

1607.08.2231 1523.004749 1.933538724 1288865858 24S41953.27 2300182021 237,2239249 12934.13852

576565 13849.3492 1386236587 2.4629248 1297.278266 1.3049.99206 1.769S4757 1.509148811 1814235668 195874102 1363549456 22.30904817 1913983771 1.93S444516 1.35087.1209 2016398,585 2016182184 1.919.640391 4.589386S65 287.3304061 1.567702651 1562650793 4.402839905 1553,55099

1.420044249 2135798539 4.882620367 3,524.453323 2.686018137 3.059265287 1.338804181 1316.064614 1998145455 2.871168159 2.842133746 2.38737779 2.184228724 1,78621854

1.6920.31435 2,61541686 2221123681 207834915 1.889856149 1,544.353428 2764424252 2333O3998 197784,441 47B48716 282047171

1396.872487


Figure 4D (cont.)

1448330 at glutatione S-transferase, in 1 Gstm 1425627 at glutathlone S-transferase, mL 1 Gst1 1416507 at transmembrane protein 4 mera 144855 at lipopolysaccharide binding protein bp 1423590 at rapsin A aspartic peptidase Napsa 142628 at expressed sequence AW24952 AW2491s2 142497a at Wild repeat domain, phosphoinositidetriteracting Wipit 1418858 at aldehyde oxidase 3 Acxs 1450767 at neural precursor celepressed, developmentally down-regulatedge Nedd9 1423508 at periostir, osteoblast specific factor Post 1421918 at platelet derived growth factor receptor, alpha polypeptide Pdgfra 1426388 at Ras and Rariteractor 2 rina 1424808 at laminin, alpha 4 ama 1429.076 aat glycerophosphodiesterphosphodiesterase domain containing 2 Gdpd2 1421239 at interteukin 6 signal transducer sist 1450923 at transforming growth factor, beta2 Tgfb2 1438738 at DNA segment, human D4S114 DOES114 1450839 at DNA segmart, human D4S114 4S114 1427884 at procollagen, type I, alpha1 Co3a1 1452843 at interleukin 6 signal transducer 6st 1426397 at transforming growth factor, beta receptor Tg?br2 1449388 at decorn Oc 1423954 at complement component3 c3 1418321s at proline arginine-rich end leucine-rich repeat Prep 141799 at integral membrane protein 2B tra 1429514 at phosphatidic acid phosphatase type 28 Ppap2b 1415832 at angiotensin receptor, type 2 Ag2 1480694 at supervin Sw 1424807 at laminin, alpha 4 ama 1436994a at histone 1, H1c Hist11: 1416101a a histona 1, H1c Histhic 1451238 at rAS-like, estrogen-regulated, growth-inhibitor Rerg 1449.038 at hydroxysteroid 11-beta dehydrogenase 1 Hs 11 142357 at endothelial differentiation sphingolipid G-proteincoupled receptor 1 edg 1428778 at solute carrier family 10, members Scais 1435375 a cDNA sequencebCO52328 BCO52328 1423250a at transforming growth factor, beta2 Tgb2 142977 at glycoprotelnib, bets polypeptide Gp1bb 1419040 at cytochrome P450, family 2, subfamily d, polypeptide 22 Cyp2d22 1428221 at loss of heterozygosity chromosomal region 2, homolog(human) her?a 1437689 at clustern Cu 1418628 a.at clustern Clu 1454849x at clustern Cl 14278838 at procollagen, type, alpha 1 Co3a 1421917 at platelet derived growth factor receptor, alpha polypeptide Pagfa 141641 at glutathione S-transferase, Tu2 Gsts 1423413 at N-myc downstream regulated gene 1 Ndret 1432517aat nicotinamide N-methyltransferasa Nimt 1448823 at chemokine (CX-C motif ligand 12 Coca 417574 at cherokine (CX-C motiigand 12 Coc12 1416200 at RIKEN cDNA 923.0117N10 gene 23017NRik 1456808aat phosphatase and actin regulator 1 Pact 142697 at utiquitin-activating enzyme 1-ke Ube 1419703 at pocolagen, typew, alpha 3 CoSas 1439022 at phosphatase and actin regulator 1 act 1421991a at trisulin-like growth factorbinding protein 4 lgbp4 1452595 at a disintegrin-like and retallopeptidase thorribospondin type 1 Adamsa 1431834a at elastin micro?trinterfacer EE1 1448984 at S100 calcium birding proteing S100g 1460409 at carnatine palmitoyltransferase 1a, Iver Cpt1a 1417505 sat interleukin 11 receptor, alpha chain 1 11 141802 1st complement component 4B (Childo blood group) Cas 1480513 a at endothelin receptor type A Edra 146978 at FC receptor, IgG, alpha chain transporter Fogit 1418534 at frizzled homolog2(Drosophia) z2 1424334 a tetraspianin 17 Tspan17 1417130s at angiopoietir-like 4 Angp44 1421,088 at glypicar 4 Gpca 1417009 at complement component 1, r subcomponent C1r 1426306 aa melandma antigen, family D, 2 . Maged2 1455642a at tetrasparin 17 Tspan 17 1418455 at Coato-Tierprotein complex subunitzeta2 Copy2 1426973 at G protein-coupled receptor 153 Gpr153 1434034 at ceramide kinase Cek 1425298aat regulator of G-proteinsignaling 3 rgs3 1425,701a at regulator of G-protein signaling 3 Rgs3 1416414 at elastin microfibrinterfacer Ei 1451598a at sphingosine kinase 1 Sphk1 1456437 x at NA NA 1424382 at retic docatin 3, eF-hand calcium binding domain Rc3 1421978 at matrix metallopeptidase 19 Mmp19 1421977 at matrix metallopeptidase 1 Mmp19 1422840 at protocadherin beta e Pedas

Mxas 1452330 a. at matrix-remodelling associated 8 .

3147 seasis 43887 -894 0,481 88885 0,41328,822337 642327 los9749

05784 65120 0,422697 -0.589733 O4S 95682 sess log1934

345648 0.925814 -204598 -1.00548 .3382 -2852

-0.531707 losses 0.372382 0807077 -533,297 -0.4091 -0,33922 -0,75882 0.187s2 0.7ses2

1758 0.8316 OB9919 -0.907323 3.3282 -85.83

.91988 58859 0.0353.72ss35 0.07255 0.83588 0.151258 -0.84944 -0258.213 -0.6775 218 .474

Os3975 0.787053 -0.714SS -0.74058

1938 ...S.174 0.342 .5548 loossa Osags o,11626,6838 22844 - 1298

c.17396 -1.03.245 0.255.24 0907057 -c.18927 -1.08148 -32288 -18975 0.7669 - 327 033.538 -1.088426

o,058998 -1.07000 ,5339 -1.4s.264 O3S329 -11SS83 0.843S 2674 0.238.042 1.22s2SS 0.27199 -1.359. 0.182-253767

sasa .222s2 Oossess co278 -245878 24,392 1833S 362.54

0.532s 376 0.3SO 1053 0,4SSO161,06854 -O43S44S C3SS45

4238sa SS.14 0.68487 c.68753 0.4008-0-693695 -69741 -87987 - S13 .9837 loss 132 0.887s2 -0.508854 -0.984.149 0.531445 -089365 -0,57794 -99143 o,35828 -12325 -0.38826 -1.8269 0.32878 -11782 -31235 -1.1ssss

-0.312681-1.192822 -34s.2 -1160s 0.333798 -1.087s22 -31692 -32S1 2.98475-18855

o,20409 -1.11889 -0283933 -120329 0.32063 -12229 0.28454 -1,4307

0.25355 -1.12428 -0.397232 -1094396 -0.459944 -109885 0.437335 - 1350s 0.438398 -1.14342 -0395.42 1.23331 -0.440335.13901s 0.27973 -1,3475.3

Jun. 3, 2010 Sheet 7 of 27

1563152 587094 1527s 1.55562 1s5973s 1584.8 153686 1439.91 1.5027 1546643 1538656 147891 1629 158423 1.5844 1.5881s.3 1s1347s 1.490438 52.585

1537373 SO474

1SO48 1.58735 1.584.884 1.638 182689 1.595074 8233. 54ss s37 s32039 46858 sos3.2

1590.48 1593353 152884s

S1493 1.502574 155369 1.43778 1.4651.93 1446856

42314 1.32sse 13984 s322

13s.583 1.3215 1.3385 12398 13357 sess

157584 1353 488.364

1.6137 567073 15751 SCO3 57.332

1s2873 51675

1,575 439

1431125 1.4s.229 47sg37 1.45741 15569 1,521.091 1557 1452948 151714 1.5983 1442895 492.154

141327 48,554

147934 1,44937s 14426SS 141635 1.4982 15273

US 2010/0135970 A1

1354.239s 1384,78848 1.5ss197of 1,432380294 1.288ss9 ass692

1392,594.739 1533.SS48 1463,08959 3935087 216542949 1.42730s 2.67.1448 2.6585765 1.21524S5 1.37876760s 2,530845.454 2.146083 3,501139,239 1,4728,585 2.78sts 1.753.45ss 3.1839,233 2.52052757 1582,1234 1.487766792 2795442 1.775898942 1,255581s 1853747s 1597.7105.11 1.361303422 21ssess2147 1,5258.388 2,207332418 2,582292827 1.5288 14357 1.5138sses 22928,537 3483428 652723 1457087 1.361ssistas 1s187251 1533S

157028093 34792.423

1,66585.15 4.024119432 2sssss 256321128 1.984658734 16474,149 1s2423 16455994 2,674924581 28.387,072 16628O8122 3.5sgs5298 85.08471

2435617 2.7038848 2.9812S38

23S2557 2.3492-51s 1,692271006 2,207415s 1573ssa1 2.525.02439 2.8455.4398 2.3s238895 18478583 2022591859 392,5547

1455.250.2 284.338

1487.0167 2.19408317 2.7862,359 .99201498 1,944-1886 207138327 .988.9765 52B11488


Figure 4D (cont.)

1415899 at Jun-Boncogene Juab 0.322915 -1.100.33 1.468.439 1.324317412 14217928 at triggering receptor expressed on myeloid cells2 en? 0,477256 .1,141428 1.388372 153705945 1420124 at T-cell leukemia translocation altered gene Tcta -0.480853 -1099157 1447695 1.464952751 1452178 at plectin1 Pec1 -0.551302 -1.096753. 142254 1.469233709 1448842 at cysteine dioxygenase 1. cytosolic Co1 -0.525677 -0.978214 1522,383 3.973745277 14170238 at fatty acid binding protein 4, adipocyte Fabp4 -0492751 1,064984. 1464771 3.245170633 14512S38 at fatty acid binding protein 4, adipocyte Fabp4 0.473723 -1.06s234 1.491743 2.90014117 1452018 at arachldonate 5-lipoxygenase activating protein Alox5ap 0.631884 0.97.3758 1516301 3.17550.3976 1416077 at adrenomedulin Adm -0.62549 -1.056414 1.437476 2.2829.18478 1417292 at interferon gamma inducible protein 47 f47 -0.596206 -1.049078 1435135 2300550892 1425039 at integrin, beta-like 1 Itgbl1 -0.515229 -1.175257 1.365.302 253751C931 1434858 at ankyrin repeat domain 44 Arkdaa 0.436,536 -136894. 41329 1,778376857 1426519 at procoltagen-proline,2-oxoglutarate 4-dioxygenase alpha 1 peptide P4hat 0,594052 -1.041519 .308.371 1526396917 1423915 at otfactomedn-like 28 Ofm2b -0.287SS3 -1.325292 1.3D9s36 2305176019 1452145 at hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) H5pd -0.350.433 -1.268O17 134281 1.70122613 1417283 at Ly6ineurotoxin 1 lynx 0.150031-1378705 1.272279 1340356.884 1420833 at vesicle-associated membrane protein2 Vamp2 0.316698 -1297802 1307333 150941723 1426278 at interferon alpha-inducible protein 27 f27 0.301715-347438 1253594 4.152130855 1423889 at NA MGC5739 o,41181 - 315461 .194984 1.51398O331 1418188 at glutathlone S-transferase, theta 1 Gst1 0.479875-1.176721 1.352393 1635169474 1448941 at UDP-Gal:betaGlcNAc beta1,4-galactosyltransferase, peptide 2 B4galt2 -0.329374-1234005 1.333886 1.325352303 1419039 at cytochrome P450, family 2, subfamily d, polypeptide 22 Cyp2d22 -O,067,083 -1277542 1.411S5 2332512779 1417133 at peripheral myatin protein Pinp22 0.000645-1328871 13s.5781 1931.044422 1415806 at plasminogen activator, tissue Pat 0.49171 -12606 1.42334 2,237651494 1451229 at histone deacetylase 11 Hac11 0.211813 -1237467 141459 151186.3208 1449528 at c-fos induced growth factor Figf -O.000645-1395.453 1271094 2.275481 1450658 at a disintegrin-like and metallopeptidase thrombospondin type 1 AdamtsS -0.2O8667 -312498 1.3O887 1991.752942 14241.87 at RIKEN coMA261.0001 E17 gene 26.000117Rik -0.056195-142205 1,18924 1407651514 1424713 at calmodulin-like 4 Carr 0.10903 -1.408918 1.245022 1.772657.338 1451335 at placenta-specific 8 PacB 0.05903 -365689 1253572 234.70757.43 1416503 at latexin Ugn -0.147697-1376847 1.255.015 1633,296,212 14262.10.x at poly (ADP-ribose) polymerase family, member 3 Pap3 -0,165429-1355952 1.288154 1.433843463 1422985 at fitzded homolog1 (Drosophila) Fad1 0.271358-1298117 134.0054 167712587 1425894 at . MAS-related GPR, member F Mrgprf 0.1386.35 - 135988 1.322785 3.22.746,378 1419182 at sush, von Willebrand factor type A, EGF and pentraxin domain conta Swep 0.0607 13845.42 1.33392 22753,3537 1418454 at microfibrillar associated protein 5 Mfap5 0.190789-1318634 13.525.09 3.3218838 1460681 at endothelial differentiation sphingolipid Gprotein-coupled receptor 3 Edg3 0.05035 -1.324737 .362783 2246802529 1450718 at a disintegrin-like and metallopeptidse thrombospondin type 1 Adamits 1 -0.243945 -1.142261 1.48147 2.950988029 1424O4.8 at complement component 1, s subcomponent C1s 0.21942 1.221876 1.4.01175 2.9589.30385 1415997 at thloredoxin interacting protein Txnip 0.138873 -1.152673 .43795 2,48233O897 1415998 at thloredoxin interacing protein Txnip -0.04539 -1.1973.58. 1428.39 2,235306162 1448377 at sectatory leukocyte peptidase inhibitor Sp 0.113069 -1.336.509 1.37499 1721022691 1426818 at sterol O-acyltransferase 1 Soat 0.063921 -1.313074 1.326.232 1.36s21291 1418003 at RIKEN cDNA 11900O2H23 gene 11900O2H23Rik 0.15.5677 -1.3075 1.35234 1922389.25 1438511a at RIKEN cDNA 11900O2H23 gene 11900O2H23Rik -0.085474 -1.33175 1264889 1930.32491 1418934 at mab-21-like 2 (C. elegans) Mab22 c.042.539 -1368,277 1316523 34077898 1449350 at odd-skipped related 1 (Drosophila) Ost 0.0583.07 -1238.128 1400148 1s2s187188 1434735 at hepatic leukemia factor Hf 0.045351 -1331604 1.306844 477776807 1431858 Bat C1q and tumor necrosis factor related protein 6 Ciqtrf6 -0,176102 -1226684 1.360988 134828442 1418618 at engrailed 1 En 0.002977-1524808 1,037143 1794.003438 1436187 at RIKEN cDNA 1110054M08 gene 110054MOBRik -0.09.288 -1.463019 1.142385 1.39928s298 1421228 at chemokine (C-C motif) ligand 7 C7 0.034619 -1.54928 0.984.04 1.910821418 1416203 at aquaporin1 Aqp1 0.0601-1.54O238 1.012098 150399.4227 1439364 a at matrix metallopeptidase 2 Mmp2 0.043848 -1.485069 1.114649 1540sg9237 1416138 at matrix metallopeptidase 2 Mmp2 0.060892 -1.485677 1.091674 1.47305.8403 1424988 at Tryosln regulatory light chain interacting protein Mytip 0.073347 -1.454068 1,151427 1.498315346 1436970 a at platelet derived growth factor receptor, beta polypeptide Pdgfrth 0.15796 -1.454081 1,164816 1.88356.882 1417148 at platelet derived growth factor receptor, beta polypeptide Pdgfrt 0.138593 -1.427g25 1207354 1711669142 1418533 sat fitzded homolog2(Drosophila) F2 0.28209 -1.400879 120561 190817815 1418532 at frizzled honolog2(Drosophila) FZ2 0.203558 -1.39513 1.224668 1838848227 1435908x at guanylate nucleotide binding protein2 Gbp2 0.193345.1.4792051.171959 1.439743586 1418240 at guanylate nucleotide binding protein2 Gbp2 0.181357 - 1.528975 1,1861 1.403990063 1434738 at hepatic leukemia factor f 0.121269 -1.498498 1.138422 1.7.1582.6917 1423489 at monocyte to macrophage differentiation-associated Mr. 0.104127-1535,293 1.078098 1.34408751 1438953 at NA NA -0.024858 -1.436405 1235684 2.80383.0024 1438954 x at NA NA O.022833 -1451115 1.22556 2.696551093 1438528 at Kazal-type serine peptidase inhibitor domain Kazad1 0.06734 -149074 116956 1.32O38801 1422603 at ribonuclease, RNase A family 4 Rrase4 -0.0137 -1485s?8 1,046453 1368.93385 1451978 at lysyl oxidase-like 1 lood1 0.331208 -1,469559 .177939 1.426484937 1416221 at follstatink 1 Fst O.218924 -1471561 1.194562 1.345267.289 1455978 a at matrilin2 Maty2 D353761 -1514044 1.104742 1.368792.155 1419442 at matrin2 Matriz 0,417.399 -150819.3 1.094102 1.358990441 1416441 at plasma glutamate carboxypeptidase Pgap 0.234855 -1.370594. 12973s2 1.572.000298 1417273 at pyruvate dehydrogenase kinase, isoenzyme 4 PK4 0233017 -1.494.367 .3469 1.577809172 1423607 at umlcan Lum 0.366911 -1571274 0.993328 1.338497O64 1448475 at ofactortedlinke 3 ofm3 O37851-15887.22 O.963579 1.33862472 1419477 at C-type lectin domain family 2, member d Cec2d -0.322079 -1.15312 1348.884 2006,347738 1448881 at haptoglobin Hip -O,852471 -1.031D13 1.119748 3.286,514455 1421217a at lectin, galactose binding, soluble gals 0.787362-162433 1.16325 2,08672.9335 1422827 x at solute carrier family 35 (UDP-galactose transporter), member 2 Sc35a2 -O,81605-10838 124844 1.34471.9233 141905 at WNT1 inducible signaling pathway protein2 Wisp2 0.675004 -1.130213 0.989842 • 1.5805802 1421890 at ST3beta-galactoside alpha-2,3-sialyltransferase 2 St3gal? -0.675459 -1.15531 1.043348 13925.425.65 1451426 at . DNA segment, Chr 11, Lothar Henrighausen2, expressed D11 gp2e -0.811336 -1.01.0372 1.098601, 1.3913s2791 421571a at y Tiphocyte antigen 6 complex, locus C Ly6c 0.666995-194126 1.28984 3.208833435


Figure 4D (cont.)

1450.378 at TAP binding protein 1448380 at lectin, galactoside-binding, soluble, 3 binding protein 1417185 at lymphocyte antigen 8 complex, locus A 1451501 a at growth hormone receptor 1452249 at prickle like 1 (Drosophila) 1426195aat cystatin C 1426734 at cDNA sequence BCD22623 1416521 at selenoprotein w, muscle 1 1419008 is at pellino.2 1425985s at mannan-binding lectin serine peptidase 1 1423818 at CAAXbox1 homologA(human) 1425191 at RIKEN cDNA 94.300.98EC2 gene 1419684 at chemokine (C-C motif ligand 8 1425,023 at transnairbrane protein 106A 1450033 at signal transducer and activator of transcription 1 14187C2a at RIKEN cDNA281042B15 gene 1418704 at S100 calcium binding protein A13 1416455 a at crystallir, alpha B 1434389 a at crystallin, alpha B 1418990 at membrane-spanning 4-domains, subfamily A member 4d 1451344 at transmembrane protein 119 i422571 at thrombospondin2 1425510 at MAPimicrotubule affinity-regulating kinase 1 1449830s at MAPimicrotubule affinity-regulating kinase 1 1424759 at artestin domain containing 4 1448,318 at CKLF-Ike MARVEL transmembrane domain containing 3 1448619 at 7-dehydrocholestero reductase 1424617 at interferon-induced protein 35 1416046a at fucosidase, alpha-L-2, plasma 1426277 at RIKEN conAC730.025P13 gene 1415947 at cellular repressor of E1A-stimulated genes 1456155 x at fucosidase, alpha-L-1, tissue 1437772 sat fucosidase, alpha-L-1, tissue. 1451134a at TM2 domain containing 2 1420624 a at vesicle-associated membrane protein 8 1448621aat sphingomyelin phosphodesterase 1, addysosomal 1448832 at proteasome prosome, macropain) subunit, beta type 10 14505.09 at cartohydrate sulfotransferase 11 1451153 a at cysteine and histidine richt 1448887 at TMEM9 domain family, member B 1416317a at Stam binding protein 1417874 at TMEM9 domain family, member B 1420540 a at Ras-like without CAAX1 1418368 at histone 2, H2aa1 14241.98 at Yip1 domain family, member 1 1418109 at fucosidase, alpha-L-1, tissue 1434743 x at RUN and SH3 domain containing 1 1415824 at stearoyl-Coenzyme A desaturass 1 1418418 at . garnTa-aminobutyric acid (GABA) receptor-associated protein 1417793 at interferonduce GTPase 2 1421385 a at rhyosin Vila 1417141 at interferon gamma induced GTPase 1450403 at signal transducer and activator of transcription 2 1437044 a at glucosidase, beta, acid 145.0099aat glucosidase, beta, acid 1448332 at peroxisone biogenesis factor i9 1427127x at head shock protein 1s 1431691a at RAB31, member RAS oncogene family 1415893 at sphingosine phosphate lyase 1 1427128 at heat shock protein 18 14523.18aat heat shock protein 18 1422512a at opioid growth factor receptor 144839Qaat dehydrogenase/reductase (SDR family) member 3 1422670 at rho family GTPase 2 1418191 at ubiqultin specific peptidase 18 1451533 at cDNA sequence BCC22587 1453.198a at 2-5 oligoadenylate synthetase-Eka 2 148580 at receptor transporter protein 4 1423468 at chemokine (C-C motif receptor 7 1422155 at histone 2,H3c2 1453891 at polymerase I and transcript release factor 1424394 st selenoprotein M 1435468 at lin-10 homolog(C. elegans) 1423998 at general transcription factor C, polypeptide 5 1418013 at carnello-like t 14161088 at transmembrane emp24 domain containing 3 1416457 at dinnethylarginine dimethylaminchydrolase 2 1423948 at PDZ and JM donan 2 1417527 at adaptor-related protein complex3, mu2 subunit 1416572 at matrix metatiopeptidase 14 (membrane-inserted) 1448383 at matrix metallopeptidase 14 (membrane-inserted) 1417101 at heat shock protein 2. 1448152 at insulin-like growth factor 2 . 1424,169 at Tax1 (human T-celleukemia virus type 1) binding protein 3

Tapbp 0.603S48 gals3bp 0.63000 Ly6a 0.569.999 Gr 0.505908 Pricke1 -0.50959 Cst3 -0.51.1817 BC22623 0.513845 Sepw 0501272 Pe2 -0470417 Masp1 -0.49931 Coa 0.501913 943.098O2Rik -0.682209 CC8 0.553748 Tinenosa -0.532.077 Stat1 -0.59145 23104285Rik -0.7.5128 SOba13 0.511407 Cyab 0.174725 Cyab 0.197773 Msaa4d 0.1397.35 Trnem119 0.243478 This? 0.2296 Mark -0,265.889 Mark 0.24179 Artdca 0.25029S Cutts 1.183965 Dht 1.148.257 f35 ..106872 Fuca? -0.98,2092 C73.0025P13Rik -0.863682 Creg1 -.1635.53 Fuca.1 1.350918 Fuca 135669 T22 35799 Wamp3 139376 Smpd .1.27867 Psn10 14S4472 Cist11 -1.08839 Cyhr1 -1.177549

sts -1.221658 Stambp -1.194128 Tengb -1.211038 R1 -1.167014 Hist22aa1 1.053559 Yipf1 1.051693 Fuca ..100071 Rusc1 .1.199892 Sc1 -1.052508 Gabarap1 -1,160858 ligp2 -1,100859 Myofa -0,829733 gtip -1.034444 Sta2 0.771775 Goa 1397,883 Gba -1425722 Pax 9 -139B569 Hispatib- -1461663 Rab31 -1409488 Sgp1 -1436843 Hispath -1.414741 Hspa1b -1.3B273S Ogfr -1.460243 Offss -1.344749 Rnd12 -1.367.074 Usp18 -0.641644 sCe2687 -0.637655 Oas2 0,952.468 Rp4 -O.80921 Cerf 0.5095 Hist23c2 0.888874 Pf 0.64147 Set 1.18425 in 10 120535

Giscs .1.155033 Crm.1 -1.13240 Tmed3 0.968.391 Dah? -1,039.096 Pinz -1.035568 Ap3m2 -O.964152 Mmp14 -1.119464 Mmp14 -1.0397.58 Hspa2 -0.94.432 g2, 0.85883 Taxbp3 0.847.873

Jun. 3, 2010 Sheet 9 of 27

..1652.13

..c5889 1,180864 1.269798 -1.118535 -1.261373 1261716 -i.30174

-1.29119 1.270.08 -1238496 1.122135 .1.283279 -1278.382 -1.229008 -1.053181 -.289851 489158

. .477537 1.489035 -1.443047 -1.821.382 1.358687 ..3599.08 -1.360968 0.881295 0.721.188 0.87822

-0.920696 -1.02O091 0.617152 0.331741 0.353429 0.34307 0.43969 c.50751

0,176854 -0.635179 0,518904 -0,492952 0.5468.31 -0.615591 -0.640375 -0.768241 -0.799.935 0.69684

-0.462131 -0.63639 -0.609238 -0.558.238 0.865.348 0.757955 O.98890s 0.26182

-0.231008 0.267719 0.209688 -O,309914 0.176608 0.23981

0.357661 0.207913 0.08279 0.228908 -1.103847 -1.13317s 0.875442 -0.95.0453 0.850.014 0.631.93

0.937479 0.346949 0.303868 0.470941 0.31848.2 0.364,763 0.338999 -0.435251 -0.555731 -0.46067 0.49709 -0.4250SS -0.647757 -0.640945

259512 1.288709 1.16724 1.133812 1.34926.1 1.194852 1.1861.64 1.073582 1.17269 1.1692s2 1.2551.43 1.251983 0.972

0.911672 0,90185 1.18914 0.904649 0.815453 0.776132 0.844845 0.99643 0.688764 1.16803 1.177344 1.072018

O.9SB8 0.841749 1.055363 0.983268 0.8884O7 o,499.108 1.125472 .075,585 1,14576 1,056552 1.30.093 0.94787 133015 1.32s23 1.281671 1.30012 1.137389 1.212SO7 1.242089 1.182456 1.263,595 1.14803 1.11543s 1,14547s 1.27884 1253807 1.1507 21908

0.SS44.38 0.559.881 o.72765 0.7g26s.7 0.78639 0.61843 O,794818 0.82006 O.B3503 0.1130s 0.5925.78 o,53558 0.450062 0.847732 0.77562 14712

148744 131457 143,677 1431149 1.415165 1.423272 1561009 1,528456 1536982 1.534365 1.432902 1.515381 157776 1.573315 1.579.261

US 2010/0135970 A1

1.6947.2195 2044301.884 24659.8889 1898997015 258612385 1.552508958 1.3584218 1286259682 1.306.222946 1320091957 1.3221890.5 1.287.398.454 3.07.2860953 1501015049 1.30630833 1,525,53877

1,3304841.91 1.332325482 29366911

22759998.78 15.7164228 1446168398 1697.044847 1.52782O38 1.290075.287 1.395.002099 1.3012O2478 1.455158024 1.412640809 1388093828 310389953

1.469955992 1.346947707 477581594

1,431585179 1.4147349 1.35585,453 18875.4217

1,6062B499 1.597223533 1,381633048 1548958O11 1,293880479 186O757943 1422559381 1468,26984 1.321 181963

1.4627.478 1.3495.57916 2.16955376 1475353371 141293.2893 1444569714 1360,999.45 1.298512754 1.292776.032

, 1.780796,915 1.448490741 1.337,328.309 1.712444728 1,651611834 1.473549139 1305916.38 1.305654097 1.70562s625 1.384888,174 21783.28998 1,563122335 16219.04595 1.363698945 13188959

240976.9167 231414S139 1.506581386 771525082

16085,55369 499.914221

2381863375 1.5889836O7 1.942465O16 1821282907 1.597B26368 S.91230O3S2 1.45787.0143


Figure 4D (cont.)

1434.866 x at 1438158 xat 1420924 at 1423704 at 1418463 at 1455871 sat 1429248a at 1448328 at 1448428 at 1418712 at 1448477 at 1450696 at 1427394 at 1449228 at 1424842 a at 1452752 at 1428538s at 1423980 at 1434131 at 1430549 at 1448618 at 1423140 at 1418367 xat 14.8538 at 1424848 at 1421071 at 1428534 a at 1434.299 at 1425618 a st 1421242 at 1435738 x at 1423952a at 1451290 at 1480348 at 1423141 at 1429947aat 1452112a at 1427574 sat 1419821s at 1416488 at 1423718 at 1428334 a at 1448384 at 1430522a at 141814B at 1422573 at 1458412a at 1432438aat 1422341s at 1452648 at 1449558 at 1420953 at 1420954 a at 1417174 at 1417982 at 1427457 a at 1451625 sat 1424694 at 1422478 aat 143691.5 xat 1428380 at 141635 at 1449043 at 1448118 a at 1424498 at 1433723 sat 1451381 at 1418829 a at 1439259 xat 1460671 at 1429.97e Bat 1421478 a at 1423854 a at 142492 at 1415930aat 1448883 at 1424307 at 1421322a at 1423554 at 1422980s at 1428O84 at 1451339 at

canline palmitoyltransferase 1a, liver camitine palmitoyltransferase 1a, liver tissue inhibitor of metalloproteinase 2 lysophospholipase 3 phosphatidylinositol 3-kinase, polypeptide 2 (p.85beta) ribosomal protein 13 annexin As SH3-domain binding protein 2 neuroblastoma, suppression of tumorigency 1 CDC42 effector protein (Rho GTPase binding) 5 cartohydrate sulfotransferase 12 proteosome (proSome, macropain) subunit, beta type 9 insulin-like growth factor2, antisense hyperimethylated in cancer 1 Rho GTPase activating protein 24 leprecan 1 retinoic acid receptorresponder (tazarotene induced)2 solute carterfamily 25 RUN and FYVE domain containing 1 blocked early in transport 1 homdog (S. cerevisiae)-like major vault proteli lysosomaladdlipase 1 histone 2,2aa1

Cpt1a Cpt1a Timpz lypla3 PK32 Rp13 Axas Sh3bp2 Nb Codca2ep5 Chs2 Psing g2as Hic A?hgap24 lepre1 Rates2 Sc2Sa29 ruly1 Bet1 Mwp up1 Hist2h28a.

KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulunprotein retention recKderg RAB, member of RAS oncogene family-like 4 won Hippel-Undau syndrome homolog ADP-ribosylation factor GTPase activating protein 3 RAB, member of RAS oncogene family-like 4 colled-coil domain containing 23 ring fingerprotein 144 RAB, member of RAS oncogene family-like 4 keratin complex 2, basic, gene 7 microtubule-associated protein 1 light chain 3alpha arylsulfatasa A lysosomalacidipase 1 2-DNA binding protein 1 RIKENcNA 4921506122 gene SH3 domain protein d19 isocitrate dehydrogenase 1 (NADP+), soluble cyclin G2 adenylate kinase 3 BCL2-like 11 (apoptosis fadStator) cycin G2 veside-associated membrane protein 5 lysosoma-associated protein transmembrane 4B AMP dearinase 3 putative phosphatase adenylate kinase 3 lysophospholipase 3 tumor protein p53 inducible nuclear protein 2 histocompatibility 2, Tregion locus 23 adducin (alpha) adducin1 (alpha) RIKEN cDNA 1810021J 13 gena insulin Induced gene2 bone morphogenetic proteint RIKEN cDNA 1700013123 gene RIKEN conA 2010011120 gene acyl-CoA synthetase short-chain family member 2 lysosomal-associated protein transmembrane 48 RIKEN conAOs 10007C2 gene abhydrolase domain containing 4 N-acetylgalactosaminidase, alpha cathepsind RIKEN conA 5133401NC9 gene small EDRK-rich factor 2 RIKEN conA 181002OD17 gene enelase 2, gammaneuronal abhydrolase domain containing 4 glutathione peroxidase 1 RIKEN conA 1810.073NO4 gene catturn activated rticleotidase 1 RAS-like, family 11, member B bone marrow stronal cellantigen2 microtubule-associated protein 1 light chaln 3beta legumain Rho GTPase activating protein 1 Interferon dependent positive acting transcription factor 3 gamma gamma-glutamy cartboxylase blocked early in transport 1 homolog(S. cerevisiae)-like centaurin, delta2

Rabl4 Wh Arfgap3 Raba Cedc23 Rnf144 Raba. K2-7 imapic3a Asa lip Zip 49.2150622Rik Sh3d.

Cong2 Aks BC21 Cong2 wamps Laptmab Ampd3 R23-138K12.4

lypla3 Trp53inp2 H2-23 Add1 Add1 18OO21.J13REk insig2 Bript 7ood1323Rik 2010.1120rk Acss2 Laptmab OsOOO7C21Rik Abha Naga, Ctsd 533401 NogRik Ser2 18002OD17Rik Eno.2 Gpx1 18100.73NC4Rik Caft Ras1t

Maplc3b ginn

Ggox Bet1. Certz Suox.

0.952668 -0.841967 -0.79034 -0.729.411 -0.8245 0.737612

-0761692 -0.643231 0.74252-0.657379

0.858.342 -0.593484 0.793175 -0.484433 -0.6.3283 -0.742a 0.887.908 -0.67756 0.95955 -0.59480

-0,8493780,683942 0.766164 -0.76O757 -0,83581 0,795113 0.68O158 -0.52859 -0.776678 -0.53322 0.944698 -0.387ss2 -0.717347 -0.65996 0.742O11 -0.55625 -1,05527 -7051s

0.9358 0.751598 -0,932411 -0.3929s 0.7238 1.007

0.968.877 -0.775582 0.90982 0.7929

0.831458 -0.879918 0.91933 0.74S278 .1.0321B1 -0.65177 0.859684 -0.85443 0.804882 -0.848,263 0.660888 0.944O23 0.746,778 -0.982.919 0.7451.88 0.89011 0.785492 -0.944717 -0.674063-67479 0.779353 -0.949589 0.71948 -1533 0.817888 -0.825857 -0.64585 0.683487 0.880675 0.450C48 1.192973 0.0523 -1.267593 0.04.247 -1244884 0.08O868 -1.249.308 0.078482 -1.291584 -0.05492 1.370255 000184 -124706 0.17419 1.3077 Obs4

-1356002 c.11594 -1.098743 -0.276126 -1.11574-c.148311 1.04431 c3917 -0,943489 -0.3040S2 -1.018485 -0.234109 -0,912 -o.154125

1.027702 -0.074421 -1.112939 O.O15187 -1.1261.73 -0.190816 -1.324054 0.248412

214271 c.195928 -1,377739 -0,08964g -1.34149 -0.257551 -1353635,2572 -1,142497 -0.4821 -1.481437 0.03433 1.373.348 -0.104368 -1.2661 -0.171682

-1.427264. O.167472 -1394.459 d. 12977 1.4381.52 -0.101802 1445519 -0.73102 -144227 0.011444 1.43228 0.07499

1396717 -0,19297 -1s28532 (.3437 1,5396.26 0.053998 -1.243933 -030714 1356.257 -0.241311 -1.327.345 -0.16338 .1.205414 0.228658 -1.164972 0.325819 -1.262282 0.03401 -1.225458 0.0a 61

Jun. 3, 2010 Sheet 10 of 27

151227 153257 1540762 1.595656 1.59289

1581051 18O1975 1.595094 1.535904 1.5738 1.533707 1.518426 1487.703 1539943 1605165 157953 1.551285 1.539.307 1.354.069

2s2O7 1,413442 1384918 1,3844 401215

1.43359 1.457807 1.409342 1429871 1487577 1.4SS72

1371704 1388508 1.40338 1.37922

13761.97 1.379744 1.332195 148744 138698 1.3285 138327 1.37909 1.3257.62 1,37453 1305,672 1420841 1.372513 1280235 474571

1.49559 1537B99 1566.328 1.478944 1.532341 1502965 1391845

47997 1.213846 1355,008 1246.232 1306835 1227161 1.319644 1.14343 229.72

1.326281 1.148.214 1.1381.03 1.12008

1.065649 1.37819 1.044288 1.09.2692 0.923012 0.805424 1.126269 0.937967 1.072594 1.26878 1.337s2 1.152589 1.252208

US 2010/0135970 A1

20517895.3 1.95022.1818 151096.7397 1,953.538342 1.36824.245 131675.425s 1.30499794

1456685445 829867347

15555.885 1483485956 1,38116159

2298.77011 2.192787711 1.566511858 1.361107331 1.697978152 1,50768593s 1.30593.7537 1.290934081 1.62857347 1.552.71488 806939398

1.706559335 1.37191254 158340895.3 1.338537067 14069263.32 1.34247982

1.45994O793 t.3460598.39 1.35547533 1,7507969 54017576

1.324954698 i.755303407 129785882 1.555-451899 1.30373811 1.54300.4588 1.35253275 1.804815475 1.639096724 1.56784797B 1.33982531 2.722040os

1,3839,26559 160499ss3 2.586723.458 2556.387491 2.96O110788 1.428908295 14238.08475 1689743281 1,660193039 1922826,369 1,883.459089 426174113

1.717624291 1295.08892

2305960.404 1537871585 1.32818984s 1649552257 1306677003 1,334405244 1.741.32005 1.494.102139 1.76309713 1.579289453 1829.412994 1626.00916 1.544474158 24296,04957 329857993

147577439 1.327826659 1,43671418

1.404314882 1,420507823 1.31698012 1419297134


Figure E

Table S3: List of top 500 downregulated transcripts in 3T3ID3 cells compared to 3T3 control cells ProbeSet) Gene Nare Gene Symbol 3T3 D3 3T3/D3 log(3T3and 3T3/D3) 1422445 at integrin alpha 6 Etgas 0.5867.42 1.22032 -1.0487.34 2.293939438 1422444 at integrin alpha 6 tgas 0.613945 .136157 -1.49493 2.34724294 1418350 at heparin-binding GF-like growth factor Hbegf 0,441948 1.225654 - 12428O1 2.37979948 1448126 at teratocarcinoma expressed, serine rich Tera 0.249B02 1.37731 -1232.391 -209744.4268 1434279 at Fas (TNF receptor superfamily member) Fas 0.316815 1.39595-107B745 2,396.42069 1434280 at Fas (TNF receptor superfamily member) Fas 0.141227 1.481279 -0.967317 -244800234 1454904 at Fas (TNF receptor superfamily member) Fas 0.476838 1.259898 -2374.7 3.5949S208 1434278 at Fas (TNF receptor superfamily member) Fas 0.52054 1.216769 -1276335 4.026299.935 1448953 at Bloom syndrome homolog(human) Brm 0.521689 1.234891 -1214327 20.96S59474 1418380 at telomeric repeat binding factor 1 Tef 0.682036 1.087373 -1252086 23.306.73833 1418530 at nucleoporin 160 Nup160 0.608075 1.08.0472 -1.344127 -2.2909.73769 1422430 at fidgetin-like 1 Fignif 0.404262 .197894 -1393,839 24.91444819 1424629 at beast cancer Brca1 O.51847 1,09419 -1.444579 2.8297434 1417400 at retiroic acid induced 14 Ra14 0.498711 1.016468-152.429 2085850928 14486.50a at polymerase (DNA directed), epsilon Pole 0,490.208 1.023498. 1528908 2.27848862 1426910 at PRKC, apoptosis. WT1, regulator Pawr 0.355.285 1,150oos -1.477154 2.84.006881 14284 ?aat spematid perindear RNA binding protein - Sirbp (780395 .335751,913s 209229524 14280.52a at zinc finger, MYM domain containing 1 Zmyn1 0.568767 .17793 -1.16952 2.131809381 1460711 at RIKEN conA4930461P20 gene 4930461P2ORK 0.821308 1,042949 -1.095009 2.388467787 1453064 at RIKEN conA573O466H23 gene 57.3466-23Rik 0.657099 1.17992 -1.04B421 258480698 1418507 at suppressor of cytokine signaling 2 Socs? 0.7996.15 1.088,201 -1.472 3,01647S35 1448819 at eukaryotic translation initiation factor 2, subunit 2 (beta) 2s2 0,5856.3 1.2423.17 -1.032508 -2.293603.262 1449.109 at suppressor of cytokine signating 2 Socs2 0.632482 1228115-1.019308 -2.6693.96496 14231428 at GTP binding protein 4 Gpbp4 0.878975 0.95415 -1.28558 -2, 1995.02469 1452214 at SK-like Ski 0.877682 0.995.39 -0975176 2186897.02 1452278 at SWI/SNF-related, matrix-associated regulator of chromatin Snarcad 0.897495 0.97.1683 0.912395 2.194.802175 1433488 at chloride channel3 Ccm3 0.931315 0.956221 -0.788294 -2.2158878.35 1415772 at nucleolin Nc 1.021488 0.84329 -1.132808 -2.6618366 1426243 at cystathlonase (cystathlonine gamma-lyase) Cth 0,93203 0.95O29 -1.151009 -3563836.479 1435.0068 at ATP-binding cassette, sub-family 8 (MDR/TAP), member 7 Abcb 0.978.741 0.88233 -15759 -2.131404184 1448820 eat eukaryotic translation initiation factor 2, subunit 2 (beta) E.2s2 0.924832 0.921989 -1.167772 -2.15214976 1427253 at suppressor of zeste 12 homolog (Drosophila) Suz12 0.92O178 O.933247 -1.159266 -3.021345681 1417713 at eukaryotic translation initiation factor 2, subunit 2 (beta) E2s2 0.952814 O.902284 - 164437 2.173603.399 1452364 at suppressor of zesta 12 homolog (Drosophila) Suz12 0.90.5132 0.937109 -1.14599. -3.07754,869 1437497a at heat shock protein 90kDa alpha (cytosolic), dass A member Hsp90aa1 0.894088 0.8854 -12O372 2.18234807 1420021 sat suppressor of zests 12 homolog(Drosophila) Suz12 0.957761 0850327.1.17862 2.677798.527 1438902a at heat shock protein 90kDa alpha (cytosolic), class A member 1 Hsp90aa1 0,974S25 O.805151 -1.139887 -2.181372882 1426645 at heat shock protein 90kDa alpha (cytosolic), class A member 1 Hsp90aa1 0.97.1902 0.80.7537 -1.178Bs2 2.627979039 1452676 a at polyribonucleotide nucleotidyltransferase 1 Pript 1.013,165 C.773617 -1.12310s 25249.42178 1458617 aat eukaryotic translation initiation factor 2, subunit 2 (bata) E2s2 0.997.064 0.838162 -1.7025 -27S3004.583 1417712 at eukaryotic translation initiation factor 2, subunit 2 (beta) E2s2 1.003444 O.B39941-1.118583 2.94.938005 1450873 at GTP binding protein 4 Gpbp4 1,021453 0.796O28 -1.181332 -2.1249.2877.2 141B757 at Zwich, kinetochore associated, homolog(Drosophila) Zwich 0.902392 C.887.443 -1334301 2.71463S479 1449171st Tikprotein kinase Ttk 0.808824 0.949662 -1.31388 3.42725083 1433858 a at guanline nucleotide binding protein-like 3 (nucleolar) Gn3 0,87997 0.913412-12978S9 2,139107733 1424971 at RIKEN cDNA2600ootJ17 gene 2600001.J17Rik 0.772673 0.85797-1450834 2.338844803 1433842 at leucine rich repeat (in Ful) interacting protein 1 LIrip1 0.843015 0.807458 -1.442678 2.8347.43587 1418334 at DBF4 homolog(S. cerevisiae) D4 0.898388 0.733807 -1.481947 3,001891138 1419513 a at ec2 oncogene Ec2 0.883.247 0.74897 -1.4617B4 3,679.5850.3 1419452 at ubiquitin cartoxy-terminal esterase 5 Uch5 0,9725O1 0,656667 -1.395932 -2.594610166 1424.048 at budding uninhibited by benziridazoles homolog (S. cerevisiae) Bub 1.035248 0.604788 -1.42139 4.59882228 1418919 at shugostin-like 1 (S. pombe) Sgol1 0.851606 0.675834 -1.s3791 2252858.348 1424768 at exclsion repair cross-complementing Erics 0.862376 0547598 -157776 -2.326523581 1417457 at CDC28 protein kinase regulatory subunit 2 Cks2 0.71958 0.798.01 -154835S 20894.22588 1417458s at CDC28 protein kinase regulatory subunit 2 Cks2 0,75887 0.76242s-1.525259 2.177416731 1450158aat hyaluronan mediated motility receptor (RHAMM) Himr 1.043219 0442078 -1,423876 -3.337077215 1452242 at centrosomal protein 55 Cep55 0.920.968 os28494 -15157s -36912S903 1416309 at nucleolar and spinde associated protein 1 Nusap1 1.10915 0.335519-1416304 2.83346.3858 14500B4s at Influenza winis NS1A binding protein wns1abp 1.058778 0.532256 -1.423151 -2.175533184 1452203 at RIKEN cDNA 5830411E10 gene 583.04.111 Orik O.87573s 0.731 -1.45930s 2.2878.30453 1418442 at exportin1, CRM1 honolog (yeast) Xpo1 1.0887O2 O.6788ss -1310802 -3.17231836 1454694a at topoisomerase (DNA) i? alpha Top2a 1.014337 0.715.343 -1.3SOS97 -3,239001791 1416544 at enhancer of zeste honolog2(Drosophila) Ezh2 1.08351 0.624851 - 1355,805 2.121660893 1418443 at exportin1, CRM1 homolog (yeast) Xpo 1.139294 0.556486 -1351235 -3,43487.3928 1448794s at DnaJ (Hsp40) homolog, subfamily C, member 2 Dinajc2 1.09861 0.539819 -1335.325 -2.652869522 1435306 aat kinesin family member 11 Kf1 1.18057 0.426799 -1.38611 -3.4011.6959 1417541 at helicase, lymphoid specific Hels 1.152195 0.461795 - 42004.8 4,467968463 1425815 a_al hyaluronan mediated motility receptor (RHAMM) Hmm. 1,103.96 0.509648-1415908 -3, 1964.13807 14486.35 at SMC2 structural raintenance of chromosomes 2-like 1 (yeast) Srirc2. 1.1993.7 0.424.545 -13s.5001 4.52455837 1451080 at ubiquitin specific peptdiase 1 Usp1 1.174448 0.434394 -1387788 -2.673999837 1433.543 at arlin, actin binding protein (scraps homolog, Drosophila) Ann 1.174357 0.43373 -1.3613s 2.824O9073 1429171_a at RIKEN conA5730507HO5 gene 5730507HO5Rik 1258.515 0,331855 -1.317031 -3,922705189 1429172a at RIKEN coNA5730507HO5 gene 5730507H5Rik 1.159789 0.453345 -1.338732 2.342,728398 1417511 at Ly1 antibody reactive clone lyar 1.1177 o429345 -1.445813 254726.2038 1452315 at kinesin family member 11 Kf11 1.044004 0.829917 -133691 -2.224014995 1450157aat hyaluronan mediated motility receptor (RHAMM) Hmm. 1.027209 0.604696 -131651 -2800241311 1427541x at hyaluronan mediated motiaty receptor (RHAMM) Hmm. 1.191923 0.428943 -1.305787 -2.66576272 1453683 a at centrosomal protein 55 Cep55 0.885951. 0.652017 -1.422513 -218884.9023 1419253 at methylenetetrahydrofolate dehydrogenase (NAD+ dependent) Mfd2 1.195973 0.447534 -1.386.298 2.257553673 1419254 at methylenetetrahydrofolate dehydrogenase (NAD+ dependent) Mthf2. 1.205998 0.419996 -1.370173. -2546777548 1451382 at Chac, cation transport regulator:ke 1 (E. toll) Chack 1.13388 D652889 .407041 273S4O749 1428114 at solute carrier family 14 (urea transporter), member 1 Sc14a 0.531604 1239142 lost 9691 2.894546698


Figure 4E (cont.)

1428104 at 1448899 sat 14241.18aat 1450780s at 1450781 at 142285 at 1422460 at 1417938 at 1417910 at 1423775 sat 1423,774 a at 1434695 at 1434748 at 1419153 at 1424967 at 1418728 a at 1433893 s at 1449061aat 1452681 at 1429.295s at 1418026 at 1439012 a at 1449178aat 1423827 at 1452458s at 1422910s at 1427275 at 1419431 at 14492.17 at 145.0053 at 1431921 a at 1426402 at 1452659 at 1454631 at 1415723 at 1424205 at 1418431 at 1458112 at 1450889 at 14298.23 at 1418843 at 1419984 sat 1418563 at 1428616 at 1450954 at 1434.842s at 1420609 at 1417822 at 1426877 a at 1435.030 at 1423888 x at 1425472a at 1427061 at 1419397 at 141824 at 1424573 at 1426948 at 1426949 at 1427,197 at 1454872 at 1454.955 at 1418023 at 1418022 at 1424712 at 1434942 at 1418839 at 1453928 aat 1421534 at 1416O15 s at 1423982 at 1416014 at 1426271 at 1416859 at 1450950 at 1428087 at 1454038 a. at 1424574 at 1452197 at 1452157 at 1420918 at 1423919 at 1460403 at 1427278 at 1425082 sat

tx2, microtubule-associated proteinhomolog(xenopus laevis) RAD51 associated protein 1 spindle pole body component 25 homolog (S. cerevisiae) high mobility group A-hook 2 high mobity group AT-hook2 high mobility group AT-hook 2 MAD2 (mitotic arrest deficient, homolog-like 1 yeast) RAD51 associated protein cydin A2 protein regulator of cytokinesis 1 protein regulator of cytokinesis denticeless homolog(Drosophila) cytoskeleton associated protein2 RKN conA2810417H13 gene troponin T2, cardiac troponin T2, cardiac spen associated antigen 5 DNA primase, p49 subunit transferrin receptor thyroid homone receptor interactor 13 exonuclease 1 deoxycytidine kinase deoxycytidine kinase NAd(P)H dehydrogenase, quinone 1 peptidylpoylstomerase (cyclophian) like 5 SMC6 structural maintenance of chromosomes 6-like 1 (yeast) SMC4 structural maintenance of chromosomes 4-Eke i (yeast) epiregulin caspase 8 associated protein 2 kines.infamily member 2A st Talantigen 1 synaptotagmin binding, cytoplasmic RNA interacting protein DEK oncogene (DNA binding) RIKEN conA6330549HO3 gene eukaryotic translation initiation factors SWESNF related, marb associated, regulator of chromatin knesin family member 58 translocated promoter region SWISNF related, matrix associated, regulator of chromatin zinc fingerprotein 644 solute carrier family 30 (zinc transporter, member 4 zinc fingerprotein 844 Serpine1 mRNA binding protein zinc fingerprotein 131 YME1-like 1 (S. cerevisiae) UPF3 regulator of nonsense transcripts homologe yeast) membrane-associated ring finger (C3HC4)7 solute carrier family 12, member2 polybromo 1 UPF2 regulator of nonsense transcripts homolog (yeast) air. A artin A retiroblastoma binding protein 8 polymerase (DNA directed), alpha1 NMDA receptor-regulated gene 1 transmembrane emp24 protein transport domain containing 5 translocated promoter region translocated promoter region ataxiatelanglectasia and Rad3 related RKEN conAs230308N11 gene importin 7 NMDA receptor-regulated gene 1 NMDA receptor-regulated gene 1 AT hook containing transcription factor 1 RKEN conA2610101.03 gene gomulin, FKBP associated protein Sjogren syndrome antigen B fibroblast growth factor inducible 15 ATP-binding cassette, sub-family (OABP), member 1 FuS interacting protein (serine-argirdre rich) ATP-binding cassette, sub-family E(OABP), member 1 SMC5 structural maintenance of chromosomes 5-like 1 yeast) eukaryotic translatoriinitiation factor 3, subunit 10 (theta) chondroitin sulfate proteoglycan 8

ubiquitin specific peptidase 15 transmembrane emp24 protein transport domain containing 5 SMC4 structural mainterance of chromosomes 4-like 1 (yeast) glutamyl-prolyl-tRNA synthetase pre-mRNA processing factor 40 homolog A yeast) conA sequence BC023882 small nuclear RNA activating complex, polypeptide 3 SMC4 structural maintenange of chromosomes 4-like 1 (yeast) RIKEN cDNA 903O416H16 gene

Tpx2 Rad51 ap Spbc25 Hinga2 mga2

Hinga? Ma21 Rad51apt Cena2 P Pre D Ckap2 2814713rk

2 2

Spag5 Prin

. . . Trip13 Ex Ock Ok No1 Pp:15 SS1 Sma1 reg

Stag1 Syncip Dek S330549.03Rik Efs Smacas

6101013Rik Grin SSb Firs Ace1 Fusip1 Abe Sics Ess1 CSpg8 onrn Usp15 Treas Sinca1 eprs Prpi40a C2.382

Snapc3 Srrica1.

0.73747s O,83223 7s 85449

0.825844 98.3452

0.97f872 0.92409 1.12764 10437

1,030754 1.2394 1.198826 1.01228 1.06359 0.985344 0.553ss OSS3247 0.588278. 0.373573 0.28837 0.637908 0.5071 0.43837.2 O.33368 1.459.284 1.4385.42 1.3752 13.08471 14364 1.5899. .4S905

1.485.429 50834

1.4S334 15273 1.54527s 450849

1524259 1538.766 1.53504 1.535943 1999

1540.43 146321 157578 1444633 151481 152739 147.2011 1577B

1537,551 1.58491 1.38641s 42.245

1464988 1473.328 1.4B5279 146335s 1,372.277 1.49124 1.4214S2 1.441358 1.4s.2814 14301.97 1.522543 1485ss 1.533ss 1474843 1.485645 1.511919 1.4828.8 1503713 1475838 1,492345 1.45737 151547 1,522583

Jun. 3, 2010 Sheet 12 of 27

34241.80898 35OS3 -1585.13 23158 -15495S4

0.101188 .156323 O.1244s -1.5387 0.004194 -1502254 .135985 -1.54378 272s2 -1.572633

0,431B -1.4SS87 loos2862 - 1434989 0.0578-149746 .56965 1497348 0.238S9 -113 -0.40307 -1.36542 0.143631 -1,41418 0, 18188 -453634 0,839888 -1510339 0.74995-161374 0.674985 61139. 0.85313 -.599.18 0.4847 -1.6525 OSS532 -1580s? ossas -1574,023 42ss51-16338 37.292 -.558434 O1743 O.1652 0.953 as 18 O29258 -108598 397 -1.5993

o.243648.21582 c.1649ss -c.747.263 c. 1353ss o.20537 O.82498 0.89209

43153 -0.7722 0.5353 -0.69ss 2427 sats

oag O.721784 o,4837 -Osg39s 0.22344.753,963 0.044868 -0.29394 0.0625 -0.813489 0.7764 -0.7832.19 o.Onas -0.874592 -OOO662 -o,807,542 124969 -0.870.9

0.48472 0.789742 2 -o,4ssia

0.0344S -0.35794 0.018534 .3738 0.14S483 -088214 c.1392 -0.7sogos o.49142 c.87765 c.11777-17939 o.23748 -1.1s387 c.1652 -127917

s3897 -oos37. 0.6O42-0.98S558 c.13847s o.2268 ,263.34. Oss183 0.3587s logsta3 0.24293 .268 o, 14.g44-1844 0,13594 -1.00072 0.05557-4001965 0.14122 -100849 0.47827 0.88052s 0.05285 -354. -ooses c.987289

OS4264-0,990.728 3757 0.986,514

0.479 0.915641 -O,04435 -0.218

53572 of 2987 0.81788 .295 O,058 -083488 0.8588 -0.3895.2

0.038822 0.979.3 bossess -1.26814

1,528.206 -0.008869 1493.34.1 c.38 1463642 0,376 1.5155s -0.6951 1555227 .3582

0.90588 3959S

1.26527 0,950895 0.87.857

go3O418H16Rik 138431 O250822 0.94.252

US 2010/0135970 A1

2345288868 -2SO4O781 2473.35784 2.2258ss 2.45951s2 233333 -23ssists -2448052 2.2494484 23429sssss 2,24501329 2,320449S55 2.25445858 2,1493,35304 2.933oss 3.11528586 -2763.522 2.53S1915 3.2385674

2252O1573 -226653.454 2.1.245013 -2.1847.94574 2.1557.8235 22399,839 2.58034342 -3.3785.712 2.71s5948s

-23788S452. 2.13254.1448 24427.587 -21042,5342 3.327639 22ss381

2.83450725 23298.895 2078887688 -2.721287 23264438 226151284

2.67829.247 2,222994SS3 24821.73 -2.65437ss4 2,0582S75 2.2s1591s 2.2B3509491 2,094.376.471 2.28630744

21636893 2,202.98S47 2.877149319 -323077877.2 -3.868532636 -2374.945716 3.33.2608 -2.38873.6289 -2.881547939 -3.33OO929 2.84.10296.17 3.3356,537 2.3838.436 3.0997.331 2.23s2a3424 -3.36.27970s -20B192O767 2.38445,629 - 3.01234431 -2-867142505 3048947847 2.77.568327 -3,41639798 2399.53S421 2.718749

-2.181492.17 25076174 2.65.348.357 4.132.354.273 -242299.095 2.448112 3,32013.842 2,3928.128 3.6738447 . 2078802ss


Figure 4E (cont.)

1424642 at Thd complex 1 thoc1 1.382014 O.305326 -1.018848 -234551771 1428100 at splicing factor, arginineiserine-rich 1 (ASFISF2) SfS1 1,460152 0.165499 -0.88341. 2712570757 1428389 sai Wo repeat domain 43 WA3 1.404263 0.30935 -1.01999s -2301057235 1434787 at expressed sequence C79407 C7947 1408598 0.277689 -1.048382 -3.31sg 13141 1450938 at pinin Pnn 1.380127 0.162353 -0.906181 2,2085.0754 141B561 at eukaryotic translation initiation factor 3, subunit 10 (theta) E3s 1d 1.313142 0.265324-0.905662 2310.142929 1416650 at eukaryotic translation initiation factor 3, subunit 10 (theta) issio 1408708 0.171063 -0.859945 -22922B7334 1448425 at eukaryotic translation initiation fador 3, subunit 10 (theta) E3s10 1.390469 O.25D833 -0.96960s -232367315 1426985 at RIKEN cdNA281048505 gene 2B1048505Rik 1.40424 0.276218 0.658692 2.413SO951 1452627 at SUMOsentrin specific peptidase 8 Serps 1453043, d.133917 -0.553125 2.48577.3882 1416958 at nuclear receptor subfamily 1, group D, member 2 N2 1.390.438 0.24239 -0,680.762 23898425.99 1423773 at GC-rich promoter binding protein 1 Gpbp1 1381583 0.265562 -0.721895 261985.0435 1426671 a at RNA-binding region (RNP1, RRM) containing 2 Rnpc2 1.415 0.132022 -0.620474 -2.615359353 1438873 at solute carrier family 4, sodium bicarbonate cotransporter 7 Scaat 1420377 O.183728 -0.59244 2.130.023473 142884s at BCL2-associated transcription factor 1 Bclaf 14074 0.229025 -0.531701 2.5865.34881 147512 at ecotropic wantegration site 5 Ewis 1.374137 o265 -0.53961 2200503799 1452838 at DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 Ddx10 1.3394.17 O.367,744 0.716158 21619,51213 14531.98 at zinc fingerprotein 422, related sequence 1 Zip422-st 1.352783 0.26ssis -0.6.18768 2.1773:2288 1452268 at RIKEN cDNA2810485.05 gane 2810485DSRik" 1.425944 0.176474 -0.629378 2.331455648 1431804 a at trans-acting transcription factor 3 Sp3 1.425.319 O,099075 -0.668465 2.100.587242 1424398 at dEA (Asp-Glu-Ala-His) box polypeptide 36 Dh38 1.384589 0.171733 -0.655584 2,214745943 1420477 at nucleosome assembly protein 1-like 1 Nap11 1.381145 0.357357 -0.832798 2268547583 1428907 at RIKEN coNA2600011C06 game 260.001C06Rik 1,347104 0.383743 -0.878354 2777.22517 1433831 at eukaryotic translation initiation factor 5 Efs 1376,044 0.352053 0.90.432 211681499 1424206 at SWI/SNF related, matrix assodated, regulator of chromatin Smarcas 1375418 0.331997 -0.92336 -2.67308063 1424207 at SWISNFralated, matrix associated, regulator of chromatin Smarcas 1.3754C2 0.255413 -0.858976 2.4812.71967 1431748 a at ubiquitin-activating enzyme E1C Ubec 1.317928 0.387.195 -0.898.281 -2.160272951 145.0386 at karyopherin (importin) alpha 3 Kipriad 125778.3 0.485873 -0.953.293 -226,537885 1423275 at DEADIH (Asp-Glu-Ala-Asp/His) box polypeptide 26 Ox26 121975 0.597969 -0.95629 2.067729589 1421828 at karyopherin (importin) alpha 3 Kpna3 1267.281 0,54582 0.92S248 2.44131371 1449095 at vacuolar protein sorting 54 (yeast), Wps54 1.264,758 0.519.027-0,848224 2,216955655 1450039 at ubiquitin specific peptidase 9, X chromosome Usp9x 1305877 0.362052-074075 2,091112214 1420922 at utiquitin specific peptidase 9, X chromosome Usp9x 1.26O26 O.45.53S9 -0.7594SS -2,298,233832 1423322 at lin-7 homolog C (C. elegans) in7c 1362954 .45996 -0.845704 2.1.5225615 1424397 at DEA (Asp-Glu-Ala-lis) box polypeptide 38 Ox38 1.38783 0219599 0.791086 2.559285.42 1435164s at ubiquitin-activating enzyme E1C Ubec 1.404675 0215428 -0.82984 -2.405384254 1417202s at ubiquitin-activating enzyme E1C Ubec 1.380448 o.188545 -0.834911 2.462022117 1449708 sat checkpoint kinase 1 homolog (S. pombe) Chek1 1.327916 D.372315 -1035815 3.169326S72 1450677 a checkpoint kinase 1 homolog (S. pombe) Chek1 1.28444 0.41636 -1.125445 -3.34.1303281 1435333 at RIKEN cDNA 1110007M04 gene 1110007M04Rik 1,3411 1 0.3543441,09893 2.255988315 1417657 sat dnai (Hsp40) homolog, subfamily C, member 2 dnajce 131884 370267 -117s559 2,74040339 1450986 at nucleolar protein 5 No.5 1.298891 O.3704.5 - 176219 3,098995338 1423381 at YME1-like 1 (S. cerevisiae) Yg 1.329314 0.274547 -0.996253 -2135355324 1428844 a at BCL2-associated transcription factor 1 Bcaf 1.331062 O27935 -1.050354 2194S43376 1424033 at splicing factor, arginine/serine-rich 7 Sfrs 1.4O7814 0.2537 -1.068.33 -2083795873 1452731.x at NA NA 1.275122 C,480245 1,078083 -3.000004848 1428301 at NA NA 1.1954.82 0.54229 -1.222441 3,367549578 1424591 at RIKEN cDNA 5830433M19 gene 58.30433M19Rik 1.31306 0.37979 -11383.31 2.437788027 1424841a at THO complex 1 hoc1 1294847 0.46862 -1.137685 3.1262B379 1434459 at OTU domain containing 4 Otud4 1.24896.3 0.475.34 -1.08.1288 -2.092200366 1428908 at RIKEN cDNA2600011C06 gene 2500011C06Rik 1.24922 0.479019 -0.939045 -2.631757884 1428084 at HIV-1 Rey binding protein2 Hrb2 1285557 0.389.21 -1.015475 2.26412305 1424333 at RNA (guanine-9) Tethyltransferase domain containing rg9mtd 1 123951s 431281 -1.056 -2.1597.546 1456528 x at nucleolin Nc 1203098 os3.287 -1211157 2.38.04534 1452241 at topolsomerase (DNA) beta binding protein Topbp 1.1698.18 d537573 .1266s2g 2.585.459021 1433903 at mirror-image polydactyly gene i homolog(human) Mipol1 1.120603 OSS1717 -1.134964 2.0923.31657 1415773 at can Nic 1.61352 0578788 -1.14922 -2.595239351 1415771 at nucleolin Nc 1,181003 0.58475-1.15.3478 -2.60sosses4B 1454914 at RIKEN cDNA2610101N10 gene 2810101N1ORK 1.0454.03 0.7s502 -1.120625 22689297B 1434488 at OTU domain containing 4 Otud4 1259667 0.411787.1.207143 2,304274,778 1434215 at RIKEN conAa230308N11 gene B230308N1 Rik 1204285 os3883 -1.155863 -2.537929.306 1428262s at heterogeneous nuclear ribonucleoprotein A3 Hnpa3 1.179703 d519646 -1.287537 2.1570.54227 1454683 at eukaryotic translation initiation factor 5 Efs 1.232758 0.432937.1.193295 2.11624.3731 1451184 st heterogeneous nuclear ribonucleoprotein A3 Hnpa3 1.146763 0.483776 -1.304742 22505273 1438278 a at conA sequence BCCO3993 BC003993 1.332564 0.394871 -1.03211 -2.3164.57579 145.5434a at kinectin Kt1 1355922 0.3837.27 -0.87.337 2.799615345 1420441 at centromere autoantigen C1 Cenpc1 133499 o,37453 -0.985993 -2.393.20989 1421058 at alcoholdehydrogenase 7(dass IV), mu or sigma polypeptide Ach? 1.271737 o.491323 -1.090245 2.176307015 1423181s at Sprouty protein with eVH-1 domain 1, related sequence Spred1 1.321593 0.403533 -1.09932 -2.226775203 1429491s at Rap1 interacting factor 1 homologyeast) Rif1 1.277.168 0.51051 - 1,13536s -3.58.1490552 1454831 at forkheadboxN2 Fox2 202724 0.549229 - 1.148285 2.151124.309 1449338a at STE20-like kinase (yeast) Sk, 1.487975 0.252795 -1.05915 -2.66496766 1417928 at leucine zipper protein 5 Luzp5 1517236 -0.27404 -1021273 3,989203467 1435162 at protein kinase, coMP-dependent type Prixg2 1.496948 -0.264334 -1.01537s 3.297.31258 1426817 at antigen identified by monoclonal antibody K67 MikiS7 1.465299-0.101695 -1.115.454 4.05096.2114 1418264 at SaxtZiSox6 laucine zipper binding protein in tests Solt 1,451074 -0.195056 -1.123344 2.76.0733.54 1421945aat brix domain containing 1 Bxdc1 1.467756 -0.45747 -1.127482 -2.297O681.99 1435341 at peptidyl-polyl isomerase G(cyclophilin G) Ppig 14923 -0.048.155 - 1,051679 -249087.0114 1427062 at ratinoblastoma binding protein 8 Rbbp8 1.458825 -0.01597 -1.13062 2.579299,288 1434941s at RIKEN cDNA2610101.JO3 gene 260103Rik 1.46016 0.08386 -1.09459 -3,123408878 1435390 at RIKEN conA 4933424NO9 gens 493.3424NO9Rik 1434858 -0.003057 -1.124436 -2.083317388 1420B27aat cyclin G1 Cong1, 1,334429 -0.063478 -1.245299 2056.0444S2 1428.570 at cyclin C Ccic 1.321296 -0.008766 .291649 2.105.393551 145.0017 at cyclin G Ccing 1 124038 0.053892 -1.270268 2.24352600s


Figure 4E (cont.)

1416858 a at FK506 binding protein 3 Fkbp3 1359607 -0.031412-1098893 -243633S358 1416859 at FK506 binding protein 3 Fkbp3 1.322823 0.04173 -1.132457 2.4773598.34 1452047 at calcyclin binding protein Cacybp. 1394084 0.12g293 -1.1338 24352.78435 1417771a at proteasome (prosome, macropain)26S subunit ATPase, 6 Psres 1430907 -0.029326 -1.08.255 -2.5437943.05 1422979 at suppressor of variegation 3-9 homolog2(Drosophila) Suw892 1275365 0.28O851 -1.31807 -239294.7337 1453748 at at kinesin family manber23 K23 1268468 0.174574.132738 260642831 1423524 at microtubule assodated serine/threonine kinase-like Mast 1.33254 .227988 -1220779 2465913974 1455990 at kinesin family member 23 Kf23 227509 O.255.509 -1.357845 -229O107038 1449348 at membrane protein, palmitoylated 6 (MAGUK p55 subfamily 6) Mpps 1276121 D.144188 -1.3539s1 -2797.402171 1455.488 at riKEN conA6230416J20 gene 6230416J20Rik 1.33781 0.077584 -1.295.722 -3.468527442 14241.58 at retinoblastoma-like 1 (p107) RD 1.296007 0.062867 -1.358985 2.98.3813744 1426580 at polo-like kinase 4 (Drosophila) Plk4 1.3431 0.116682-1295.991 -3,088,278.898 141983Bs at polo-like kinase 4 (Drosophila) Pika 1.267336 0.20192 -1.3842 3,527394048 1417445 at kinetochore associated 2 Kntc2 1273681 0.180795-1293481 -27337,18926 1418299 at Shc SH2-domain binding protein 1 Shchp1 1,30219 0.193317 -1.314959 -3,166531.33 1423874 at Liblaritin specific peptidase 1 Usp1 1.273247 0.269381 -1.286157 -2.426021346 1429.080 at M-phase phosphoprotein 10(U3 small nucleolar ribonucleoprotein) Mphosph10 1349894 0.21841 -1.195768 287S5399 1428349s at thymopoietin Tripo 1.421822 0.02074 -1.1793.14 2.47.009995 14496998 at RIKEN cDNAC330027C09 gene C33027Cogrk .388943 O. 119271 -1223,061 4.755763 145.0423 sat brix domain containing 1 Bxdc1 1.414332 0.1428151.1595.67 257558412 1422814 at asp (abnormat spindle-like,microcephaly associated (Drosophila) Aspin 1.352968 d. 180945-1203369 -3.469768674 1452314 at kinesin family member 11 Kf11 1313749 0,345908 -247046 253,2063961 1425350a at myelin basic protein expression factor 2, repressor Myer2 1353686 0.251513.1.18677 -2.679498.21 1430982 at splicing factor, arginine?sarine-rich 1 (ASFISF2) Sfis1 1.224897 0.249.423 -1326419 -2.186908465 1423675 at ubiquitin specific peptdiese 1 Usp1 1.199992 0,380583 -1287167 267381415 1416705 at ribulose-5-phosphate-3-epimerase Rpe 12912.18 0.22123 -1135834 -2.115875578 1428194 at ubiquitin specific peptidase 9, X chromosome Usp9x 1.24879 0.516484 -0.703178 -2.230206.884 1433585 at transportin 1 Tnpo1 1.275065 0.488059 0712079 2.432125592 1423193 at ubiquitin specific peptidase 9, X chromosome Usp9x 1286.338 0457985-0,604012 -2.275800865 1425020 at UBX domain containing 4 Ubixd4 1.162119 0.638973 -0.75,195 -2.205603166 1452247 at fragile Xmental retardation gene 1, autosomalhomolog Fx1h 1.098372 0.712998 0.831955 -2.236721984 144997.28 at zinc finger protein 97 Zipg7 1.09983 0.702822 -0.738807 2.2883.20058 1449519 at growth arrest and DNA-damage-inducible 45alpha Gadd45a 1.23S346 0.571272 -0.708613 -2.2998.2909 1437867 at NA NA 1020092 oboe?45 0.667795 2.212274.96 1426D65 at tribbles homolog 3 (Drosophia) 3. 1, 18957 0681380,989848 2.95.354802 1456225x at tribbles homolog 3 (Drosophila) fits 1.190257 0.6s272 -1.032399 -3,07472.399 1426556 at suppressor of hairy wing homolog 4 (Drosophila) Shiwa 1278207 0.492.713 0.88232 2,1843475.46 1423194 at Rho GTPase activating protein 5 A?hgap5 1606443.0.286550.677378. 2.125380494 1423010 at sacsin Sacs 1.530402 -0.388975-0.671933 2258872.309 1426270 at SMC5 structural maintenance of chromosomes 5-like 1 (yeast) Stics1 1.6.27443 0.417504 -oss3.85 -2.520O29055 1434958 at sacsin Sacs 1.621628 0.347764 O.849332 3.22932,768 1426832 at RIKEN coNA6330505F04 gene 633,505FO4REk 1.600906 -0.407321 -0.741.73 2.221117124 14301.47a at osephin domain containing 3 Jos3 1.572808 -0.210415 -.784237 2.7423551 1436222 at growth arrest specific 5 Gas5 1.538.723 -0.176852 -0.83OS4S -3.106267988 1436871 at splicing factor, arginine?serine-rich 7 Sfs 1.600886 -0.38795 O.S3B538 -277.4.313517 1450090 at zinc fingerprotein 101 Zip101 1.587278 -0.180027 -0.7962.43 -2.6928.75883 1418421 ast. Sjogren syndrome antigenB Ssb 1554502 -0.206115-c.77372s 2.87187002 1423198aat expressed sequence AWO11752 AWO11752 1554051 -0.226822 -0.703809 2.449161555 1450900 at expressed sequence AWO11752 AW.1752 1.59.6236 -0.2992S4 -0.797341 -2525.477792 1428478 at RAS p21 protein activator 1 Rasa 1.584635 -0.342008-0720759 287556554 423325 st prin Pn 545978 -0.212724 -0.835ss -23497739 1417239 at cert? 3 Ce3 1.53887 -0.308224 0.895795 -236570356 1422653 at centrosomal protein 70 Cep70 164344 0.253696 0.674558 2.376837831 1417738 at SMC6 structural maintenance of chromosomes 6-like 1 (yeast) Smics11 1.578558 -0.181545 -0.7299 2.596731215 1449090-aat Yamaguchi sarcomaviral (v-yes) oncogene homolog Yes 1.596573 -0, 182745 -0.782754 -2.5385,55585 1448829 at SMC6 structural maintenance of chromosomes 6-like 1 (yeast) Sncs1 1.599905 -0.242447 -0.685.194 -288704741 1430271.x at osephin domain containing 3 Josd3 16O2018 0.336808 -0.715052 2.71931.6836 1434.604 at eukaryotic translation initiation factor 5B Elfsb 1.572266 -0.2957 0.92289 -2.27.2016794 14488.28 at SMC8 structural maintenance of chromosomes 6-like 1 (yeast) Sinces 1.582,826 -0.234781 -0.870998 -3.255860959 1423395 sat eukaryotic translation initiation factor 3, subunit 1 alpha Effss1 1552573 -0.2022 -0.870.393 -2.243.255675 1416422 a al Sogen syndrome antigens Ssb 158148 0.1994.05 -0.82572 -2.212263.192 1451485 at riKEN conA3300001 P08 gene 3300001PO8REk 1,552302 -0.128712 -0.82666 -2.272963031 141B162 at toll-like receptor 4 4 1.SS8848 -0.165442 -0.88S994 -2.61093934 1418427 at kinesin family member 5B Kfsb 1.5352 0.033404 -0.789988 2.213 9804 1418429 at kinesin family member 58 Kifsb 1.545299 O.190178-0.684987 2654508252 1416681 at ubiquitin protein gase E3A Ubesa 1.590385 -0.455.25-0.752s22 20872.3054 1424.324 at establishment of cohesion 1 homolog 1 (S. caravisiae) Esco 1.556BS7 -0.358125 0.764065 -2.18348.7235 1452009 at RIKEN cDNA 9130422G05 gene 9130422G05Rik 1.515911 -0.248421 -0.898599 2.10694.1056 1454703 x at RNA U22 small nucleolar Ru22 1,592159 -0.48810s 0.81761 -2,830,22698 1437858aat RNA U22 small nucleolar Rue2 1,561011 -0.405988-0927335 -3,148147S72 1424843a at growthamest specific 5 Gas5 151716 -0.341124 O.86849 2.80973483 1424752x at zinc ?ingerprotein 71, related sequence 1 Z?p71-st 1.505016 -0.030478 -0.66915.4 2.231046377 1423197a at expressed sequence AWO11752 AWO11752 1,582458 -0.203533 -0.684412 -2.51726.8536 1424107 at kinesin family member 18A Kf18a 1.566496 -0.09521s. 0.91829 2529236525 1424872 at RIKEN cDNA2310001H12 gene 2310001H12Rik 1612086 -0.425157 0.503461 2.14974345 1455698 a at PRP4 pre-mRNA processing factor 4 homolog B (yeast) Pipf4b 16O1193 -0.333478 -0.528029 3.11356.478 1454074 a at RIKEN conA 1500011.J06 gene 150001106Rik 1560972 -0.314478 -0.4s.2103 -2553.174667 1452997 at RIKEN cDNA261.0005LO7 gene 26100057Rik 5.8563 -0.478893 -0.33773 -2410.05876 1428487 at TARDNA binding protein Tardbp 1559.427 0.287.13 -o,573174 2506294.693 1433830 at heterogeneous nuclear ribonucleoprotein A2/81 himpa2b 1504661 -0.253s2 -0.508555 25050716 1426124a at CDC-like kinase 1 Clk 1.498698 -0.198183 -0.533,214 2,50570945 1424802 aat RIKEN cDNA 3300001.PDB gene 330001-08REk 1.558233 -0.245845 -0.650948 -2.585883778 1415872 at heterogeneous nuclearibonucleoprotein H1 Hnph1 . . 1.512871 -0.2335-0.594416 . .-2,075237907

2329155907 1452080 eat DCUN101 DCN1, defective in cuttin meddylation 1 Ocud 1.547174 0.274987 -0.65434


Figure 4E (cont.)

1450874 at Tatrín 3 Matrs 1421882 aat ELAV(embryonic lethal, abnormal vision, (Huantigens) Eaw2 1438714 at zinc finger protein2O7 Zip2O7 1417791a at zinc finger, matrin-like an 1435768 at ATrich Interactive domain 48 (Rbp like) A?id4 1452299 at Woomain containing 3 ubiquitinproteinigase 1 Wp1 1452774 at heterogeneous nuclear ribonucleoprotein A3 Hnrpa3 142971C at phosphosierine/thraonina?tyrosine interaction protein Styx 1450396 at stroma antigen 2 Stag2 1454610 at septin 7-Sep 1420907 at CD2-associated protein Cd2ap 1451730 at zinc finger protein 62 Zip62 1420908 at CD2-associated protein Cd2ap 1451840 a at RIKEN conA 1500011Josgana 150001106RIk 1456651a at translocated promoter region Tp 1417168 at PC4 and SFRS1 interacting protein 1 Psip 1426419 at RIKEN conA1700009PO3 gene 17oooogPO3Rik 1424.637s at RIKEN conA281020423 gene 251204.23Rik 1428088 at dynamin 1-like drin t450937 at in-7 homolog C(C. elegans) inc 1418007 at RIKEN conA1B10007M14 gene 1807M14Rik 1435139 at NMDA recepto?-regulated gene 1 Narg1 1427134 at spicing factor, arginineiserine-rich 12 Srs12 1423324 at plmin Pn 1438397aat RNA-binding region (RNP1, RRM containing 2 Rrpe2 142971 at phosphoserine/threonine?tyrosine interaction protein Styx 1428374 at glucuronyi C5-epimerase Glce 1426878 at polybromo 1 Pb 1424431 at chondroitin sulfate GalNAcT-2 Ganac.2 1450420 at stromal antigen 1 Stag1 1423131st RIKEN conA5730427NO9 gene 5730.427NO9REk 1423432 at peckstrinhomology domain interacting protein Phip 1425977aat STE20-like kinase (yeast) Sk 1427982 8 at synaptic nuclear ervelope2 Syne2 1438859 at RIKEN coNA2700007P21 gene 270000721R 1423459 at COP9 (constitutive photomorphogenic) Cops2 1416680 at ubiquitin protein gase E3A Utesa 1423369 at fragile X mental retardation syndrome 1 homolog Fmr1 1418942 at intrefagellar transportfA homolog (Chlamydomonas) f74 1450994 at Rho-associated colled-coil forming kinase 1 Rock 1450690 at RAN binding protein2 Ranbp2 1416799 at transient receptor potential cation channel, subfamily M, 7 Trpm7 1422621 at RAN binding protein2 Ranbp2 1433531 at acyl-CoA synthetase long-chain family member 4 Acs4 1417983a at ubiquitin-conjugating enzyme E2 variant2 Use2W2 1435315s at RIKEN conA2900034E22 gene 2000.34E22Rik 1427983 at suppressor of hairy wing homolog3 (Drosophila) Suhw3 1427141 at RIKEN conA 2700099C8 gene 27000998REk 1439399 at at RNA U22 small nucleolar R22 14177708 at proteasome (prosome, macropain)26S subunit, ATPase, 6 Psics 1424292 at DEP domain containing a Depdc1a 145104 at Rho-assodated collad-octl forming kinase 2 Rock2 1418911 at acyl-CoA synthetase long-chain family member 4 Acs4 1455.433at NA MGC107,415 1421139 a at zinc finger protein 386 (Kruppal-Ike) Zip386 1418960 at beta-2 microglobulin 32 1417077 at B-cell receptor-associated protein 29 Bcap29 1424589 sat RNA-binding region (RNP1, RRM) containing 3 Rrpc3 1423444 at Rho-associated colled-colt forming kinase 1 Rock 1428O11a at Erbb2 interacting protein Erbb2p 1421849 at stromal antigen 2 Stag2 145584 at MOB1. Mps. One Binderkinase activator-Ike 1A (yeast) Mobk1a. 1437039 at COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidop Cops2 1428172 at PRP39 pre-mRNA processing factor 39 homolog (yeast) Prp?39 1426840 st YTH domain family 3 Ythis 1437461s at RNA-binding region (RNP1, RRM) containing 3 Rrpc3 1450897 at Rho GTPase activating protein 5 Ajhgap5 1423592 at Rho-associated colled-coil foming kinase 2 Rocka 1437696 at cDNA sequence BC049807 BC49.807 1424708 at zinc fingerprotein 51 Zip51 1437634 at THO complex2 Thoc2 1433999 at STE20-like kinase (yeast) Sk 1437995 x at septin? 7-Sep 1424139 at RAS-related protein-1a Rap1a 1418859 at TPA regulatedlocus Tpart 1455954 a at DCUN1D1 DCN1, defective in culin reddylation 1 (S. cerevisiae). Dcun1d 1 1438045 at early endosome antigen 1 Eea 1416818 at NEMA (rever in mitosis gene a-related expressed kinase 7 Nek 1437533 at baculoviral APrepeat-containing 4 Birta 1450898 at Rho GTPase activating protein 5 A?hgap5 1416731 at topolsomerase (DNA) libeta Top2b 1423445 at Rho-associated colled-oc) forming kinase 1 Rock 1438736 at THO complax2 Thoc2 1418524 at percentriolar material 1 Peni

Jun. 3, 2010 Sheet 15 of 27

1.55636 -0.3639-545032 1,55876 -0.25665 0.479.126

1.537049 -0.4.13344 -0.275.282 1.565818 -0.17062-0501208 15323760,149569 0.4850.58 1.51802 0.019207 -0.59598

1.5.19737 -0.3152 -0.498.287 1.568124-0, 152848 -0.551373 155372 -0.248699 -0.524264 1578757 0.296745 -0.48254 1.581093-0, 193041 -0.604301 156068 -0.13809 -0.524402

1550575-0.145994 -0.624829 1.521993 -0.147.241 -0.46952 1.52372 -0.123587 -0.679077

1.545473 -0.090741 -0.73075 1.520232 -0.138.515-0.741394 1494.175 0071307-0635427 1.523822 -0.177528 -0.635369 1,458989 0.02383 -0.664159 1485.150,060378 0.74.09 148679-0003357 -oosas

1.523549 -0.20351s. 0.682O6 1505969 -0.20723 -82428 1.390815 0.103.195 -0.702922 161414 - 238.338 -0.59944 1572145 -0.144799 -o,511426 1594578 -0.33241 -0.456003 151245 -0.137733 -0.472671

1.5472590,227677 -0.4943 .5357 -0.154568 0.327325 1.522156 -0.170759 -o.42147s 1.568569 0.49695 c.76679 1.562139 -0.522.308 -82782 1.58278 -0.435927 of 4767 1.5627 0.453738 -o,685.191 160636 -0.623554 -O,545308 1.60241 -0.595.284 -0.585218

1.617975 -0.597,385 -0.541474 1.61739 -0.527.13s.571142 1.570.587 -0.643051 054736 1.597811 -0.584974 -0.583364 1.597727-0,607659 -c.5781ss 15821.87 -c.581655 -0.592691 1.59655S-0.605484 -0.645651 180835 -0.456517 -0.7.1.245 1,62109 -0.54085 -0.708285 1635022 -0.477559 setsa7 1.591457 -0.646391 -c.56264 1,586539 -0.406435 067.4276 1.603956.0,518238 714163 1,6091830,394.818 -0.23758 1538,221 -0.486167 -0.54S718 1.547393 -0.577s56 5s.1262 1.549204 -0.642738 -0.401502 1.588.632 -0.688749 -0.484972 1.58409 -0.719418 -0.49574 157083 -0.38391 -54992 1.58074 -0.4481 0.453324 158945 -0.417369 O.252555 1.583.39 -0.407677 -0.3848

1,553S48 0298987 -0.546858 1.604234 -0.561787 -0.431862 15998.57 -c.563333 -3s2103 160914 -0.5129 -0.35048 1608774 -0.502494 -0.57801 1823928 -0.595OBs -5295 1641164 0.4774S4 -0.5S320 1,634545 -0.503549 -0.456s2 1.641737 -0.545448 0456599 1.634834 0.497.528 -0.5041.95 1.607176 -0.480507 -0.513252 1624896 -0.4558O3 -0.514004 1.623649 -0.525299-0472206 1.617975 -0.473158 -o,5976.94 1.69404 -0.435295 -.500858 1.524809 -0.495942 -0.542968 1,603563 -0.504742 -0.496461 1.596.01 -0.380.252 -0.483.38

1,631619 -0.527392 -0.523424 1603672 -0.45.3755 -0.538,213 1624856 -0.373O88 -0.626836 1,604.193 -0.39634 -0.552676 1,619732 -0.573157 0.366125

US 2010/0135970 A1

-2.37757241s 216749884

-2.232172815 -2.52001155

-257254.4272 2,41348.3685 -2400577484 2,473505525 -2.42985.5555 2,6441792.95 -2.52580.1246 -2.64565119

-2.25923.9653 2517794553 -2.767986749 -3,5042945.5 -2070505925 2.29003195

2,514630575 2.452706033 2,712837794 2.42.4854634. 2233073974 ..a62419,3344 2.12981526 -2057486999 223912893 -2.1945.92369 -2.105473.338 -2.296443184 2.107243748 2.4374099.46 -2.299774568 -2.350651384 -238995924 2.5812s63 -227.7594988 2.57.0248239 2.43990576 -2.518609357 -2.6526084

-2.644571081 2770884655 2.39487.2276 -3.348313187 2,574719841 -3.012957305 -2.687815856 2,143125,211 2.82400697 3.298265274 2,308804347 2.22624541 -2.6740498.35 2C938,201

2.41036717 -24.30875.543 2.177111524 -2.504913192 -231827679 2433246.227 2.117657034 -2.524.84947 2.90.4852251 -2.0754429

-2,356344141 2.980.279483

-2.251.181088 -3.247457419 2.3899.12237 -2.689976157 2.102142932 225871288 -2.1205780.29 -2.60844193 2.6867569 2.9650.1624 2,506.559 2.83101827 2,780.079367 -2.2769940.83 -2.87.0954793 2,335700.974 2.112531107

Patent Application Publication Jun. 3, 2010 Sheet 16 of 27

Figure 4E (cont.)

1437218 at RIKEN conA A4301.0612 gene A4301s12Rk 1452128 at zinc finger protein 160 Zip160 1433.540 at far upstream element (FUS) binding protein 1 Fubp 1452688 at PRP39 pre-mRNA processing factor 39 homologyeast) Pipfgg 1428171st PRP39pre-mRNA processing factor 39 homologyeast) Prp?39 1418152 at nudeosome binding protein Nsbpt 1453.59 at conA sequence BC003267 accos257 1427,518 at conA sequence D10627 1627 1418772 at conA sequence BCO16423 BC16423 1449929 at dynein light chain Tctex-type 3 Dyria 1456388 at RNA-binding region (RNP1, RRM) containing 2 rnpc2 1434513 at NA NA 1434.888 a at matrin 3 Mats 1454S52 at zinc fingerprotein 265 zip265 1451146 at zinc fingerprotein 386 (Kruppel-like) 2386 1420514 at transmembrane protein 47 me47 1449414 at zinc fingerprotein 53 Zip53 1417327 at cawedir2 Cawa 14803D3 at nuclearraceptor subfamily 3, group C, member 1 N31 1426477 at RAS p21 protein activator 1 Rasa 1438695 at ubiquitin proteinigass 3A Ubea 1449292 at RBriducible collec-co R1c1 142205 at ataxiatelangiectasia mutated homolog(human) At 1423577 at ankyrin repeat domain 32 Akt2 1437543 at far upstream element (FUSE binding protein 1 Futp1 1437917 at RIKEN conACS3DD37H12 gene soo3712Rik 1439079 aat Ertib2 interacting protein Erbb2p 1434391 at expressed sequence A5C3316 A5336 1434390 at expressed sequence A503316 ASC338 1427.018 at RIKEN conA 493243BA13 gene 4932438A13REk 1434471st coMA sequence BCOC3331 BC333 1420948s at alpha thalassemiamental retardation syndrome homolog(human) Air 1438427 at PRP4 pre-mRNA processing factor 4 horndoge (yeast) Prpfab 1439040 at centramere proteine Cenpa 14351.84 at naturetic peptide receptor 3 Npr3 1422916 at fibroblast growth factor21 Fg21 142637 at male steristy domain containing 2 se 1423369 at male sterility domain containing 2 Msta 1426712 at solute carrier family6 (neurotransmitter transporter, member 15 Sca15 1453550 a at male sterility domain contalning 2 Mist 1426370 at male starity domain containing 2 Msta 1424.507 at Ras and Ranteractor R 1422535 at cycline2 Cena 1424942 aat myelocytomatosis oncogene Myc 1427161st centromere autoantigen F Cenpf 1438945 at gap junction membrane channel protein alpha 1 Ga1 1437992 at gap junction membrane channel protein alpha1 Ga1 1423820 at RIKEN conA261052BM 18 gene 2615288Risk 1415800 at gap junction membrane channel protein alpha1 Gjat 1422944 ast daphanicus homolog3 (Drosophila) Diap3 1417283 at prostaglandin-endoperodde synthase 2 Ptgs2 1417262 at prostagiardin-endoperodds synthase 2 Ptgs2 1439.483 at expressed sequence A506816 ASS88 1427346 at ovary testis transcribed Ot 142647 at zinc finger protein 52 Zips2 1420991 at ankyrin repeat domain 1(cardiac muscle) Ark 1420992 at ankyrin repeat domain (cardiac muscle) Akt 1422053 at inhibin beta-A Inhiba 1449885 at transmembrane protein 47 ne 1426544a at tetratricopeptide repeat domain 14 14 1416904 at musdebindice 1 (Drosophia) r1 1426472 at zinc fingerprotein 52 Zip52 1422828 at RIKEN conA 4532417K18 gene 4.32478Rik 1451469 at RIKEN. cDNA d53000517 gens 53doostrik 1426301 at activated leukocyte cell adhesion molecule Aca 1426300 at activated leukocyte cell adhesion molecule Alcar 1421871 at S3-binding domain glutamic acid-rich protein like Sh3bgri 1428.107 at SH3-binding domain glutamic acid-rich protein like Sh3bgr 1435977 at transmembranes superfamily member 1 Issf 1419247 at regulator of G-protein signaling 2 Rgs2 1419248 at regulator of G-protein sigrating 2. Rgs2 1418293 at interferon-induced protein with tetratricopeptide repeats 2 ft2 1448558aat phospholipase A2, group IVA (cytosolic, calciurn-dependent) Pa2g4a 1435137s at RIKEN conA 1200016E24 gene 2006E24Rik 14221698 at brain derived neurotrophic factor Bf 1419152 at RKEN conA2810417H13 gene 2804113rk 1449.033 at tumor necross factor receptor superfamily, member 11b infrsf1 1418492 at gremlin 2homolog, cysteine knot superfamily Xenopus laevis) Srein 1425858 at CD109 antigen cdos 1448182a at CO24a antigen C24a 14375C2x at CO24a antigen C24a

aslaloglycoprotein receptor 1 Asg1 1421944 a at

sa7s 539537 c.37676 159719 lossess -0.50346 1,583107 -0.580616 -0.486158 161592,650945-428799 1525592 -O.S1483 -0.45SS9 1630s -0.5595 -0.697.229 58922 .553285 -0.5772se 5833 -0.40758 -0.75:19 .556904 .3450s -ossO39s S360,795.520,279

1.587s24 -0.286 -0.222251 15824s -0.58967 -0.357669 .s0824s -6547 -o,352.87 1588S720.sbs2 0.37315

59.622 25 .4318 1.6553 -0.8257s2 0.43935

1.573872 -0.80O881 -0.32864 157874 .858s .32288 1.554s 6985.4 c.3971 S3834. 53484 -.5132

1.587.507 -0.71489-0380926 so?495 0.40271 -0.30433

1593.68 0.56154 0.75.655 15667 -o.47358 -o,7388 1.559544 -0.8244 -0.16941 1.544934 -g349 -0.13528 1586910,852 02088 1.54945 0.82s2 .35882 1572 offs .4375 60387s 68809 -0.278,769

1592:35 -0.61113 -0.27120s 1558.48s S4631 O.38743 1.5932 .58735 -38.33 155340s 54.21 0.287s sts 15 0.43529 Os3322

1.550458 0.0883 0.74.108 158365 0664554 0.87133 1.49539s -os925ss -0.79542s 14582 -533, -93772 23,515 .332914 -1.13568s

12S3482 .431634 -1153,212 1445. 405-1.6123 1.43158 0.375.35 -1.11654 1.474981 -0.24554 -1.1542 49522 O.34884 -959 3.53S4S .373S -1.24832

13675 -0.17892 -1285.41 13915 -c.181382 -1228013 1.4095 b,34S42 1.1539 1.4423ss -oss56 -1.1598.39 1.376.88 50s.O4 -1587 13555 Osg399 -187682 12.SS371 .55442 1.3837 4assis -15737 -.47284

1.5648 0.7843 -0.572.79 1.541212 c.1975 -c.563 154038 0.933788 0.55806 sa477 og2sos -ossess

1.492.14 -1487 -0.43242s 1,55442 -0.963359 -0.333739 1515642 -1.05403 -0.372346 1.59580s -0.888222-0.457.727 1s2 of sasa -ossBas

1.5757ss s452 c.1765 1.566983 0.961s2 0,147 1,51433, -91528 .308364 1.37444 -12355 Ossss 1477 -1232312 cosas 13

1.451376 -1.14016a O.031428 1,325462 -135863 -0.032 1.349782 -1.337.913 -0.026525 1.30382 -1.06499 -0.665265

1.371s28 0.886325 0.819847 29942 - 1,16394 -0.570348

1461802 -,972 -o,665573 3SS3B -485 .O.S4908s

1.354.643 -1,441 -0.58031s. Os3S46 -143473 .292 1895.56 -14s657 c.156923 0.7226ssosoroa ob19 0.735991 D.2053-08904 1,01033 -1.08094 -0.8894O2

US 2010/0135970 A1

2.92.7ss36 -2.128058.448 2,63884.38

2.755850.34 28.00992918 -3.3232294 242s25

-2s623815 2.82981435 -2075874514 -23784Bs269 2.4381.83 2227.35859 25.4920227 -25300.885 3.1164373

-2.2S2882 4S32047 2.74852 2.558377 2.4452442 2.OSOS483.89 252.5591536 2724284489 -20679456 23S12947 2.2962ss -261161,834 3,471s1587 21327.54S5 22899.404 2.6798 2.779545 -220915233 3,5881325 -2.42892653 2,66880639 3.033224 -2S4560SSOs -203.58.123 2.46958 2.05ss4677 2.871stress 2,083.43.432 3.SS3981 2.17136337 223S2C919 3.11532.74 2.74s.247 25972817 -3.36S2323 4,869781908 2.30836.53 2.45804SS59 3,387368 231505ss 2.538054 22823.345 -2415383 2.852497 2.70.124s -27813256B 24.545458 2.520998 -266502596

-2.269109806 -2,303697.365 -23981684s 2,36751548 -2.15016715 -2.2756ss 2.06522.985 28SS9092

2.1257173 -2.104.197482 -2.112095274 2.955938157 2.244468 2.5.223967 2.1907s25s 222SO9338

-3.000525229


PrSet 1415671 at 1424263 at 1419883s at 1416831 at 1437835 a. at 1455930 at 1415900 a at 1436050 xat 1423424 at 1418528aat 1430355 a at 1423468 at 1424740 at 1424741 at 1449875 sat 1415928 at 1415929 at 1453,960 aat 142B942 st 1417108 at 1415999 at 1424.728 at 1422478 at 1439030 at 1419979 at 1448905 at 1431385 at 1423495 at 145837 at 1417071s at 1416968 at 1423075 at 1443200 at 1416274 at 141837 at 1452148 at 1426894 sat 1426697 at 1451204 at 1452770 at 1426313 at 1417945 at 1424,523 at 1415907 at 1450699 at 1450955 sat 1418331 at 14483.08 at 144973 s at 1420038 at 1449376 at 1418607 at 1454268 a at 1416948 eat 14561 xat 1422466 at 1415981 at 1424828aat 145478 at 1425344 at 145167B at 1417492 at 1448754 at 1418133 at 1422587 at 14 18072 at 1436928 at 1426083a at 1426893 at 1423518 aat 1448415 a. at 141298 at 144B291 at 1450117 at 1431843 a at 1421014a at 1423362 at 141749 at 1416552 at 1427143 at 14481.94 a at 1424295 at

Jun. 3, 2010 Sheet 17 of 27

Figure 4F

Table S4: List of transcripts upregulated in D3 and 3T3ID3 cells compared to 3T3 control cells see Nans Gene Symbol 3T3 3. 333 ATPase, transporting, lysosomal WO subunit D1 Atpévod1 -82.761 .45385s o.41037 RKENcDNA281.0003C17 gene 280003C17REk -1.618764 0680515 0.31265 ATPase, H+ transporting, lysosomal V1 subunit 82 Atpév1b2 -S4492 SO314 .39)943 nearlridase Nsu -58453 F3s2 c.10127 RIKEN cDNAOS10011L14 gene 0600114rik -1557373 0.534694 0.151952 NA NA 3S2579 1.12459 .29802 kit oncogene Kit -1.543s. O.12S327 97.4888 halry and enhancer of splits (Drosophila) Hess -15857 0.349842 0.81942 zinc fingerprotein of the cerebellum 3 -552.43 0.18344 .988262 defender against cell death 1 a1 -56B911 .248s 97.122 STEAP family member 3 Steap3 -156433 .42 stoa STEAP family member 3 Steap3 -5895S 265783 0.854697 cAMP responsive element binding protein 3 Ce3 -SSOS 4BS 902484 cAMP responsive element binding protein 3 Cres -152337 (.344, 1.287 histocompatibility 2, region locus 10 2-o 494,518 0.295.096 1,6479 Ticrotubule-associated protein 1 Eight chain 3beta Map1 c3b -1,524893 .273453 1.803 microtubide-associate proteih 1 tight chain 3beta Map1c3b -1547s 0.354184, 1763 capping protein (actinfilament) muscle 2-line, beta Capzb 1.525 041328, 1.3698 reactionein2, M2 439845 0,14991 1.5624 kinestnight chain 4 Kosa 148419 0.22s 8553 sphingomyelinphosphodiesterase 2, neutral Smpd2 -1.505527 0.656852 0.358221 coMA sequence BC014585 BCO4685 1617 0,553S6 0.8422S7 interferongamma inducible protein 30 630 SS24 O.O81258 0.78s GDP-Tanrose pyrophosphorylases Gmppb 1s5234 otggs .82st cAMP responsive element binding protein 3 Cre3 l,5862 0.465138 (.81614 expressed in non-metastatic cells 3 Nes -SOS38 4943 O.62892 membrane-boundtranscription factorpeptidase, site 1 Mbps 1 -44573 .4S4SS, 942848 2-4-denoyl-Coenzyme A reductase 2, peroxisomal ec2 -140365 0.88141 80283 Mdomain containing 2. ind2 1.451 1.0351 48.895

cytochrome P450, family 4, subfamily v, polypeptide 3 Cyp43 -145.82s 9dS23 O.S2373 hydroxy-delta-5-steroid dehydrogenase sd37 -158894 8588s diss47 lectin, marross-binding 2 Tara -15522 assis 0.425 transcobaatin2 cn2 -,51623 028 Osa234 cystinosis, nephropathic Cts -158130 SSS8 0.43304 apolipoprotein D Apod ...sos. 383 .37s24 low density lipoprotein receptor-related protein upap 0.9632 0.24319s 1,432.288 RIKEN conAC230093N2 gene C2300.93N2Rik -.1427 0.25863. 1482 low density lipoprotein receptor-related protein associated protein 1 pap1 -1089285 p.14ssis 1.45554 scavenger receptor class A, member 5 (putative) Scaras -i.1314 .391027 132859 vitamin Kepoxide reductase complex subunit 1 Wkore 25512 0.36583 .33287 brain and reproductive organ-expressed protein Bre -117135 stafa 1.2783s POU donaln, class 5, Franscription factor 1 Pous -1.18353 0.44694 .22408 egulfment and cell motity 1, ced-12 homolog(C, elegans) Eino - 1,152149 0,14253 1372815 cyclind3 CC3 12988s D, 1803s 1322 selenium binding protein 1 Selenbp1 1.17s. 833a .968 sort 1 Sor ...1049 .5484s 1.85984 RIKEN coNA 111003102 gene 11003102k -1.32sfos. 667.282 105796 nuclear factor of kappa tight changene enhancer inhibitor, alpha Nkbia -129,168 060403 1.49131 nuclear factor of kappaght changane enhancernhibitor, alpha Nfkbia -1,38738s .739 .991 nuclear factor ofkappa Eight chain gene enhancer inhibitor, alpha N?kbia -128552s obses occas nicon 1 NC1 44529 Osg.sos O9.6289 zinc fingerprotein 99 Zipge -1.43s2 osses 9ss1 cytochrone b-245, alpha polypeptide Cyba -14s 1337 os49Bs 98.7sas acetyl-Coenzyme A acyltransferase 1A Acaata -365 0.598008 1,097934 acetyl-Coenzyme A acyltransferase 1A Acaaa -14849s 05372 Osss ?tudeoredox Nxn -142.1853 assassis 37s integral membrane protein 20 int -384:37 .358888 .2432 RIKEN cDNA 1500032D16 gene Sosrik .47815 c.414273 1.92099 DNA segmen, Chr5, ERATODof 40, expressed D5Ertg40e -1.314 O.2296 86562 nuclear pretarnin A recognition factor Narf -1.3751 Os35752 184ss nuclear prelamin Arecognition factor Narf 1.17422 Os3474 120438 cathepsin B Cists -1.24sg98 Osssos 1,0957 retino binding protein, cellular Rbp1 -285331 O.322 16968 B-celleukemia/lymphomas c. 1.90222 084018 130013 transmembrane protein 45a Treas -0.953787 0.827219 1,026425 histone 1,2bc Hist2tic 2O7227 0.82415 933697 estrogen related receptor, beta Es -0.879541 0.506995 124233s GTP binding protein (gene overexpressed in skeletal muscle) Gem 0.967as 379988 .29sos RIKEN cDNA ca30093N12 gene C230093N12Rik -0.96153 0.261598 1,321203 ridogen2 Ni2 -O,896182 1,058669 O.8449Bs Sema domain, immunoglobulin domain (g) Seas -1.009947 0931076 0.957035 matrix metalopeptidase 9 Mrp9 -0.91185 0.82037. 1.04177 matrix metallopeptidase 9 Mmp9 0.804922 0.851SO8 O.99984 transcription factor 3 c3 -085901 0,883O4S 0.994474 nuclear factorkappa tight polypeptide enhancer inhibitor, epsilon Nikbie -1.110612 1.125381 0.708442 citrate lyase beta like Cyb 1,1887s 0.398875 0.950583 sort 1 ... Sort 0.998 d7oss 1.141s cathepsin B Csb 0.3348 ,09449 0.738369 developmental pluripotency-associated 5 Depa5 O2S88S 146122 22S Jumon. At rich interactive daman 18 (Rbp2 like) Jarid1b. -0,824449 1.47611 0.213182 19 fataliver mRNA. at A. H19. -0807701 1,523269 0.096924

development pluripotency-associated 3 Oppa3 90346 -56863. 22.30s

US 2010/0135970 A1

issistas 1405241488 1.3778265 1s578522 13424288 1.494829.3 19459.365 1395.27893 1.425726 1.352326 2.4127,374 8s2353743

1.48S98898 42sess

1.7067.2927 1.4828.04625 iss1897 1352932s 3 362s6619 341283sFS

133578024 1646.1653 144513738 1.3235 1.5801880s 1.28372.2825 222 1951818 1.4882O39 .3221613 1422429394 1342O2SO9 1.2939958 2.83.385 1.32069.58s 3,333.454 177569.432 87ssigns

1.4ss178918 2.99769a 1.182996.9 1.399472887 183802 1.3852ssacs 1,307752716 1.535.727892 1.315109634 .5762512 42132.944 44.29486

1.351927s22 53949

14.Saa323s 352.20285

1.391.50678 1.309055462

SS345SS 198295548 157461sg2 1.51515244 189ssiss 63651so 271323 3F53g27

1.49875 526095

1.798973351 13767gg 1.350941458 158739345

4.331193854 2262889 2,594227s

926.1965 1.89.95142 1398.222 1.372786419 .78253304 1.589.52218 1816524285 fass42565 2.5729sgB

..67ss9853


Figure 4F (cont.)

1418434 at 1429388 at 1424220 at at 14492.31 at 1421924 at 1449288 at 141688 at 1418847 at 418345 at 1432143 a 1449732 at 1460180 at 1437874s at 1417963 at 1453559a at 1449028 at

--

makorn, ring finger protein, 1 nanog porcupine homolog(Drosophia) iduronidase, alpha-L- solute carrierfamily 2 (glucose transporter)member 3 retin G1 GM2 gangoslde activator protein branched chain ketoadd dehydrogenase 1, alpha polypeptide tumor necrosis factor (ligand) superfamily, member 13 high mobility group box transcription factor 1 zinc finger proliferation 1 hexosaminidases hexosaminidase B phospholipid transfer protein Seli (suppressor of lin-12) 1 homolog(C. elegans) ras homologgene family, memberu

Mkm Nanog

Tnsf13 Hbp Zipro1 Hext Hext Pip Seth

-09237.22 1560872 -O.g3918 1581533 0.951388 1.509349 -1026082 .396.472 -0,835883. 140748 -1.03658 1.27gos 1.32057 1217s27 1215282 1355193 -12.82962. 121s2 -1.195678 1.194853 -1.09834 1.29985 -1.27578. 1415.458

-1.267422 1.405426 1.304901 1.375.583 -341951 1,078.933 -0808147-0.25423

Jun. 3, 2010 Sheet 18 of 27

-0.0305.02 0.17355 0.083269 0.2377.84 0.316735 0.521471 0.3622BS 0.308248 0.5359.49 0.585286 0.444.093 0.034599 0.004077 -0,16024 0.446.79 1.572.70s

US 2010/0135970 A1

1.403.395.254 1.308460793 1.445.4252 1.485.19049 1.32020334 2093828.538 1.55918425 1.291135129 2.48425595

1.385453.563 1.444481258 1.70450288 1525300185 1.39076941 1333,2833 1.6282S5147


O CT Meec Con3 Nk25 SA CTT TBXS

D g 9. O

a 10 Ol

C 2

4. S

1 S

S

Differentiation

Figure 5


Nestin (red)+ Sarcomeric IB4 (green)+ A B-III-tubulin (green) actinin AceLDL-Dil (red)

D

Ectoderm Mesoderm Endoderm

Figure 6


Figure 7


Figure 8

saline 3T3/3T3 3T3/D3

es

F t - as so ?

s

O t

69 s th

1 s

e

- Figure 5


Sarconieric actinin

Figure 9


Connexin43

GEP-- Cardiotroponin I

Figure 10


TUNEL

Figure 11


Post-op dO p-0.01 Post-op d7 OOO

O

N

2 a C

5 r

D

Figure 12


Figure 13

US 2010/01 3597.0 A1

METHODS FOR REPROGRAMMING ADULT SOMATIC CELLS AND USES THEREOF

CROSS-REFERENCE TO RELATED APPLICATION

0001. This application claims the benefit of the following U.S. Provisional Application Nos.: 60/922.221, filed Apr. 6, 2007, and 60/854,946, filed Oct. 27, 2006, the contents of which are incorporated herein by reference.

STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED

RESEARCH

0002 This work was supported by the following grants from the National Institutes of Health, Grant Nos: AA014575, HL63414, 57516,53354 66957 and 60911.

BACKGROUND OF THE INVENTION

0003) A number of clinical trials using autologous bone marrow (BM) and peripheral blood derived stem/progenitor cells have been completed or are currently underway for post-infarct myocardial repair. The available evidence dem onstrating improvement in myocardial function following transplantation of autologous BM derived stem/progenitor cells both in pre-clinical as well as in available clinical trials, remains a potent force driving discovery and clinical devel opment simultaneously and has provided new hope for Sub jects with debilitating heart diseases. Certain potential limi tations of autologous BM or peripheral blood derived stem/ progenitor cells have been identified. Risk factors for coronary artery disease are reported to be associated with a reduced number and impaired functional activity of endothe lial progenitor cells in the peripheral blood of patients. Like wise, patients with diabetes showed lower endothelial pro genitor cell numbers. Similarly, in diabetic mice endothelial progenitor cell-mediated re-endothelialization was impaired. Heterogeneity of bone marrow derived stem cells; incomplete mechanistic insights into their function, limited plasticity and trans-differentiation potential to various lineages of cells are also the subject of intense debate. Additionally, the stability with which trans-differentiated cells are able to maintain their newly acquired phenotype and the heritability of this pheno type remains to be defined. Better methods for developing and refining additional sources of autologous cells for tissue repair and regeneration are, therefore, required.

SUMMARY OF THE INVENTION

0004 As described below, the present invention features methods for de-differentiating and reprogramming somatic cells and related therapeutic compositions and methods. 0005. In one aspect, the invention generally provides a method for generating a reprogrammed cell, the method involves contacting a Somatic cell (e.g., fibroblast) containing a permeable cell membrane with an embryonic stem cell extract, thereby generating a de-differentiated cell; and cul turing the de-differentiated cell in the presence of at least one agent that induces differentiation, thereby generating a repro grammed cell (e.g., a mammaliancell line or primary cell). In one embodiment, the method further involves providing the cell to a subject for the repair or regeneration of a tissue or organ. In another embodiment, the method increases function of the tissue or organ. In yet another embodiment, the con tacting occurs in an ATP regenerating buffer that contains one

Jun. 3, 2010

or more of ATP, creatine phosphate, and creatine kinase. In still another embodiment, the de-differentiated cell expresses an embryonic stem cell marker not expressed in the Somatic cell. In yet another embodiment, the embryonic stem cell marker is any one or more of Nanog, SCF, SSEA1, Oct-4, and c-Kit. In yet another embodiment, the de-differentiated cell has reduced levels of DNA methylation relative to an untreated Somatic cell. In yet another embodiment, the de differentiated cell has increased levels of histone acetylation relative to an untreated somatic cell. In yet another embodi ment, the agent is any one or more of LIF, BMP-2, retinoic acid, trans-retinoic acid, dexamethasone, insulin, and indomethacin. In yet another embodiment, the cell is cultured in the presence of LIF and BMP-2 to generate a cardiomyo cyte. In yet another embodiment, the reprogrammed cell expresses a cardiomyocyte specific gene any one or more of connexin43, Mef2C, Nkx2.5, GATA4, cardiac troponin I, cardiac troponin T. and Tbx5. In yet another embodiment, the reprogrammed cell expresses two, three, four or more of the cardiomyocyte specific genes. In yet another embodiment, the cell is cultured in the presence offibronectin and 10% fetal bovine serum to generate an endothelial cell. In yet another embodiment, the endothelial cell expresses an endothelial cell marker that is CD31 or Flk-1. In yet another embodiment, the cell is cultured in the presence of all-trans retinoic acid or a derivative thereof to generate a neuronal cell. In yet another embodiment, the neuronal cell expresses a neuronal marker that is any one or more of nestin and B-tubulin. In yet another embodiment, the cell is cultured in the presence of retinoic acid, dexamethasone, insulin, and/or indomethacinto gener ate an adipocyte. Preferably, the adipocyte is positive for Oil red O or acetylated LDL uptake. 0006. In yet another aspect, the invention features a method for repairing or regenerating a tissue in a subject, the method involves obtaining the reprogrammed cell of a previ ous aspect and administering the cell to a Subject (e.g., a Subject having a myocardial infarction, congestive heart fail ure, stroke, ischemia, peripheral vascular disease, alcoholic liver disease, cirrhosis, Parkinson's disease, Alzheimer's dis ease, diabetes, cancer, arthritis, wound healing) and similar diseases, where an increase or replacement of in a particular cell type? tissue or cellular de-differentiation is desirable. In one embodiment, the Subject has damage to the tissue or organ, and the administering provides a dose of cells suffi cient to increase a biological function of the tissue or organ or to increase the number of cell present in the tissue or organ. In another embodiment, the Subject has a disease, disorder, or condition, and wherein the administering provides a dose of cells sufficient to ameliorate or stabilize the disease, disorder, or condition. In yet another embodiment, the method increases the number of cells of the tissue or organ by at least about 5%, 10%, 25%, 50%, 75% or more compared to a corresponding untreated control tissue or organ. In yet another embodiment, the method increases the biological activity of the tissue or organby at least about 5%, 10%, 25%, 50%, 75% or more compared to a corresponding untreated control tissue or organ. In yet another embodiment, the method increases blood vessel formation in the tissue or organ by at least about 5%, 10%, 25%, 50%, 75% or more compared to a corresponding untreated control tissue or organ. In yet another embodiment, the cell is administered directly to a subject at a site where an increase in cell number is desired. In one embodiment, the site is a site of tissue

US 2010/01 3597.0 A1

damage or disease. In yet another embodiment, the site shows an increase in cell death relative to a corresponding control site.

0007. In yet another aspect, the invention provides a method of ameliorating an ischemic condition in a Subject in need thereof, the method involves contacting a fibroblast cell containing a permeable cell membrane with an embryonic stem cell extract; culturing the cell in the presence of LIF and BMP-2 to generate an endothelial cell; and administering the endothelial cell of the previous step into a muscle tissue of the Subject, thereby ameliorating an ischemic condition. 0008. In yet another aspect, the invention provides a method of ameliorating a cardiovascular condition in a Sub ject in need thereof, the method involves contacting a Somatic cell containing a permeable cell membrane with an embry onic stem cell extract; culturing the cell in the presence of LIF and BMP-2, to generate a cardiomyocyte; and injecting the cardiomyocyte of the previous step into a muscle tissue of the Subject, thereby ameliorating a cardiovascular condition. In one embodiment, the method increases left ventricular func tion, reduces fibrosis, or increases capillary density in a car diac tissue of the Subject. In another embodiment, the con tacting is carried out in an ATP regenerating buffer. In yet another embodiment, the method further involves expressing a recombinant protein (e.g., activinA, adrenomedulin, acidic FGF, basic fibroblast growth factor, angiogenin, angiopoi etin-1, angiopoietin-2, angiopoietin-3, angiopoietin-4, angiostatin, angiotropin, angiotensin-2, bone morphogenic protein 1, 2, or 3, cadherin, collagen, colony stimulating factor (CSF), endothelial cell-derived growth factor, endog lin, endothelin, endostatin, endothelial cell growth inhibitor, endothelial cell-viability maintaining factor, ephrins, eryth ropoietin, hepatocyte growth factor, human growth hormone, TNF-alpha, TGF-beta, platelet derived endothelial cell growth factor (PD-ECGF), platelet derived endothelial growth factor (PDGF), insulin-like growth factor-1 or -2 (IGF), interleukin (IL)-1 or 8. FGF-5, fibronectin, granulo cyte macrophage colony stimulating factor (GM-CSF), heart derived inhibitor of vascular cell proliferation, IFN-gamma, IGF-2, IFN-gamma, integrin receptor, LIF, leiomyoma-de rived growth factor, MCP-1, macrophage-derived growth fac tor, monocyte-derived growth factor, MMP 2, MMP3, MMP9, neuropilin, neurothelin, nitric oxide donors, nitric oxide synthase (NOS), stem cell factor (SCF), VEGF-A, VEGF-B, VEGF-C, VEGF-D, VEGF-E, VEGF, and VEGF164) in the cell. In yet another embodiment, the recom binant protein is a polypeptide that promotes cell prolifera tion or differentiation. In one embodiment, the recombinant protein is a reporter protein (e.g., GFP EGFP, BFP, CFPYFP. and RFP). 0009. In yet another aspect, the invention provides a repro grammed cell obtained by the method of any previous aspect. In various embodiments, the cell is a differentiated cardi omyocyte, endothelial cell, neuronal cell, adipocyte, or a precursor thereof. 0010. In yet another aspect, the invention provides a tissue containing the reprogrammed cell of any previous aspect. 0011. In yet another aspect, the invention provides a phar maceutical composition comprising an effective amount of a cell of any previous aspect in a pharmaceutically acceptable excipient for administration to a subject in need thereof. 0012. In yet another aspect, the invention provides a kit for tissue repair or regeneration comprising a reprogrammed cell

Jun. 3, 2010

obtained by the method of any previous aspect and instruc tions for use of the cell in methods of tissue repair or regen eration.

0013. In various embodiments of any previous aspect, the Subject has damage to the tissue or organ, and the adminis tering provides a dose of cells sufficient to increase a biologi cal function of the tissue or organ. In still other embodiments of the previous aspects, the Subject has a disease, disorder, or condition, and wherein the administering provides a dose of cells sufficient to ameliorate or stabilize the disease, disorder, or condition. the method increases the number of cells of the tissue or organ by at least about 5%, 10%, 25%, 50%, 75% or more compared to a corresponding untreated control tissue or organ. In still other embodiments of the previous aspects, the method increases the biological activity of the tissue or organ by at least about 5%, 10%, 25%, 50%, 75% or more compared to a corresponding untreated control tissue or organ. In still other embodiments of the previous aspects, the method increases blood vessel formation in the tissue or organ by at least about 5%, 10%, 25%, 50%, 75% or more compared to a corresponding untreated control tissue or organ. In still other embodiments of the previous aspects, the cell is administered directly to a subject at a site where an increase in cell number is desired. In still other embodiments of the previous aspects, the site is a site of tissue damage or disease. In still other embodiments of the previous aspects, the site shows an increase in cell death relative to a corresponding control site. In still other embodiments of the previous aspects, the subject has a disease that is any one or more of myocardial infarction, congestive heart failure, stroke, ischemia, peripheral vascular disease, alcoholic liver disease, cirrhosis, Parkinson's dis ease, Alzheimer's disease, diabetes, cancer, arthritis, and wound healing. In still other embodiments of the previous aspects, the method ameliorates ischemic damage. In still other embodiments of the previous aspects, the method reduces apoptosis, increases cell proliferation, increases function, or increases perfusion of muscle tissue (e.g., cardiac tissue or skeletal muscle tissue). In still other embodiments, the method repairs post-infarct ischemic damage in a cardiac tissue. In still other embodiments, the method repairs hind limb ischemia in a skeletal muscle tissue. In still other embodiments, the cell is any of the following: a cardiomyo cyte that expresses a cardiomyocyte marker that is any one or more of connexin43, Mef2C, Nkx2.5, GATA4, cardiac tropo nin I, cardiac troponin T, and Tbx5; an endothelial cell that expresses an endothelial marker that is CD31 or Flk-1; a neuronal cell that expresses a neuronal marker that is nestin or B-tubulin; or an adipocyte cell that is positive for Oil red O. 0014. Other features and advantages of the invention will be apparent from the detailed description, and from the claims.

Definitions

00.15 Agents’ refer to cellular (e.g., biologic) and phar maceutical factors, preferably growth factors, cytokines, hor mones or Small molecules, or to genetically-encoded prod ucts that modulate cell function (e.g., induce lineage commitment, increase expansion, inhibit or promote cell growth and Survival). For example, "expansion agents' are agents that increase proliferation and/or Survival of cells of the invention. “Differentiation agents' are agents that induce uncommitted cells to differentiate into committed cell lin eageS.

US 2010/01 3597.0 A1

0016. By “altered” is meant an increase or decrease. An increase is any positive change, e.g., by at least about 5%, 10%, or 20%; preferably by about 25%, 50%, 75%, or even by 100%, 200%, 300% or more. A decrease is a negative change, e.g., a decrease by about 5%, 10%, or 20%; preferably by about 25%, 50%, 75%; or even an increase by 100%, 200%, 300% or more. 0017. By “angiogenesis” is meant the growth of new blood vessels originating from existing blood vessels. Angiogenesis can be assayed by measuring the number of non-branching blood vessel segments (number of segments per unit area), the functional vascular density (total length of perfused blood vessel per unit area), the vessel diameter, or the vessel Volume density (total of calculated blood vessel volume based on length and diameter of each segment per unit area). 0018. By “cell membrane' is meant any membrane that envelops a cell or cellular organelle (e.g., cell nucleus, mito chondria). 0019. By “marker' is meant a gene, polypeptide, modifi cation thereof, or biological function that is characteristic of a particular cell type or cellular phenotype. For example, the expression of embryonic stem cell markers (e.g., Nanog, stem cell factor (SCF), SSEA1, Oct-4, c-Kit, increase in acetyla tion, decrease in methylation) may be used to characterize a cell as having an embryonic stem cell phenotype. Similarly, the expression of cardiomyocyte specific markers (e.g., car diotroponin I, Mef2c, connexin43, Nkx2.5, sarcomeric acti nin, cariotroponin Tand TBX5 may be used to identify a cell as a cardiomyocyte; the expression of endothelial cell specific markers (e.g., CD31) may be used to identify a cell as an endothelial cell; the expression of a muscle specific marker (e.g., desmin) is indicative of muscle cell differentiation; neuronal markers (e.g., nestin and B-tubulin-III) may be used to identify a neuronal cell; adipocyte markers (e.g., Oil Red-O staining or acetylated LDL uptake) may be used to identify an adipocyte. 0020. The terms “comprises”, “comprising, and are intended to have the broad meaning ascribed to them in U.S. Patent Law and can mean “includes”, “including and the like. 0021. By “deficiency of a particular cell-type' is meant fewer of a specific set of cells than are normally present in a tissue or organ not having a deficiency. For example, a defi ciency is a 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% deficit in the number of cells of a particular cell-type (e.g., adipocytes, endothelial cells, endot helial precursor cells, fibroblasts, cardiomyocytes, neurons) relative to the number of cells present in a naturally-occur ring, corresponding tissue or organ. Methods for assaying cell-number are standard in the art, and are described in (Bonifacino et al., Current Protocols in Cell Biology, Loose leaf, John Wiley and Sons, Inc., San Francisco, Calif., 1999; Robinson et al., Current Protocols in Cytometry Loose-leaf, John Wiley and Sons, Inc., San Francisco, Calif., October 1997). 0022 “Derived from as used herein refers to the process of obtaining a cell from a Subject, embryo, biological sample, or cell culture. 0023 “Differentiation” refers to the developmental pro cess of lineage commitment. Differentiation can be assayed by measuring an increase in one or more cell specific markers relative to their expression in a corresponding undifferenti ated control cell. A “lineage” refers to a pathway of cellular development, in which precursor or “progenitor” cells

Jun. 3, 2010

undergo progressive physiological changes to become a specified cell type having a characteristic function (e.g., nerve cell, muscle cell or endothelial cell). Differentiation occurs in stages, whereby cells gradually become more specified until they reach full maturity, which is also referred to as “terminal differentiation.” A “terminally differentiated cell is a cell that has committed to a specific lineage, and has reached the end stage of differentiation (i.e., a cell that has fully matured). 0024. A “de-differentiated cell is a cell in which the pro cess of differentiation has been, at least to some degree, reversed. De-differentiation can be assayed, for example, by identifying a reduction in the expression of one or more cell specific markers relative to their expression in a correspond ing control cell. Alternatively, de-differentiation can be assayed by measuring an increase in one or more markers typically expressed in an embryonic stem cell, a pluripotent or multi-potent cell type, or expressed at an earlier stage of development. 0025 “Engraft refers to the process of cellular contact and incorporation into a tissue of interest (e.g., muscle tissue) in vivo.

0026. By “stem cell extract’ is meant an extract derived at least in part from a stem cell by any chemical or physical process.

0027. The term “isolated as used herein refers to a cell in a non-naturally occurring state (e.g., isolated from the body or a biological sample). 0028 By “mammal’ is meant any warm-blooded animal including but not limited to a human, cow, horse, pig, sheep, goat, bird, mouse, rat, dog, cat, monkey, baboon, or the like. Preferably, the mammal is a human. 0029. By “organ” is meant a collection of cells that per form a biological function. In one embodiment, an organ includes, but is not limited to, bladder, brain, nervous tissue, glial tissue, esophagus, fallopian tube, heart, pancreas, intes tines, gallbladder, kidney, liver, lung, ovaries, prostate, spinal cord, spleen, stomach, testes, thymus, thyroid, trachea, uro genital tract, ureter, urethra, uterus, breast, skeletal muscle, skin, bone, and cartilage. The biological function of an organ can be assayed using standard methods known to the skilled artisan.

0030 The term “obtaining as in “obtaining the agent” is intended to include purchasing, synthesizing or otherwise acquiring the agent (or indicated Substance or material). 0.031 0032. By “permeable' is meant allowing the movement of peptides, polypeptides, polynucleotides, and/or small com pounds. A permeable cell membrane, for example, provides for the translocation of peptides, polypeptides, polynucle otides, and/or Small compounds from one side of a cell mem brane to another.

0033. By “positioned for expression' is meant that a poly nucleotide (e.g., a DNA molecule) is positioned adjacent to a DNA sequence which directs transcription and, for proteins, translation of the sequence (i.e., facilitates the production of for example, a recombinant polypeptide of the invention, or an RNA molecule). 0034. As used herein, the terms “prevent.” “preventing.” “prevention.” “prophylactic treatment” and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.

By “perfused is meant filled with flowing blood.

US 2010/01 3597.0 A1

0035. By “reference” or “control” is meant a standard condition. For example, an untreated cell, tissue, or organ that is used as a reference. 0036 By “regenerate' is meant capable of contributing at least one cell to the repair or de novo construction of a tissue or Organ. 0037. By “repair is meant to ameliorate damage or dis ease in a tissue or organ. 0038. By “reprogram' is meant the re-differentiation of a de-differentiated cell. 0039. By “reprogrammed cell' is meantasomatic cell that has undergone de-differentiation and is Subsequently induced to re-differentiate. The reprogrammed cell typically expresses a cell specific marker (or set of markers), morphol ogy, and/or biological function that was not characteristic of the cell (or a progenitor thereof) prior to de-differentiation or re-differentiation. 0040. A “somatic' cell refers to a cell that is obtained from a tissue of a Subject. Such subjects are at a post-natal stage of development (e.g., adult, infant, child). In contrast, an "embryonic cell' or "embryonic stem cell' is derived from an embryo at a pre-natal stage of development. 0041. The term “subject as used herein refers to a verte brate, preferably a mammal (e.g., dog, cat, rodent, horse, bovine, rabbit, goat, or human). 0042. By “tissue' is meant a collection of cells having a similar morphology and function. 0043. By “transformed cell is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a polynucleotide molecule encoding (as used herein) a polypeptide of the invention. 0044 As used herein, the terms “treat,” “treating.” “treat ment, and the like refer to reducing or ameliorating a disor der and/or symptoms associated therewith. It will be appre ciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated. 0045. By “vasculogenesis” is meant the development of new blood vessels originating from stem cells, angioblasts, or other precursor cells.

BRIEF DESCRIPTION OF THE DRAWINGS

0046 FIGS. 1A-1C show phenotypic changes in 3T3/D3 cells following D3-extract treatment. NIH3T3 fibroblasts were reversibly permeabilized with streptolysin O (SLO) and exposed to D3-mouse embryonic stem cell (mESC) whole cell extracts or to control self (NIH3T3) extract. Cells were cultured in DMEM supplemented with Leukemia Inhibitory Factor (LIF) (10 ng/ml) and monitored daily for morphologi cal changes. FIG. 1A shows four representative phase con trast images of self-extract treated 3T3 on day 10 and D3-ex tract treated 3T3 on days 3 (d3), 5 (d5) and 10 (d10). Cells were cultured on 4 well slides and expression of c-Kit (FIG. 1B) and Stage Specific Embryonic Antigen 1 (SSEA1) (FIG. 1C) was determined by immuno-fluorescence staining. Six representative photomicrographs obtained using fluores cence microscopy are shown. DAPI was used as a marker for nuclei. 0047 FIGS. 2A-2C show the de-differentiation of mES cell extract treated NIH3T3 cells. FIG. 2A is a graph quanti tating mRNA expression by real-time RT-PCR for indicated stem cell markers (e.g., Nanog, stem cell factor (SCF). SSEA1, Oct-4, and c-Kit). Total RNA was extracted from 3T3/D3 four weeks after initiation of treatment. Data is plot

Jun. 3, 2010

ted as fold mRNA expression compared to the mRNA levels in self-extract treated 3T3 cells averaged from 3 similar experiments. FIG. 2B presents six photomicrographs show ing Oct4 expression determined by immuno-fluorescence staining of cells cultured on 4 well slides. Representative staining is shown. FIG. 2C presents four photomicrographs showing the loss of somatic cell marker, lamin A/C in 3T3/D3 cells as analyzed by immuno-fluorescence cyto-chemistry. 0048 FIGS. 3A-3D show that D3 extract treatment induced epigenetic changes in 3T3/D3 cells. FIG. 3A is a schematic diagram of the Oct4 promoter with the position of CpG indicated. Genomic DNA from indicated cells was digested with EcoRI and treated with sodium meta-bisul phite. The Oct4 promoter was amplified from modified DNA using specific primers by PCR and PCR products were sequenced for the evidence of cytosine conversion to thymine at unmethylated CpG. Filled circles represent methylated CpG and open circles represent unmethylated CpG in the Octa promoter. FIG. 3B is a photograph showing a DNA fragment. The Oct4 promoter fragment was amplified from bisulphate treated genomic DNA of indicated cells and was subjected to digestion with HypCH4IV restriction enzyme that specifically cleaved methylated CpG. Post-digestion DNA was resolved on 2% ethidium bromide stained gels and photographed. FIG. 3C is a graph that quantitates histone H3 (AcH3) and H4 acetylation (AcH4) of the Oct4 promoter analyzed by Chromatin Immunoprecipitation (ChIP) relative to control (IgG). FIG. 3D is a graph quantitating the dimethy lation status of lysine 9 of histone H3 (diMeK9H3)(3D). Gels from 3 separate experiments were quantified by NIH image analysis and average values were plotted against levels observed in D3 cells (arbitrarily given a numerical value of 1). 0049 FIGS. 4A-4F show global gene expression analysis for re-programmed 3T3/D3 cells. FIG. 4A provides a heat map of Z-scored values for 3286 genes showing significant differences (p<0.001 and absolute log fold change of >1) between 3T3 and 3T3/D3 cells and the expression level of same genes in D3 cells. FIG. 4B shows that genes expressed differentially in 3T3 and 3T3/D3 cells (3286) were grouped in 20 functional categories according to EASE program. FIG. 4C shows a heatmap of the top 500 up-regulated (dark grey) and top 500 down-regulated genes (Z-scored values) in 3T3/ D3 cells compared to 3T3 cells and relative expression of same genes in D3 cells (* genes up-regulated exclusively in D3 and 3T3/D3; *.* top 500 up-regulated genes in 3T3/D3; ** top 500 down-regulated genes in 3T3/D3). FIGS. 4D and 4E provide lists of genes upregulated and downregulated genes, respectively. FIG. 4F provides a list of genes showing significant up-regulation exclusively in D3 and 3T3/D3 cells as compared to 3T3 cells. 0050 FIG. 5A-5D show cardiomyocyte and endothelial cell differentiation of 3T3/D3 cells. Representative phase contrast images of 3T3/D3 cells cultured for 7 days under culture conditions conducive to cardiomyocyte (FIG. 5A, right panel) and endothelial cell (FIG. 5C, right panel) differ entiation conditions. FIGS. 5B and 5D are graphs showing fold increase in mRNA expression of cardiomyocyte specific markers cardiotroponin I, Mef2c, connexin43, Nkx2.5, sar comeric actinin, cariotroponin T and TBX5 (FIG. 5B) and endothelial cell specific markers (FIG. 5D) in 3T3/D3 cells when cultured under cardiomyocyte cell (CMC) and/or endothelial cell (EC) differentiation conditions, in vitro (see materials and methods).

US 2010/01 3597.0 A1

0051 FIGS. 6A and 6B show that de-differentiated 3T3/ D3 cells differentiate into cells representative of all 3 germ layers. FIG. 6A shows that under culture conditions condu cive to cell specific differentiation, 3T3/D3 cells show protein expression of neuronal (a), cardiomyocyte (b), endothelial cell, merged image of (c) and adipocyte (d) specific markers. FIG. 6B shows that 3T3/D3 subcutaneously injected in SCID mice form teratomas exhibiting differentiation into cell lin eages representative of all 3 germ layers. 0.052 FIGS. 7A and 7B show that 3T3/D3 cells form ter atomas in SCID mice. FIG. 7A shows photographs of mice forming teratomas when injected with D3 and 3T3/D3 cells. FIG. 7B shows the kinetics of tumor growth in mice injected with 3T3, D3 and 3T3/D3 cells. 3T3 cells did not form ter atomas until 7 weeks post-injection of cells. D3 cell injected mice revealed tumor growth of ~3 cm by 3 weeks and were sacrificed at that time. 0053 FIGS. 8A-8D are graphs showing that transplanta tion of 3T3/D3 cells improves left ventricular function and histological repair in a mouse model of acute myocardial infarction. Transplantation of 3T3/D3 cells significantly improved left ventricular end-diastolic areas (LVEDA) (FIG. 8A), and left ventricular fractional shortening (FIG. 8B) as compared to mice treated with control 3T3 cells and/or saline. FIG. 8C shows the quantification of % fibrosis area in 3 groups of mice. FIG. 8D shows the quantification of capillary density. Mice were perfused with FITC-BS1 lectin and fluo rescently labeled capillaries were counted in 6 randomly selected tissue sections at the border Zone from each animal.

0054 FIG.9A-9D shows that 3T3/D3 cells trans-differen tiate into cardiomyocytes and endothelial cells, in vivo. FIGS. 9A and 9B are photomicrographs of representative merged figures showing co-localization of GFP+ (green) transplanted control 3T3 cells (left panel) and 3T3/D3 cells (right panel) and CMC specific marker, sarcomeric actinin-- (red) cells. Double positive cells are identified by yellow fluorescence in the merged images (white arrowheads). FIGS. 9C and 9D are representative merged images showing co-localization of GFP+ (green) transplanted 3T3 control (left panel) and 3T3/ D3 (right panel) and endothelial cell (EC) specific marker, CD31+ (red) cells. Double positive cells are identified by yellow fluorescence (white arrowheads) in the merged images. 0055 FIG. 10 provides six photomicrographs showing that 3T3/D3 cells incorporate into the vasculature and trans differentiate into cardiomyocytes, in vivo. Four weeks after AMI and GFP-tagged 3T3 or 3T3/D3 cell transplantation, a subset of mice was perfused with fluorescently labeled BS-1 lectin (red). Myocardium was harvested, fixed with 4% PFA and sectioned. Tissue sections were then analyzed by laser confocal microscopy to visualize co-localization of GFP+ wells with BS-1 lectin stained vasculature. As shown in FIG. 10, GFP+3T3/D3 cells (green) co-localized with BS-1 lectin stained vessel (red), giving an yellow fluorescence, while no GFP+3T3 cells incorporated into the vasculature (upper pan els). Transplanted GFP+3T3 or 3T3/D3 cells were also addi tional cardiomyocyte specific markers (connexin43 and Car diotroponin I; middle and lower panels) to assess their differentiation to CMC lineage in vivo. 0056 FIGS. 11A and 11B show that 3T3/D3 cell trans plantation decreases post-infarct myocardial apoptosis. The number of apoptotic and proliferating myocardial cells in the infracted myocardium 28 days was determined following AMI and cell transplantation. The number of apoptotic cells,

Jun. 3, 2010

as evident from TUNEL+ cells, was significantly higher in myocardial sections of mice treated with control 3T3 as com pared to those treated with 3T3/D3 cells (FIG. 11A; 18+2.3 TUNEL+ cells/high visual field in control 3T3 group vs. 5+1.2TUNEL+ cells/high visual field in 3T3/D3 cell group: p-0.01). A higher number of proliferating cells, (nuclei stained positive for Ki67) was also observed in the myocar dial sections from 3T3/D3 treated mice as compared to con trol 3T3 treated mice (FIG. 11B, p<0.05). 0057 FIGS. 12A-12D show that transplantation of 3T3/ D3 cells into a surgically induced mouse hind limb ischemia model improved functional blood flow recovery and neo vascularization. To ascertain the functional efficacy of re programmed D3-extract treated 3T3 cells in a physiologically relevant model of tissue repair, studies were conducted in a well-established mouse hind limb ischemia model described in (R. Kishore et al., J Clin Invest. 115, 1785 (2005). Laser Doppler Perfusion Imaging (LDPI), just after the surgery, confirmed establishment of ischemia (complete loss of per fusion in the operated limb; dark shading FIG. 11A left pan els). Immediately following the Surgery (post-op d0), mice were assigned to two groups and 3T3/D3 or 3T3 cells (2x10), labeled with DiI for tracing purposes, were injected into the ischemic muscles at 3 different sites. Physiological blood flow recovery was assessed by LDPI on day 7 post Surgery (post-op d7), in both groups of mice. As shown in representative perfusion images in FIG. 12A (right panel)and quantified as the ratio of blood flow in ischemic to non ischemic limb, in FIG. 12B, mice transplanted with 3T3/D3 cells, displayed significantly improved perfusion on day 7 compared to mice treated with 3T3 control cells (p<0.01). This data suggest that transplantation of 3T3/D3 cells into Surgically induced mouse hind limb ischemia model improved functional blood flow recovery. To substantiate the physiological blood flow recovery with the anatomical evi dence, the number of capillaries in at least 6 randomly selected tissue sections obtained from both group of mice was first determined. Capillaries were identified as fluorescent structures (green), stained with in vivo perfuse FITC-BS-1 lectin. The transplanted cells were traced by red fluorescence (DiD). The number of capillaries/per high visual field in dif ferent sections was quantified and averaged. As shown in FIG. 12C, the capillary density was significantly higher in mice that received 3T3/D3 cells compared to those that received control 3T3 cells. Furthermore, 3T3/D3 cells displayed a better proliferative capacity in the ischemic hind limbs than the control 3T3 cells. Immunofluorescence staining for BrdU+DiI double positive cells (indicating proliferation of transplanted cells) revealed a significantly higher number of in vivo proliferating 3T3/D3 cells as compared to control 3T3 cells (FIG. 12D). 0058 FIG. 13 shows the in vivo differentiation of D3-ex tract treated cells to endothelial and muscle cells was corrobo rated by co-staining of Dil-labeled cells with specific markers of endothelial and muscle cells. Tissue sections from ischemic hind limbs were stained with mouse FITC-labeled anti-CD31 and anti-desmin antibodies. Fluorescent micros copy was conducted to visualize CD31 + (green) and DiI+ (red) cells and desmin- (green) and Dil-- (red) cells to deter mine EC and muscle differentiation, respectively, of trans planted cells and images in the same visual field were merged to generate composite image. As shown in FIG. 13 (panels a, b), many CD31+DiI double positive cells (indicated by arrows) were observed in the ischemic tissue of mice treated

US 2010/01 3597.0 A1

with 3T3/D3 cells (panel a) compared to those treated with control 3T3 cells (panel b). Similarly, a large number of 3T3/D3 cells co-expressed muscle marker, desmin, in the ischemic hind limbs while very few desmin-i-Dil double posi tive cells in control 3T3 treated mice were observed (FIG. 13, panels c and d). Taken together, these data indicate that re programmed somatic cells are capable of multi-lineage dif ferentiation in vivo and participate in tissue repair and regen eration.

DETAILED DESCRIPTION OF THE INVENTION

0059. The invention features compositions and methods that are useful for reprogramming Somatic cells and related therapeutic compositions and methods. 0060 Reverse lineage-commitment of adult somatic cells provides an attractive, oocyte-independent source for the gen eration of pluripotent, autologous stem cells for regenerative medicine. As reported in more detail below, when reversibly permeabilized NIH3T3 cells were exposed to mouse embry onic cell (ESC) extracts, the cells underwent dedifferentiation followed by stimulus-induced re-differentiation or repro gramming into multiple lineage cell types. Genome-wide expression profiling revealed significant differences between NIH3T3 control cells and ESC extract treated NIH3T3 cells, including the up-regulation of ESC specific transcripts. ESC extracts induced CpG de-methylation of Oct4 promoter and hyper-acetylation of histone 3 and 4 as well as decreased dimethylation of histone 3. In a mouse model of acute myo cardial infarction (AMI), transplantation of reprogrammed NIH3T3 cells significantly improved post-MI left ventricular function, decreased fibrosis, enhanced capillary density and the transplanted cells trans-differentiated into cardiomyo cytes and endothelial cells. Moreover, when injected into SCID mice reprogrammed cells formed teratomas. Taken together these data indicate the oocyte-independent genera tion of functional autologous stem like cells from terminally differentiated somatic cells. 0061 Somatic cells can be isolated from a number of Sources, for example, from biopsies or autopsies using stan dard methods. The isolated cells are preferably autologous cells obtained by biopsy from the subject. The cells from biopsy can be expanded in culture. Cells from relatives or other donors of the same species can also be used with appro priate immunosuppression. Methods for the isolation and culture of cells are discussed in Fauza et al. (J. Ped. Surg. 33. 7-12, 1998) 0062 Cells are isolated using techniques known to those skilled in the art. For example, a tissue or organ can be disaggregated mechanically and/or treated with digestive enzymes and/orchelating agents that weaken the connections between neighboring cells making it possible to disperse the tissue into a Suspension of individual cells without appre ciable cell breakage. Enzymatic dissociation can be accom plished by mincing the tissue and treating the minced tissue with digestive enzymes (e.g., tiypsin, chymotrypsin, collage nase, elastase, hyaluronidase, DNase, pronase, and dispase). Mechanical disruption can be accomplished by scraping the Surface of the organ, the use of grinders, blenders, sieves, homogenizers, pressure cells, or Sonicators. For a review of tissue disruption techniques, see Freshney, (Culture of Ani mal Cells. A Manual of Basic Technique, 2d Ed., A. R. Liss, Inc., New York, Ch. 9, pp. 107-126, 1987). While the Examples provided below describe embodiments where fibroblast cells are de-differentiated then reprogrammed, the

Jun. 3, 2010

invention is not so limited. One skilled in the art will readily appreciate that the invention may be employed for the repro gramming of virtually any somatic cell of interest. Moreover, a reprogrammed cell can generate any of a variety of mam malian primary cells or cell lines, with cell types including, without limitation, adipocytes, preadipocytes, urothelial cells, mesenchymal cells, especially smooth or skeletal muscle cells, myocytes (muscle stem cells), mesenchymal precursor cells, cardiac myocytes, fibroblasts, chondrocytes, fibromyoblasts, ectodermal cells ductile cells, and skin cells, hepotocytes, islet cells, cells present in the intestine, paren chymal cells, other cells forming bone or cartilage (e.g., osteoblasts), and neurons. 0063. Once a tissue has been reduced to a suspension of individual cells, the Suspension can be fractionated into Sub populations. This may be accomplished using standard tech niques (e.g., cloning and positive selection of specific cell types or negative selection, i.e., the destruction of unwanted cells). Selection techniques include separation based upon differential cell agglutination in a mixed cell population, freeze-thaw procedures, differential adherence properties of the cells in the mixed population, filtration, conventional and Zonal centrifugation, unit gravity separation, countercurrent distribution, electrophoresis and fluorescence-activated cell sorting. For a review of clonal selection and cell separation techniques, see Freshney, Culture of Animal Cells. A Manual of Basic Techniques, 2d Ed., A. R. Liss, Inc., New York, Ch. 11 and 12, pp. 137-168, 1987). The use of allogenic cells, and more preferably autologous cells, is preferred to prevent tis Sue rejection. However, if an immunological response does occur in the Subject after implantation of the reprogrammed cell, the Subject may be treated with immunosuppressive agents, such as cyclosporin or FK506, to reduce the likeli hood of rejection.

Therapeutic and Prophylactic Applications 0064. The present invention provides a ready supply of stem-like cells that could be generated from individual sub jects, obviating ethical concerns and also circumventing issues regarding immune rejection, the 'stem cells generated from each individual would be genetically identical to the donor/recipient. The invention also provides methods of using these “stem cells to repair or regenerate diseased or damaged tissues and organs. In particular embodiments, the invention may be used to increase the number of cells in a tissue or organ having a deficiency in cell number or an excess in cell death. Cells of the invention are administered (e.g., directly or indirectly) to a damaged or diseased tissue or organ where they engraft and increase tissue or organ function. In one embodiment, transplanted cells of the invention function in blood vessel formation to increase perfusion in a damaged tissue or organ, improving organ biological function, reduc ing apoptosis, and/or reducing fibrosis. These methods may stabilize a damaged tissue or organ in a Subject; or the meth ods may repair or regenerate a damaged or diseased tissue or organ. Methods for repairing damaged tissue or organs may be carried out either in vitro, in vivo, or ex vivo. 0065. Thus, the invention provides methods of treating a disease and/or disorders or symptoms thereof characterized by a deficiency in cell number or excess cell death which comprise administering a therapeutically effective amount of a cellular composition described herein to a Subject (e.g., a mammal. Such as a human). In one embodiment, the invention provides a method of treating a subject suffering from or

US 2010/01 3597.0 A1

Susceptible to a disease characterized by a deficiency in cell number or excess cell death (e.g., heart attack, congestive, heart failure, stroke, Parkinson's disease, Alzheimer's dis ease, diabetes, cancer, arthritis) or disorder or symptom thereof. In particular embodiments, autologous cells could be generated for use in any tissue repair or regeneration indica tion, including but not limited to, myocardial infarction, con gestive heart failure, stroke, ischemia, peripheral vascular diseases, alcoholic liver disease, cirrhosis, Parkinson's dis ease, Alzheimer's disease, diabetes, cancer, arthritis, wound healing and similar diseases where an increase or replace ment of in a particular cell type? tissue or cellular de-differ entiation is desirable. The method includes the step of admin istering to the mammal a therapeutic amount of a cellular composition herein sufficient to treat the disease or disorder or symptom thereof, under conditions such that the disease or disorder is treated.

0066. The methods herein include administering to the Subject (including a subject identified as in need of Such treatment) an effective amount of a composition described herein, or a composition described herein to produce Such effect. Identifying a subject in need of such treatment can be in the judgment of a Subject or a health care professional and can be subjective (e.g. opinion) or objective (e.g. measurable by a test or diagnostic method). 0067. The therapeutic methods of the invention (which include prophylactic treatment) in general comprise admin istration of a therapeutically effective amount of the compo sition herein, such as a composition comprising de-differen tiated or reprogrammed cells herein to a subject (e.g., animal, human) in need thereof including a mammal, particularly a human. Such treatment will be suitably administered to sub jects, particularly humans, Suffering from, having, Suscep tible to, or at risk for a disease characterized by a deficiency in cell number oran increase in cell death, disorder, or symptom thereof. Determination of those subjects “at risk” can be made by any objective or subjective determination by a diagnostic test or opinion of a Subject or health care provider (e.g., genetic test, enzyme or protein marker, Marker (as defined herein), family history, and the like). The compounds herein may be also used in the treatment of any other disorders in which a deficiency in cell number or an excess in cell death may be implicated. 0068. In one embodiment, the invention provides a method of monitoring treatment progress. The method includes the step of determining a level of diagnostic marker (Marker) (e.g., any target delineated herein modulated by a compound herein, a protein or indicator thereof, etc.) or diag nostic measurement (e.g., Screen, assay) in a Subject suffering from or Susceptible to a disorder or symptoms thereof asso ciated with a deficiency in cell number or an excess in cell death, in which the subject has been administered a therapeu tic amount of a composition herein Sufficient to treat the disease or symptoms thereof. The level of Marker determined in the method can be compared to known levels of Marker in either healthy normal controls or in other afflicted subjects to establish the subject's disease status. In preferred embodi ments, a second level of Marker in the subject is determined at a time point later than the determination of the first level, and the two levels are compared to monitor the course of disease or the efficacy of the therapy. In certain preferred embodiments, a pre-treatment level of Marker in the subject is determined prior to beginning treatment according to this invention; this pre-treatment level of Marker can then be

Jun. 3, 2010

compared to the level of Marker in the subject after the treat ment commences, to determine the efficacy of the treatment.

Methods for Evaluating Therapeutic Efficacy

0069 Methods of the invention are useful for treating or stabilizing in a subject (e.g., a human or mammal) a condi tion, disease, or disorder affecting a tissue or organ. Thera peutic efficacy is optionally assayed by measuring, for example, the biological function of the treated organ (e.g., bladder, bone, brain, breast, cartilage, esophagus, fallopian tube, heart, pancreas, intestines, gallbladder, kidney, liver, lung, nervous tissue, ovaries, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testes, thymus, thyroid, trachea, ureter, urethra, urogenital tract, and uterus). Such methods are standard in the art and are described, for example, in the Textbook of Medical Physiology, Tenth edition, (Guyton et al., W.B. Saunders Co., 2000). Preferably, a method of the present invention, increases the biological function of a tissue or organ by at least 5%, 10%, 20%, 40%, 50%, 60%, 70%, 80%,90%, 100%, 150%,200%, or even by as much as 300%, 400%, or 500%. In addition, the therapeutic efficacy of the methods of the invention can optionally be assayed by mea Suring an increase in cell number in the treated or transplanted tissue or organ as compared to a corresponding control tissue or organ (e.g., a tissue or organ that did not receive treatment). Preferably, cell number in a tissue or organ is increased by at least 5%, 10%, 20%, 40%, 60%, 80%, 100%, 150%, or 200% relative to a corresponding tissue or organ. Methods for assaying cell proliferation are known to the skilled artisan and are described in Bonifacino et al., (Current Protocols in Cell Biology Loose-leaf, John Wiley and Sons, Inc., San Fran cisco, Calif.). Alternatively, the therapeutic efficacy of the methods of the invention is assayed by measuring angiogen esis, blood vessel formation, blood flow, or the function of a blood vessel network in the tissue or organ receiving treat ment as compared to a control tissue or organ (e.g., corre sponding tissue or organ that did not receive treatment). A method that increases blood vessel formation or perfusion (e.g., by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 100%, 150%, or 200%, or even by as much as 300%, 400%, or 500%) is considered to be useful in the invention. Methods for evaluating angiogenesis and vasculogenesis are standard in the art and are described herein.

Administration

0070 Cells of the invention include somatic cells that have been de-differentiated and reprogrammed or re-differentiated to express cell specific markers. Such cells can be provided directly to a tissue or organ of interest (e.g., by direct injec tion). In one embodiment, cells of the invention are provided to a site where an increase in the number of cells is desired, for example, due to disease, damage, injury, or excess cell death. Alternatively, cells of the invention can be provided indirectly to a tissue or organ of interest, for example, by administration into the circulatory system. If desired, the cells are delivered to a portion of the circulatory system that Supplies the tissue or organ to be repaired or regenerated. Advantageously, cells of the invention engraft within the tissue or organ. If desired, expansion and differentiation agents can be provided prior to, during or after administration of the cells to increase, main tain, or enhance production or differentiation of the cells in vivo. Compositions of the invention include pharmaceutical compositions comprising reprogrammed cells or their pro

US 2010/01 3597.0 A1

genitors and a pharmaceutically acceptable carrier. Adminis tration can be autologous or heterologous. For example, cells obtained from one subject, can be administered to the same subject or a different, compatible subject. Methods for administering cells are known in the art, and include, but are not limited to, catheter administration, systemic injection, localized injection, intravenous injection, intramuscular, int racardiac injection or parenteral administration. When administering a therapeutic composition of the present inven tion (e.g., a pharmaceutical composition), it will generally be formulated in a unit dosage injectable form (solution, Suspen Sion, emulsion).

Formulations

0071 Cellular compositions of the invention can be con Veniently provided as sterile liquid preparations, e.g., isotonic aqueous solutions, Suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and Solid compositions. Additionally, liquid compositions are somewhat more conve nient to administer, especially by injection. Viscous compo sitions, on the other hand, can beformulated within the appro priate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium con taining, for example, water, Saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid poly ethylene glycol, and the like) and suitable mixtures thereof. 0072 Sterile injectable solutions can be prepared by incorporating the cells (e.g., de-differentiated or repro grammed cells) utilized in practicing the present invention in the required amount of the appropriate solvent with various amounts of the other ingredients, as desired. Such composi tions may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological Saline, glucose, dextrose, or the like. The compositions can also be lyo philized. The compositions can contain auxiliary Substances Such as wetting, dispersing, or emulsifying agents (e.g., meth ylcellulose), pH buffering agents, gelling or viscosity enhanc ing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as “REMING TON'S PHARMACEUTICAL SCIENCE, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare Suitable preparations, without undue experimenta tion. 0073. Various additives which enhance the stability and sterility of the compositions, including antimicrobial preser Vatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, Sorbic acid, and the like. Prolonged absorption of the injectable pharmaceuti cal form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the de-differentiated cells or reprogrammed cells or their pro genitors. 0074 The compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and lacrimal fluid. The desired isotonicity of the compositions of this invention may be accomplished using sodium chloride, or other pharmaceu

Jun. 3, 2010

tically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic Sol utes. Sodium chloride is preferred particularly for buffers containing sodium ions. 0075 Viscosity of the compositions, if desired, can be maintained at the selected level using a pharmaceutically acceptable thickening agent. Methylcellulose is preferred because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, Xanthan gum, carboxymethyl cellulose, hydrox ypropyl cellulose, carbomer, and the like. The preferred con centration of the thickener will depend upon the agent selected. The important point is to use an amount that will achieve the selected viscosity. Obviously, the choice of suit able carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid filled form). 0076. A method to potentially increase cell survival when introducing the cells into a Subject is to incorporate cells or their progeny (e.g., in Vivo, ex vivo or in vitro derived cells) of interest into a biopolymer or synthetic polymer. Depending on the Subject's condition, the site of injection might prove inhospitable for cell seeding and growth because of Scarring or other impediments. Examples of biopolymer include, but are not limited to, cells mixed with fibronectin, fibrin, fibrino gen, thrombin, collagen, and proteoglycans. This could be constructed with or without included expansion or differen tiation factors. Additionally, these could be in Suspension, but residence time at sites subjected to flow would be nominal. Another alternative is a three-dimensional gel with cells entrapped within the interstices of the cell biopolymer admix ture. Again, expansion or differentiation factors could be included with the cells. These could be deployed by injection via various routes described herein.

0077 Exemplary agents that may be delivered together with a reprogrammed orde-differentiated cell of the invention include, but are not limited to, any one or more of activin A, adrenomedulin, acidic FGF, basic fibroblast growth factor, angiogenin, angiopoietin-1, angiopoietin-2, angiopoietin-3, angiopoietin-4, angiostatin, angiotropin, angiotensin-2, bone morphogenic protein 1, 2, or 3, cadherin, collagen, colony stimulating factor (CSF), endothelial cell-derived growth fac tor, endoglin, endothelin, endostatin, endothelial cell growth inhibitor, endothelial cell-viability maintaining factor, eph rins, erythropoietin, hepatocyte growth factor, human growth hormone, TNF-alpha, TGF-beta, platelet derived endothelial cell growth factor (PD-ECGF), platelet derived endothelial growth factor (PDGF), insulin-like growth factor-1 or -2 (IGF), interleukin (IL)-1 or 8. FGF-5, fibronectin, granulo cyte macrophage colony stimulating factor (GM-CSF), heart derived inhibitor of vascular cell proliferation, IFN-gamma, IFN-gamma, integrin receptor, LIF, leiomyoma-derived growth factor, MCP-1, macrophage-derived growth factor, monocyte-derived growth factor, MMP 2, MMP3, MMP9, neuropilin, neurothelin, nitric oxide donors, nitric oxide Syn thase (NOS), stem cell factor (SCF), VEGF-A, VEGF-B, VEGF-C, VEGF-D, VEGF-E, VEGF, and VEGF164. Other agents that may be delivered together with a cell of the inven tion include one or more of LIF, BMP-2, retinoic acid, trans retinoic acid, dexamethasone, insulin, indomethacin, fibronectin and/or 10% fetal bovine serum, or a derivative

US 2010/01 3597.0 A1

thereof. Preferably, a cell of the invention is delivered together with a combination of LIF and BMP-2; with fibronectin and 10% fetal bovine serum; with retinoic acid or a derivative thereof together with mitotic inhibitors, such as fluorodeoxyuridine, cytosine arabinosine, and uridine; and dexamethasone, insulin, and/or indomethacin. 0078 Those skilled in the art will recognize that the poly meric components of the compositions should be selected to be chemically inert and will not affect the viability or efficacy of the reprogrammed or de-differentiated cells or their pro genitors as described in the present invention. This will present no problem to those skilled in chemical and pharma ceutical principles, or problems can be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein.

Dosages

0079. One consideration concerning the therapeutic use of reprogrammed or de-differentiated cells or their progenitors of the invention is the quantity of cells necessary to achieve an optimal effect. In general, doses ranging from 1 to 4x10" cells may be used. However, different scenarios may require opti mization of the amount of cells injected into a tissue of inter est. Thus, the quantity of cells to be administered will vary for the subject being treated. In a preferred embodiment, between 10 to 10, more preferably 10 to 107, and still more prefer ably, 1,2,3,4, 5, 6, 7x10" stem cells of the invention can be administered to a human subject. 0080. Fewer cells can be administered directly a tissue where an increase in cell number is desirable. Preferably, between 10° to 10, more preferably 10 to 10, and still more preferably, 10 reprogrammed or de-differentiated cells or their progenitors can be administered to a human Subject. However, the precise determination of what would be con sidered an effective dose may be based on factors individual to each Subject, including their size, age, sex, weight, and condition of the particular subject. As few as 100-1000 cells can be administered for certain desired applications among selected patients. Therefore, dosages can be readily ascer tained by those skilled in the art from this disclosure and the knowledge in the art. 0081 Reprogrammed or de-differentiated cells or their progenitors of the invention can comprise a purified popula tion of reprogrammed or de-differentiated cells. As described herein, cells of the invention are identified as de-differenti ated or reprogrammed, for example, by the expression of markers, by cellular morphology, or by the ability to form a particular cell type (e.g., ectodermal cell, mesodermal cell, endodermal cell, adipocyte, myocyte, neuron). Those skilled in the art can readily determine the percentage of cells in a population using various well-known methods, such as fluo rescence activated cell sorting (FACS). Preferable ranges of purity in populations comprising reprogrammed or de-differ entiated cells are about 50 to about 55%, about 55 to about 60%, and about 65 to about 70%. More preferably the purity is about 70 to about 75%, about 75 to about 80%, about 80 to about 85%; and still more preferably the purity is about 85 to about 90%, about 90 to about 95%, and about 95 to about 100%. Purity of reprogrammed or de-differentiated cells or their progenitors can be determined according to the marker profile within a population. Dosages can be readily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage).

Jun. 3, 2010

I0082. The skilled artisan can readily determine the amount of cells and optional additives, vehicles, and/or carrier in compositions and to be administered in methods of the inven tion. Typically, any additives (in addition to the active stem cell(s) and/or agent(s)) are present in an amount of 0.001 to 50% (weight) solution in phosphate buffered saline, and the active ingredient is present in the order of micrograms to milligrams, such as about 0.0001 to about 5 wt %, preferably about 0.0001 to about 1 wt %, still more preferably about 0.0001 to about 0.05 wt % or about 0.001 to about 20 wt %, preferably about 0.01 to about 10 wt %, and still more pref erably about 0.05 to about 5 wt %. Of course, for any com position to be administered to an animal or human, and for any particular method of administration, it is preferred to determine therefore: toxicity, Such as by determining the lethal dose (LD) and LDso in a suitable animal model e.g., rodent such as mouse; and, the dosage of the composition(s), concentration of components therein and timing of adminis tering the composition(s), which elicit a suitable response. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations can be ascertained without undue experimen tation.

0083. If desired, cells of the invention are delivered in combination with (prior to, concurrent with, or following the delivery of) agents that increase Survival, increase prolifera tion, enhance differentiation, and/or promote maintenance of a differentiated cellular phenotype. Expansion agents include growth factors that are known in the art to increase prolifera tion or Survival of stem cells. Such agents are expected to be similarly useful for the expansion of cells of the invention, particularly for the expansion of de-differentiated cells. For example, U.S. Pat. Nos. 5,750,376 and 5,851,832 describe methods for the in vitro culture and proliferation of neural stem cells using transforming growth factor. An active role in the expansion and proliferation of stem cells has also been described for BMPs (Zhu, G. et al. (1999) Dev. Biol. 215: 118-29 and Kawase, E. etal. (2001)Development 131: 1365), LIF (Menard Cetal (2005), Lancet. 366:1005-1012) and Wnt proteins (Pazianos, G. et al. (2003) Biotechniques 35: 1240 and Constantinescu, S. (2003).J. Cell Mol. Med. 7: 103). U.S. Pat. Nos. 5.453,357 and 5,851,832 describe proliferative stem cell culture systems that utilize fibroblast growth factors. The contents of each of these references are specifically incorpo rated herein by reference for their description of expansion agents known in the art. 0084 Agents comprising growth factors are also known in the art to increase mobilization of stem cells from the bone marrow into the peripheral blood. Mobilizing agents include but are not limited to GCSF or GMCSF. An agent that increases mobilization of stem cells into the blood can be provided to augment or Supplement other methods of the invention where it would be desirable to increase circulating levels of bone marrow derived stem cells (e.g., to increase engraftment of Such cells in an ischemic tissue). I0085 Agents comprising growth factors are known in the art to differentiate stem cells. Such agents are expected to be similarly useful for inducing the re-differentiation or repro gramming of de-differentiated cells. For example, TGF-B can induce differentiation of hematopoietic stem cells (Ruscetti, F. W. et al. (2001) Int. J. Hematol. 74: 18). U.S. Patent Appli cation No. 2002142457 describes methods for differentiation of cardiomyocytes using BMPs. Pera et al describe human

US 2010/01 3597.0 A1

embryonic stem cell differentiation using BMP-2 (Pera, M. F. et al. (2004) J. Cell Sci. 117: 1269). U.S. Patent Application No. 20040014210 and U.S. Pat. No. 6,485,972 describe methods of using Wnt proteins to induce differentiation. U.S. Pat. No. 6,586,243 describes differentiation of dendritic cells in the presence of SCF. U.S. Pat. No. 6,395,546 describes methods for generating dopaminergic neurons in vitro from embryonic and adult central nervous system cells using LIF. The contents of each of these references are specifically incorporated herein by reference for their description of dif ferentiation agents known in the art. I0086. In vitro and ex vivo applications of the invention involve the culture of de-differentiated cells or reprogrammed cells or their progenitors with a selected agent to achieve a desired result. Cultures of cells (from the same individual and from different individuals) can be treated with expansion agents prior to, during, or following de-differentiation to increase the number of cells Suitable for reprogramming. Similarly, differentiation agents of interest can be used to reprogram a de-differentiated cell, which can then be used for a variety of therapeutic applications (e.g., tissue or organ repair, regeneration, treatment of an ischemic tissue, or treat ment of myocardial infarction). 0087. If desired, de-differentiated or reprogrammed cells of the invention are delivered in combination with other fac tors that promote cell survival, differentiation, or engraft ment. Such factors, include but are not limited to nutrients, growth factors, agents that induce differentiation or de-dif ferentiation, products of secretion, immunomodulators, inhibitors of inflammation, regression factors, hormones, or other biologically active compounds. Exemplary agents include, but are not limited to

Delivery Methods 0088 Compositions of the invention (e.g., cells in a suit able vehicle) can be provided directly to an organ of interest, Such as an organ having a deficiency in cell number as a result of injury or disease. Alternatively, compositions can be pro vided indirectly to the organ of interest, for example, by administration into the circulatory system. 0089 Compositions can be administered to subjects in need thereof by a variety of administration routes. Methods of administration, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects. Such modes of administration include intramuscular, intra-cardiac, oral, rectal, topical, intraocular, buccal, intrav aginal, intracisternal, intracerebroVentricular, intratracheal, nasal, transdermal, within?on implants, e.g., fibers such as collagen, osmotic pumps, or grafts comprising repro grammed or de-differentiated cells, etc., or parenteral routes. The term “parenteral includes subcutaneous, intravenous, intramuscular, intraperitoneal, intragonadal or infusion. A particular method of administration involves coating, embed ding or derivatizing fibers, such as collagen fibers, protein polymers, etc. with therapeutic proteins. Other useful approaches are described in Otto, D. et al., J. Neurosci. Res. 22: 83 and in Otto, D. and Unsicker, K. J. Neurosci. 10: 1912. 0090. In one approach, re-differentiated cells derived from cultures of the invention are implanted into a host. The trans plantation can be autologous, such that the donor of the cells is the recipient of the transplanted cells; or the transplantation can be heterologous, such that the donor of the cells is not the

Jun. 3, 2010

recipient of the transplanted cells. Once transferred into a host, the re-differentiated cells are engrafted, such that they assume the function and architecture of the native host tissue.

0091. In another approach, de-differentiated cells derived from cultures of the invention are implanted into a host. The transplantation can be autologous. Such that the donor of the cells is the recipient of the transplanted cells; or the transplan tation can be heterologous, Such that the donor of the cells is not the recipient of the transplanted cells. Once transferred into a host, the de-differentiated cells are induced to undergo re-differentiation. The reprogrammed cells are then engrafted, such that they assume the function and architecture of the native host tissue.

0092 De-differentiated cells and reprogrammed cells and the progenitors thereof can be cultured, treated with agents and/or administered in the presence of polymer scaffolds. If desired, agents described herein are incorporated into the polymer scaffold to promote cell survival, proliferation, enhance maintenance of a cellular phenotype. Polymer Scaf folds are designed to optimize gas, nutrient, and waste exchange by diffusion. Polymer scaffolds can comprise, for example, a porous, non-woven array of fibers. The polymer scaffold can be shaped to maximize Surface area, to allow adequate diffusion of nutrients and growth factors to the cells. Taking these parameters into consideration, one of skill in the art could configure a polymer Scaffold having Sufficient Sur face area for the cells to be nourished by diffusion until new blood vessels interdigitate the implanted engineered-tissue using methods known in the art. Polymer scaffolds can com prise a fibrillar structure. The fibers can be round, scalloped, flattened, star-shaped, solitary or entwined with other fibers. Branching fibers can be used, increasing Surface area propor tionately to Volume. (0093. Unless otherwise specified, the term “polymer” includes polymers and monomers that can be polymerized or adhered to form an integral unit. The polymer can be non biodegradable or biodegradable, typically via hydrolysis or enzymatic cleavage. The term “biodegradable' refers to materials that are bioresorbable and/or degrade and/or break down by mechanical degradation upon interaction with a physiological environment into components that are metabo lizable or excretable, over a period of time from minutes to three years, preferably less than one year, while maintaining the requisite structural integrity. As used in reference to poly mers, the term “degrade” refers to cleavage of the polymer chain, Such that the molecular weight stays approximately constant at the oligomer level and particles of polymer remain following degradation. 0094. Materials suitable for polymer scaffold fabrication include polylactic acid (PLA), poly-L-lactic acid (PLLA), poly-D-lactic acid (PDLA), polyglycolide, polyglycolic acid (PGA), polylactide-co-glycolide (PLGA), polydioxanone, polygluconate, polylactic acid-polyethylene oxide copoly mers, modified cellulose, collagen, polyhydroxybutyrate, polyhydroxpriopionic acid, polyphosphoester, poly(alpha hydroxy acid), polycaprolactone, polycarbonates, polya mides, polyanhydrides, polyamino acids, polyorthoesters, polyacetals, polycyanoacrylates, degradable urethanes, ali phatic polyester polyacrylates, polymethacrylate, acyl Substi tuted cellulose acetates, non-degradable polyurethanes, poly styrenes, polyvinyl chloride, polyvinyl flouride, polyvinyl imidazole, chlorosulphonated polyolifins, polyethylene oxide, polyvinyl alcohol, Teflon R, nylon silicon, and shape memory materials, such as poly(styrene-block-butadiene),

US 2010/01 3597.0 A1

polynorbornene, hydrogels, metallic alloys, and oligo(e-ca prolactone)diol as Switching segment/oligo(p-dioxyanone) diol as physical crosslink. Other suitable polymers can be obtained by reference to The Polymer Handbook, 3rd edition (Wiley, N.Y., 1989).

Kits

0095 De-differentiated or reprogrammed cells of the invention may be supplied along with additional reagents in a kit. The kits can include instructions for the treatment regime or assay, reagents, equipment (test tubes, reaction vessels, needles, Syringes, etc.) and standards for calibrating or con ducting the treatment or assay. The instructions provided in a kit according to the invention may be directed to suitable operational parameters in the form of a label or a separate insert. Optionally, the kit may further comprise a standard or control information so that the test sample can be compared with the control information standard to determine if whether a consistent result is achieved.

Screening Assays

0096. The invention provides methods for identifying modulators, i.e., candidate or test compounds or agents (e.g., proteins, peptides, peptidomimetics, peptoids, polynucle otides, Small molecules or other agents) which enhance de differentiation or reprogramming. Agents thus identified can be used to modulate, for example, proliferation, Survival, differentiation of cells of the invention, or their progenitors, or maintenance of a cellular phenotype, for example, in a therapeutic protocol. 0097. The test agents of the present invention can be obtained singly or using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non peptide backbone which are resistant to enzymatic degrada tion but which nevertheless remain bioactive; see, e.g., Zuck ermann, R. N. (1994) et al., J. Med. Chem. 37:2678-85); spatially addressable parallel solid phase or Solution phase libraries; synthetic library methods requiring deconvolution; the one-bead one-compound library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are limited to peptide libraries, while the other four approaches are appli cable to peptide, non-peptide oligomer or Small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12:145). 0098. Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA91:11422. Zuckermannet al. (1994) J.Med. Chem. 37:2678; Cho et al. (1993) Science 261: 1303: Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem. 37:1233. 0099 Libraries of compounds may be presented in solu tion (e.g., Houghten (1992), Biotechniques 13:412–421), or on beads (Lam (1991), Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner, U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. 5,223,409), plas mids (Cullet al. (1992) Proc Natl Acad Sci USA 89:1865 1869) or on phage (Scott and Smith (1990) Science 249:386 390; Devlin (1990) Science 249:404–406; Cwirla et al. (1990)

Jun. 3, 2010

Proc. Natl. Acad. Sci. 87:6378-6382: Felici (1991) J. Mol. Biol. 222:301-310; Ladner supra.). 0100 Chemical compounds to be used as test agents (i.e., potential inhibitor, antagonist, agonist) can be obtained from commercial sources or can be synthesized from readily avail able starting materials using standard synthetic techniques and methodologies known to those of ordinary skill in the art. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in Syn thesizing the compounds identified by the methods described herein are known in the art and include, for example, those such as described in R. Larock (1989) Comprehensive Organic Transformations, VCH Publishers; T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and Subsequent editions thereof. 0101 Test agents of the invention can also be peptides (e.g., growth factors, cytokines, receptor ligands). Screening methods of the invention can involve the identification of an agent that increases the proliferation, survival of de-differen tiated or reprogrammed cells or the progenitors thereof, or maintenance of a cellular phenotype. Such methods will typi cally involve contacting a population of the de-differentiated or reprogrammed cells with a test agent in culture and quan titating the number of new de-differentiated or reprogrammed cells produced as a result. Comparison to an untreated control can be concurrently assessed. Where an increase in the num ber of de-differentiated or reprogrammed cells is detected relative to the control, the test agent is determined to have the desired activity. 0102. In practicing the methods of the invention, it may be desirable to employ a purified population of cells or the pro genitors thereof. A purified population of de-differentiated or reprogrammedcells have about 50%, 55%, 60%. 65% or 70% purity. More preferably the purity is about 75%, 80%, or 85%; and still more preferably the purity is about 90%, 95%, 97%, or even 100%.

0103 Increased amounts of de-differentiated or repro grammed cells or the progenitors thereof can also be detected by an increase in gene expression of genetic markers. For example, de-differentiation is detected by measuring an increase (e.g., 5%, 10%, 25%, 50%, 75% or 100%) in the expression of one or more embryonic stem cell markers. Such as Oct4, Nanog, SSEA1, SCF and c-Kit. Further evidence of de-differentiation is shown by a reduction in or the loss of lamin A/C protein expression. Alternatively, de-differentia tion is detected by measuring an increase in acetylation, Such as increased acetylation of H3 and H4 within the promoter of Octa, or by measuring a decrease in methylation, for example, by measuring the demethylation of lysine 9 of his tone 3. In each of these cases, de-differentiation is measured relative to a control cell. In other embodiments, de-differen tiation is assayed by any other method that detects chromatin remodeling leading to the activation of an embryonic stem cell marker, such as Oct4. 0104 Re-differentiation or reprogramming of a de-differ entiated cell is detected by assaying increases in expression of cell specific markers that are not typically expressed in the cell from which the reprogrammed cell is derived. An increase in the expression of a cell specific marker may be by about 5%, 10%, 25%, 50%, 75% or 100%. For example, a

US 2010/01 3597.0 A1

neuronal cell is detected by assaying for neuronal markers, Such as nestin and B-tubulin-III; an adipocyte is detected by assaying for Oil-Red-O staining or acetylated LDL uptake. Cardiomyocytes are detected by assaying for the expression of one or more cardiomyocyte specific markers, such as car diotroponin I, Mef2c, connexin43, Nkx2.5, sarcomeric acti nin, cariotroponin T and TBX5, and sarcomeric actinin. The presence of endothelial cells is detected by assaying the pres ence of an endothelial cell specific marker, such as CD31+. The level of expression can be measured in a number of ways, including, but not limited to: measuring the mRNA encoded by the markers; measuring the amount of protein encoded by the markers; or measuring the activity of the protein encoded by the markers. 0105. The level of mRNA corresponding to a marker can be determined both by in situ and by in vitro formats. The isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or North ern analyses, polymerase chain reaction analyses and probe arrays. One diagnostic method for the detection of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA encoded by the gene being detected. The nucleic acid probe is Sufficient to specifically hybridize under Stringent conditions to mRNA or genomic DNA. The probe can be disposed on an address of an array, e.g., an array described below. Other Suitable probes for use in the diagnostic assays are described herein.

0106. In one format, mRNA (or cDNA) is immobilized on a Surface and contacted with the probes, for example by running the isolated mRNA on anagarose geland transferring the mRNA from the gel to a membrane, such as nitrocellu lose. In an alternative format, the probes are immobilized on a surface and the mRNA (or cDNA) is contacted with the probes, for example, in a two-dimensional gene chip array described below. A skilled artisan can adapt known mRNA detection methods for use in detecting the level of mRNA encoded by the genetic markers described herein. 0107 The level of mRNA in a sample can be evaluated with nucleic acid amplification, e.g., by rtPCR (Mullis (1987) U.S. Pat. No. 4,683.202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sus tained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/ Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplifica tion method, followed by the detection of the amplified mol ecules using techniques known in the art. As used herein, amplification primers are defined as being a pair of nucleic acid molecules that can anneal to 5' or 3' regions of a gene (plus and minus strands, respectively, or Vice-versa) and con tain a short region in between. In general, amplification prim ers are from about 10 to 30 nucleotides in length and flank a region from about 50 to 200 nucleotides in length. Under appropriate conditions and with appropriate reagents, such primers permit the amplification of a nucleic acid molecule comprising the nucleotide sequence flanked by the primers. 0108 For in situ methods, a cell or tissue sample can be prepared/processed and immobilized on a Support, typically a glass slide, and then contacted with a probe that can hybridize to mRNA that encodes the genetic marker being analyzed.

Jun. 3, 2010

0109. In other embodiments, de-differentiation or re-dif ferentiation is detected by measuring an alteration in the morphology or biological function of a de-differentiated or re-differentiated cell. An alteration in biological function may be assayed, for example, by measuring an increase in acety lated LDL uptake in a reprogrammed adipocyte. Other meth ods for assaying cell morphology and function are known in the art and are described in the Examples. 0110 Screening methods of the invention can involve the identification of an agent that increases the differentiation of de-differentiated cells into a cell type of interest. Such meth ods will typically involve contacting the de-differentiated cells with a test agent in culture and quantitating the number of reprogrammed cells produced as a result. Comparisonto an untreated control can be concurrently assessed. Where an increase in the number of reprogrammed cells is detected relative to the control, the test agent is determined to have the desired activity. The test agent can also be assayed using a biological sample (e.g., ischemic tissue); Subsequent testing using a population of reprogrammed cells may be conducted to distinguish the functional activity of the agent (e.g., differ entiation rather then increase in proliferation or survival) where the result is ambiguous.

Expression of Recombinant Proteins

0111. In another approach, the de-differentiated cell or reprogrammed cells of the invention may be engineered to express a gene of interest whose expression promotes cell Survival, proliferation, differentiation, maintenance of a cel lular phenotype, or otherwise enhances the engraftment of the cell. Alternatively, expression of a gene of interest in a cell of the invention may promote the repair or regeneration of a tissue or organ having a deficiency in cell number or excess cell death. Exemplary proteins that may be expressed in a cell of the invention include, but are not limited to, angiopoietin, acidic fibroblast growth factors (aFGF) (GenBank Accession No. NP 14.9127) and basic FGF (GenBank Accession No. AAA52448), bone morphogenic protein (GenBank Acces sion No. BAD92827), BMP-2, vascular endothelial growth factor (VEGF) (GenBank Accession No. AAA35789 or NP 001020539), epidermal growth factor (EGF) (GenBank Accession No. NP 001954), transforming growth factor C. (TGF-C) (GenBank Accession No. NP 003227) and trans forming growth factor B (TFG-B) (GenBank Accession No. 1109243A), platelet-derived endothelial cell growth factor (PD-ECGF) (GenBank Accession No. NP 001944), plate let-derived growth factor (PDGF) (GenBank Accession No. 1109245A), tumor necrosis factor C. (TNF-C.) (GenBank Accession No. CAA26669), hepatocyte growth factor (HGF) (GenBank Accession No. BAA 14348), insulin like growth factor (IGF) (GenBank Accession No. P08833), erythropoi etin (GenBank Accession No. PO1588), colony stimulating factor (CSF), macrophage-CSF (M-CSF) (GenBank Acces sion No. AAB59527), granulocyte/macrophage CSF (GM CSF) (GenBankAccession No. NP 000749) and nitric oxide synthase (NOS) (GenBank Accession No. AAA36365), and fragments or variants thereof. Alternatively, cells of the invention may express a component of the extracellular matrix (ECM). ECM components include structural proteins, Such as collagen and elastin, proteins having specialized functions, such as fibrillin, fibronectin, and laminin; and pro teoglycans that include long chains of repeating disaccharide

US 2010/01 3597.0 A1

units termed of glycosaminoglycans (e.g., hyaluronan, chon droitin Sulfate, dermatan Sulfate, heparan Sulfate, heparin, keratan Sulfate, aggrecan). 0112 The gene of interest may be constitutively expressed or its expression may be regulated by an inducible promoter or other control mechanism where conditions necessitate highly controlled regulation or timing of the expression of a protein, enzyme, or other cell product. Such de-differentiated cells or reprogrammed cells, when transplanted into a subject produce high levels of the protein to confer a therapeutic benefit. For example, the cell of the invention, its progenitor or its in vitro-derived progeny, can contain heterologous DNA encoding genes to be expressed, for example, in gene therapy. Insertion of one or more pre-selected DNA sequences can be accomplished by homologous recombina tion or by viral integration into the host cell genome. The desired gene sequence can also be incorporated into the cell, particularly into its nucleus, using a plasmid expression vec tor and a nuclear localization sequence. Methods for directing polynucleotides to the nucleus have been described in the art. The genetic material can be introduced using promoters that will allow for the gene of interest to be positively or nega tively induced using certain chemicals/drugs, to be elimi nated following administration of a given drug?chemical, or can be tagged to allow induction by chemicals, or expression in specific cell compartments. 0113 Calcium phosphate transfection can be used to introduce plasmid DNA containing a target gene or poly nucleotide into de-differentiated cells or reprogrammed cells and is a standard method of DNA transfer to those of skill in the art. DEAE-dextran transfection, which is also known to those of skill in the art, may be preferred over calcium phos phate transfection where transient transfection is desired, as it is often more efficient. Since the cells of the present invention are isolated cells, microinjection can be particularly effective for transferring genetic material into the cells. This method is advantageous because it provides delivery of the desired genetic material directly to the nucleus, avoiding both cyto plasmic and lysosomal degradation of the injected polynucle otide. Cells of the present invention can also be genetically modified using electroporation. 0114 Liposomal delivery of DNA or RNA to genetically modify the cells can be performed using cationic liposomes, which form a stable complex with the polynucleotide. For stabilization of the liposome complex, dioleoyl phosphati dylethanolamine (DOPE) or dioleoyl phosphatidylcholine (DOPA) can be added. Commercially available reagents for liposomal transfer include Lipofectin (Life Technologies). Lipofectin, for example, is a mixture of the cationic lipid N-1-(2,3-dioleyloxy)propyl-N-N-N-trimethyl ammonia chloride and DOPE. Liposomes can carry larger pieces of DNA, can generally protect the polynucleotide from degra dation, and can be targeted to specific cells or tissues. Cat ionic lipid-mediated gene transfer efficiency can be enhanced by incorporating purified viral or cellular envelope compo nents, such as the purified G glycoprotein of the vesicular stomatitis virus envelope (VSV-G). Gene transfer techniques which have been shown effective for delivery of DNA into primary and established mammalian cell lines using lipopolyamine-coated DNA can be used to introduce target DNA into the de-differentiated cells or reprogrammed cells described herein. 0115 Naked plasmid DNA can be injected directly into a tissue comprising cells of the invention (e.g., de-differenti

Jun. 3, 2010

ated or reprogrammed cells). This technique has been shown to be effective intransferring plasmid DNA to skeletal muscle tissue, where expression in mouse skeletal muscle has been observed for more than 19 months following a single intra muscular injection. More rapidly dividing cells take up naked plasmid DNA more efficiently. Therefore, it is advantageous to stimulate cell division prior to treatment with plasmid DNA. Microprojectile gene transfer can also be used to trans fer genes into cells either in vitro or in vivo. The basic pro cedure for microprojectile gene transfer was described by J. Wolff in Gene Therapeutics (1994), page 195. Similarly, microparticle injection techniques have been described pre viously, and methods are known to those of skill in the art. Signal peptides can be also attached to plasmid DNA to direct the DNA to the nucleus for more efficient expression. 0116 Viral vectors are used to genetically alter cells of the present invention and their progeny. Viral vectors are used, as are the physical methods previously described, to deliver one or more target genes, polynucleotides, antisense molecules, or ribozyme sequences, for example, into the cells. Viral vectors and methods for using them to deliver DNA to cells are well known to those of skill in the art. Examples of viral vectors that can be used to genetically alter the cells of the present invention include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors (in cluding lentiviral vectors), alphaviral vectors (e.g., Sindbis vectors), and herpes virus vectors. 0117 Peptide or protein transfection is another method that can be used to genetically alter de-differentiated cells or reprogrammed cells of the invention and their progeny. Pep tides such as Pep-1 (commercially available as Chariot'TM), as well as other protein transduction domains, can quickly and efficiently transport biologically active proteins, peptides, antibodies, and nucleic acids directly into cells, with an effi ciency of about 60% to about 95% (Morris, M.C. et al. (2001) Nat. Biotech. 19: 1173-1176). 0118. The following examples are put forth so as to pro vide those of ordinary skill in the art with a complete disclo Sure and description of how to make and use the assay, Screen ing, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention. 0119 The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature. Such as, “Molecular Cloning: A Laboratory Manual, second edition (Sambrook, 1989); “Oligonucleotide Synthesis” (Gait, 1984): “Animal Cell Culture” (Freshney, 1987); “Methods in Enzymology” “Handbook of Experimental Immunology’ (Weir, 1996); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Current Protocols in Molecular Biology” (Ausubel, 1987); “PCR: The Polymerase Chain Reaction. (Mullis, 1994): “Current Protocols in Immunol ogy' (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

EXAMPLES

I0120 Experimental evidence has revealed nuclear re-pro gramming of terminally differentiated adult mammaliancells

US 2010/01 3597.0 A1

leading to their de-differentiation. One example of somatic cell nuclear re-programming comes from reproductive and therapeutic cloning experiments utilizing Somatic nuclear transfer (SNT), wherein transplantation of somatic nuclei into enucleated oocyte cytoplasm can extensively reprogram Somatic cell nuclei with new patterns of gene expression, new pathways of cell differentiation, generation of embryonic stem cells and birth of cloned animals. Therapeutic cloning, although conceptually attractive, is hampered by the techni cal challenges, extremely low efficiency, oocyte-dependence, ethico-legal concerns and prohibitive cost associated with the process. Accordingly, alternative strategies for Somatic cell re-programming is likely to be important in the development of therapeutics utilizing reprogrammed cells. The present invention provides oocyte-independent systems that involve the exposure of somatic cell nuclei to ESC-derived cell-free factors/proteins to drive somatic cell de-differentiation and nuclear re-programming. 0121 To determine if cell-free extracts from the mouse embryonic stem cell (mESC) line D3, might provide the necessary regulatory proteins to induce de-differentiation fol lowed by stimulus-induced re-differentiation of NIH3T3 murine fibroblasts, reversibly permeabilized NIH3T3 cells were treated with whole cell extracts from NIH3T3 (control) or with mouse embryonic stem cell D3 (ATCC CRL-1934) extracts, made as described below, and the treated cells were cultured in complete DMEM in the presence of LIF (10 ng/ml) for 10 days. As shown in FIG.1. NIH3T3 cells treated with the self extracts (hereinafter referred to as “3T3 cells') did not show any morphological changes up to day 10 post treatment whereas, NIH3T3 cells treated with D3 extracts (hereinafter referred to as “3T3/D3) showed significant changes in cell morphology on days 3, 5 and 10. On day 10 the 3T3/D3 cells formed colonies resembling typical embryonic stem cell (ESC) morphology. To determine if the altered morphology of 3T3/D3 cells represents the de-differentiation of NIH3T3 cells, the induction of mES markers in 3T3/D3 and 3T3 cells was analyzed up to 4 weeks post-treatment, both at the mRNA level by quantitative real-time PCR and at the protein level by immuno-fluorescent staining. Quantita tive mRNA expression of mESC markers, Oct4, Nanog, SSEA1, SCF and c-Kit was significantly higher in 3T3/D3 cells while 3T3 cells did not express measurable mRNA for any of these stem cell markers (FIG. 2A). Enhanced mRNA expression of stem cell specific genes was further corrobo rated by immuno-fluorescence staining for selected markers Octá (FIG. 2B), c-Kit and SSEA1 (FIGS. 1B, and 1C). Fur ther evidence of NIH3T3 de-differentiation is shown by the loss of lamin A/C protein expression in 3T3/D3 cells (FIG. 2C). Lamin A/C is a specific marker of Somatic cells. Taken together, these data indicate that cell-free ESC extracts pro vide the necessary regulatory components required to induce Somatic nuclear reprogramming and alter the differentiation status of non-embryonic cells. 0122 DNA methylation of CpG residues leading to the silencing of pluripotent embryonic genes, including that of Octa, is known as an integral step governing differentiation and development. Since D3-extract exposure leads to the induction of Oct4 mRNA and protein expression in 3T3/D3 cells, studies were performed to determine whether D3-ex tract treatment lead to demethylation of CpG residues in the promoter of Oct4 gene. The methylation status of each CpG in the Oct4 promoter region was investigated (10 CpG sites) by Sodium bisulphite genomic sequencing. The bisulfite-con

Jun. 3, 2010

verted genomic DNA (1g) from D3, 3T3 and 3T3/D3 cells was amplified for Oct4 promoter by PCR. Primers are listed in Table 1 (below).

TABLE 1.

Probe/Primer sequences for quantitative PCR (correct)

Gene sequence

Nanog CAGGGCTATCTGGTGAACGCATCTGG

GATA-4 CCCGGGCTGTCATCTCACTATGGG

Oct - 4 ATCTCCCCATGTCCGCCCGC

c-kit TGCTGAGCTTCTCCTACCAGGTGGCC

CTI AAGCGGCCCACTCTCCGAAGA

Mef2c TCACCAGACCTTCGCCGGACGA

Connexin 43 AGCGATCCTTACCACGCCACCACTG

Nkx2.5 TCCGCGAGCCTACGGTGACCCT

Tox5 TGTACCGT CACCACCGTGCAGCC

CTT ACTCCGGATTCTGTCTGAGAGGAAAA

Flk-1 ACGCTTGGACAGCATCACCAGCAG

CD31 TTTATGAACCTGCCCTGCTCCCACA

SCF c-kit ligand CAGCCATGGCATTGCCGGC

alphaMHC CTCACTTGAAGGACACCCAGCTCCAGC

Primers

Oct - 4 Promoter

F-5 " - GTGAGGTGTCGGTGACCCAAGGCAG-3 R-s' - GGCGAGCGCTATCTGCCTGTGTC-3'

Bisulfite converted Oct 4 promoter

1F-5 " - GAAGGGGAAGTAGGGATTAATTTT-3' 1R-5. CAACAACCATAAACACAATAACCAA-3'

2F-5'-TAGTTGGGATGTGTAGAGTTTGAGA-3 2R-5'-TAAACCAAAACAATCCTTCTACTCC-3

3F-5'-AAGTTTTTGTGGGGGATTTGTAT-3 3R- " - CCACCCACTAACCTTAACCTCTA-3'

PCR products were directly sequenced. As depicted in FIG. 3A, upon bisulphite treatment, all 10 CpG sites in D3 cells were converted from C to T, indicating the unmethylated status of Oct4 promoter in this murine ESC cell line (open circles). All 10 sites were methylated in 3T3 cells (closed circles). In contrast, treatment of 3T3 cells with D3 extracts induced DNA de-methylation at 8/10 CpG residues. D3-ex tract induced Oct4 promoter demethylation in the 3T3/D3 cells was independently corroborated by restriction enzyme analysis. In the Oct4 promoter region, there is one HpyCH4IV (methylated CpG specific restriction enzyme) site at -202. The DNA methylation status of the -202 site was analyzed by HpyCH4IV restriction analysis in D3, 3T3 and 3T3/D3 cells. A ~250 bp promoter region including site-202 of mouse Oct4 was amplified by PCR from the bisulphite treated genomic DNA from all three cell types. As shown in FIG.3B, the PCR product was not digested with HpyCH4IV

US 2010/01 3597.0 A1

in D3 cells, indicating that the genomic DNA of D3 cells was unmethylated at this particular Oct4 promoter site. In con trast, the PCR product was readily digested in 3T3 cells indicating methylation of Oct4-202 site. Interestingly, the PCR product from 3T3/D3 cells was resistant to digestion by HypCH4IV, suggesting that treatment of 3T3 cells with D3 extracts induced de-methylation of CpG sites thereby revers ing the repression of Oct4 mRNA expression observed in 3T3 cells. DNA methylation/demethylation dependent gene Sup pression/activation is coupled with modifications to the his tone proteins, which together lead to chromatin remodeling and new patterns of gene expression. To determine whether the D3-extract induced epigenetic changes in 3T3 cells, the acetylation of histones (H)3 and 4 and methylation of histone 3 protein and its interaction with Oct4 promoter was analysed using Chromatin Immunoprecipitation (ChIP) assays (R. Kishore et al., J Clin Invest. 115, 1785 (2005). ChIP was performed using anti-acetylated H3 and H4 antibodies or anti-IgG antibodies. The Oct4 promoter was amplified from immunoprecipitated chromatin DNA by PCR. ChIP analyses showed that the promoter of Oct4 had increased acetylation of H3 and H4 (FIG. 3C) and decreased demethylation of lysine 9 of histone 3 (FIG. 3D) in 3T3/D3 cells compared to 3T3 cells. Without wishing to be bound by theory, these data indicate that D3-extract induced de-differentiation and nuclear re-programming of 3T3/D3 cells was mediated, at least in part, by chromatin remodeling leading to the activa tion of Oct4. The ChIP data indicates an association of acety lated H3 and H4 with Oct4 promoter following ESC-extract treatment of 3T3 cells. This finding is consistent with data showing that DNA methylation causes chromatin condensa tion through the formation of a protein complex consisting of methyl-binding protein, histone deacetylase, and repressor protein at the methylated CpG sites (P. L. Jones et al., Nat Genet. 2, 187 (1998) 1 X. Nanet al., Nature. 393,386 (1998); H. H. Ng, P. Jeppesen, A. Bird, Mol Cell Biol. 4, 1394 (2000). 0123 Considering that DNA methylation is involved in various biological phenomena, Such as tissue-specific gene expression, cell differentiation, X-chromosome inactivation, genomic imprinting, changes in chromatin structure, and tumorogenesis, it is likely that changes in Oct4 promoter CpG methylation by exposure of 3T3 cells to ESC extracts is one of the epigenetic events underlying de-differentiation of 3T3 cells. Evidence present in the literature also supports this conclusion. In mice, Oct4, is expressed in the oocyte and preimplantation embryo but is later restricted to the inner cell mass of the blastocyst and in the derived ESC. Thus, Oct4 expression in mouse embryos is restricted to totipotent and pluripotent cells. In Oct4-deficient embryos, the inner cell mass loses pluripotency and the trophoblast cells no longer proliferate to form the placenta. Furthermore, reduction in Octa gene expression led to the trans-differentiation of ES cells into other cell types, demonstrating that Suppression of the Oct4 gene is important for the determination of the potency of these stem cells. Moreover, Oct4 is one of the many embryonic genes known to be regulated by DNA methylation. Chromatin structure modification by histone acetylation is also involved in the epigenetic regulation of the Octa gene. 0124. To gain further insight into the changes in gene expression patterns in reprogrammed 3T3/D3 cells, global gene-expression profiles of D3, 3T3 and 3T3/D3 and one single cell derived clone from 3T3/D3 cells was carried out using Affymetrix mouse genome 2A gene chips. Differen

Jun. 3, 2010

tially expressed genes between the three cell types 3T3, D3, and 3T3/D3 were determined by a simple one-way ANOVA performed on the RMA expression values of each probe set, using the R package limma (G. K. Smythm et al., (eds.), Limma: linear models for microarray data. Bioinformatics and Computational Biology Solutions using R and Biocon ductor, Springer, New York, pages 397–420 (2005)). A mul tiple testing adjustment (Y. Benjamini andY. Hochberg, Jour nal of the Royal Statistical Society Series B, 57,289 (1995)) was performed on the resulting statistics to adjust the false discovery rate. Differentially expressed probes with adjusted p-value <0.001 and a fold-change of greater than 2 (absolute log fold change of>than 1) were extracted for further inspec tion. This resulted in 3.286 probes with statistically signifi cant differential expression between cell types 3T3 and 3T3/ D3 including the significant up-regulation of ESC specific genes Oct4, nanog, Dppa 3 and 5, Slc2a3, Z?p296, and kit, histones 1 and 2 and histone deacelylase etc. 0.125 Genes significantly down-regulated in 3T3/D3 cells compared to 3T3 cells included limna, cyclins A2, C and G1, tlr4, fas, hsp90pre1, SOCS2 etc. Hierarchical clustering, using the Pearson correlation coefficient and average agglom eration method was performed on the 3.286 genes (2187 down-regulated genes and 1099 up-regulated genes) that were differentially expressed between 3T3 and D3/3T3 cells. The heatmap in FIG. 4A of z-scored probes illustrates this clustering, in which Z-scores (subtraction of mean and divi sion by standard deviation of normalized values) were com puted for each probe across all twelve arrays. The 3,286 genes found to be differentially expressed between 3T3 and 3T3/D3 cell types were categorized with respect to functional group (FIG. 4B) as per the software EASE (http://david.niaid.nih. gov/david/ease.htm). Two categories, cell cycle and cell pro liferation, were found to be statistically over-represented (Bonferroni corrected p-value p-0.05) using the Fisher exact test via the software package EASE. Heatmap of the top 500 up-regulated and top 500 down-regulated Z-scored probe sets in 3T3/D3 cells compared to 3T3 cells, is shown in FIG. 4C and the annotations of such genes are listed in FIGS. 4D and 4E, respectively. A list of genes showing significant up-regu lation exclusively in D3 and 3T3/D3 cells as compared to 3T3 cells is depicted in FIG. 4F. 0.126 The differentiation potential of de-differentiated 3T3/D3 cells to multiple cell types was assessed in vitro and in vivo. The potential of 3T3/D3 cells to form cardiomyocytes was assayed in vitro. 3T3/D3 cells were cultured under con ditions conducive for cardiomyocyte (CMC) and endothelial cell (EC) differentiation. As shown in FIGS. 5A and 5C) 3T3/D3 cells elicited changes in cell morphology consistent with CMC and EC phenotype, which was corroborated by marked increase in mRNA expression of CMC (FIG. 5B) and EC (FIG. 5D) specific genes. Further evidence in support of the CMC and EC differentiation of 3T3/D3 cells is provided by the finding that the cells expressed EC and CMC specific markers in immunofluorescence assays for sarcomeric acti nin (FIG. 6A, panelb), which is a CMC-specific marker and for the EC specific markers Isolectin B4 (IB4). In addition, 3T3/D3 cells showed uptake of Dil labeled acetylated-LDL (FIG. 6A, panel c), which is also consistent with an EC cell fate. To determine whether 3T3/D3 cells were capable of differentiating towards multiple cell types, neuronal cell and adipocyte specific protein expression was examined. 3T3/D3

US 2010/01 3597.0 A1

cells were cultured under conditions suitable for neuronal or adipocyte fate induction. Results are shown in (FIG. 6A, panels a, d) 0127. In addition, the multilineage differentiation of 3T3/ D3 cells was examined by assaying for teratoma formation. 3T3/D3 cells were injected subcutaneously into SCID mice. The injected cells reproducibly formed teratomas. The for mation of teratomas occurred with slower kinetics relative to teratoma formation in SCID mice injected with D3 cells (FIGS. 7A, 7B). As shown in FIG. 6B, 3T3/D3 cells differ entiated into representative cell types of all 3 germ layers, confirmed by immunofluorescence staining for the expres sion of BIII-tubulin (ectodermal), desmin (mesodermal) and C.-fetoprotein (endodermal). 0128. The trans-differentiation of 3T3/D3 cells into CMC and EC observed in vitro, prompted examination of whether ischemic myocardium could be repaired by transplantation of these cells in a model of acute myocardial infarction (AMI). Mice underwent surgery to induce AMI by ligation of the left

anterior descending coronary artery, as described (A.Iwakura et al., Circulation. 113, 1605 (2006)). Animals were sub divided into 3 groups (10 mice in each group), and received intramyocardial injection of 5x10'lentiviral-GFP transduced (to track transplanted cells up to 4 weeks, in vivo) 3T3/D3 or 3T3 control cells or saline, respectively, in a total volume of 10 ul at 5 sites (basal anterior, mid anterior, mid lateral, apical anterior and apical lateral) in the peri-infarct area. Left ven tricular function was assessed by transthoracic echocardio graphy (SONOS 5500, Hewlett Packard) as described (A. Iwakura et al., Circulation. 113, 1605 (2006);Y. S. Yoon et al., J Clin Invest. 111,717 (2003)). A physiological assessment of left ventricular (LV) function after AMI was performed in all

16 Jun. 3, 2010

groups of mice at basal level before Surgery and on days 7, 14 and 28, post-AMI. Left ventricular end-diastolic areas (LVEDA) were similar in the 3T3 cell and saline groups before and at all time points after AMI (FIG. 8A, black (3T3/ D3) and grey lines (Saline and 3T3/3T3), respectively). In contrast, mice treated with the 3T3/D3 cells had less ventricu lar dilation when assayed by echocardiography (FIG. 8A black line, p<0.05 in 3T3/D3 vs. control groups) when treated with 3T3/D3 cells beginning at 1 week post AMI then mice treated with 3T3 cells. Fractional shortening (FS), an indica tor of contractile function, was evaluated on day 7, 14 and 28 in all groups. As shown in FIG. 8B FS was consistently depressed following AMI in control mice receiving Saline and control 3T3 cells relative to pre-surgery (basal) F.S. Mice treated with 3T3/D3 cells following AMI showed signifi cantly improved FS at all time points tested (at 4 weeks post-Surgery, p<0.01 vs. Saline group and p(0.05 vs. control 3T3 cell treated group). The individual values for evaluated LV function parameters at various time points are shown in Table 2 (below).

TABLE 2

Hemodynamic parameters in nice receiving cell therapy

After MI

barameters in group Before MI 1 week 2 weeks 4 weeks

LVEDA, mm2 8 3T3 D3 11.7 O.7 13.6 O.6** 15.O. O.6 14.6 6.6* 6 3T3.3T3 12.2 + 0.4 16.40.4 16.6 0.8 18.01.1 5 Saline 13.30.6 14.3 1.7 13.5 - 1.6 17.62.9

LVESA, mm2 8 3T3 D3 S.10.3 7.2 0.4*** 7.8 O.S* 7.8 0.6*** 6 3T3.3T3 S.O. O.2 10.5 + 0.6 10.3 O.8 11.90.8 5 Saline 6.8 OS 9.6 1.4 9.51.7 12.91.9

LV area FS, 9% 8 3T3 D3 55.8 1.3 46.9 2.9* 48.3 1.6 46.6 3.2 6 3T3,3T3 SS.O 2.S. 36.1 2.8 38.23.7 34.1 + 2.4 5 Saline 53.74.9 32.92.1 30.8 - 1.7 30.8 - 0.9

LVDd, mm 8 3T3 D3 282 - 3.3 320 6.1** 337 7.6*** 355 - 7.6* 6 3T3.3T3 291 32 355 7.4 383 - 6.4 391 11.0: 5 Saline 2843.O 314 4.O 31834 397 15.5

LVDs, mm 8 3T3 D3 100 S.4 1306.1*** 140 10.6** 1426.2* 6 3T3.3T3 1OO 34 1669.5 1777.7 1879.2 5 Saline 109 6.1 113 - 14.O 183 25.2 233 16.O

LVFS, 9% 8 3T3 D3 64.6 1.7 59.51.8* S8.7 2.3 58.2 2.2 6 3T3,3T3 65.5 1.2 53.21.9 53.7 1.6 52.2 1.3 5 Saline 61.6 2.2 64.0 - 4.6 42.6 7.6 41.3 - 1.7

LVEDA: Left ventricular end-diastolic Area, LVESA: Left ventricular end-siastolic Area, FS: Fractional shortening, LVDd: Left ventriculat Diastolic dimension, LVDs: Left ventricular systolic dimension.

I0129 Improvement in post-AMI physiological heart func tion in mice that received D3-extract treated 3T3 cell trans planted was also observed when treated hearts were histologi cally evaluated. Immunofluorescence staining of myocardial sections was performed to determine CMC and EC differen tiation of the transplanted (GFP) cells and to determine myocardial proliferation (kió7 staining) and apoptosis (TUNEL) (Y. S. Yoon et al., J Clin Invest. 111, 717 (2003). Fibrosis was assayed by embedding heart tissues sections in paraffin, staining the tissue for elastic tissue/trichrome (ET), and measuring the average ratio of the external circumference of fibrosis area to LV area. As shown in FIG. 8C, the fibrosis area in mice hearts receiving either saline or control 3T3 cells

US 2010/01 3597.0 A1

was significantly larger than that observed in mice that received 3T3/D3 cells (p<0.001). Tissue sections were also stained with BS1 lectin to determine the capillary density at the border Zone of the infracted myocardium. Significantly higher capillary density was observed in mice receiving 3T3/ D3 cells than in mice receiving control 3T3 cells or saline (FIG.8D, p<0.01). 0130. To evaluate the CMC differentiation of the trans planted cells in the myocardium, tissue sections were stained with a specific CMC marker, sarcomeric actinin, and the GFP cells (3T3 or 3T3/D3; green) co-expressing sarcomeric actinin (red) were visualized as double positive (yellow) cells in the merged images. As shown in FIG. 9A-9D, GFP sar comeric actinin double positive cells (light fluorescence) were observed in mice treated with 3T3/D3 cells suggesting that some of the transplanted cells differentiated into CMC lineage in vivo, while no evidence of CMC differentiation was observed for transplanted 3T3 cells. Immunofluoresence staining of additional CMC specific markers, connexin43 and cardiotroponin I, further corroborated CMC differentiation of 3T3/D3 cells (FIG. 10). Similar observations were revealed when EC differentiation of transplanted cells was investi gated. As shown in FIG. 10, GFP+CD31 double positive cells were observed in myocardial sections obtained from mice transplanted with 3T3/D3 cells, while sections obtained from control 3T3 transplanted hearts did not show the evidence for EC differentiation. Some of the transplanted 3T3/D3 cells physically incorporated into the vasculature (FIG. 10, top panel, arrow heads). The apoptotic and proliferating myocar dial cells were also quantified following cell transplantation. The number of apoptotic cells, as evident from TUNEL+ cells, were significantly higher in myocardial sections of mice treated with control 3T3 as compared to those treated with 3T3/D3 cells (FIG. 11A; 18+ 2.3TUNEL+ cells/high visual field in control 3T3 group vs. 5+ 1.2 TUNEL+ cells/high visual field in 3T3/D3 cell group; p <0.01). A higher number of proliferating cells, (nuclei stained positive for Ki67) were also observed in the myocardial sections from 3T3/D3 treated mice as compared to control 3T3 treated mice (FIG. 11B, p<0.05). The therapeutic effect of 3T3/D3 cells on physi ological blood flow recovery and neo-vascularization in a mouse model of Surgically induced hind limb ischemia was also examined. Transplantation of 3T3/D3 cells in the ischemic hind limbs of mice resulted in robust physiological blood flow recovery on day 7 post-injury, compared to mice that were transplanted with 3T3 cells (FIGS. 12A, 12B), as measured by laser Doppler perfusion imaging. Additionally, 3T3/D3 transplanted ischemic limbs displayed a significantly higher number of capillaries, suggesting enhanced neo-vas cularization as well a higher proliferation of transplanted 3T3/D3 cells, in vivo (FIGS. 12C, 12D). Furthermore, trans planted 3T3/D3 cells expressed EC (CD31) and muscle cell (desmin) markers indicating in vivo differentiation into cells of these two lineages (FIG. 13). 0131 The goal of therapeutic cloning is to produce pluri potent stem cells with the nuclear genome of the Subject and induce the cells to differentiate into replacement cells, for example, cardiomyocytes, for repairing damaged heart tissue. Reports on the generation of pluripotent stem cells (J. B. Cibelliet al., Nat Biotechnol. 16, 642 (1998); M.J. Munsie et al., Curr Biol. 10,989 (2000); T. Wakayama et al., Science. 292, 740 (2001)) or histocompatible tissues (R. P. Lanza et al., Nat Biotechnol. 20, 689 (2002)) by nuclear transplantation, and on the correction of a genetic defect in cloned ESCs (W.

Jun. 3, 2010

M. Rideout et al., Cell. 109, 17 (2002)) suggest that therapeu tic cloning could in theory provide a source of cells for regen erative therapy. Recent evidence on the efficacy of human therapeutic cloning, however, underscores the difficulties associated with the generation of human ESC lines for thera peutic purposes. Moreover, a number of limitations may hinder the strategy of therapeutic cloning for future clinical applications. Extremely low efficiency of Somatic nuclear transfer is a major concern. Analysis of the literature on mouse SNT derived ESC lines raises concerns about the feasibility and relevance of therapeutic cloning, in its current embodiment, for human clinical practice. Nuclear transfer is unlikely to be much more efficient in human than in mouse. Optimistically, s100 human oocytes would be required to generate customized ESC lines for a single individual. Including the complexity of the volunteer reimbursement and oocyte retrieval procedure, the cost of a human oocyte could bess 1,000-2,000 in the U.S. Thus, to generate a set of cus tomized ESC lines for an individual, the budget for the human oocyte material alone would be sS100,000-200,000. This prohibitively high Sum might impede the widespread appli cation of this technology in its present form. This limitation might be alleviated with oocytes from other species, but mito chondrial genome differences between species are likely to pose a problem. Another current challenge of therapeutic cloning is to overcome abnormalities encountered in cloned animals as these may reflect defects in cloned ESC. In spite of the production of cloned animals and ESC-like cells by nuclear transplantation, reports of unstable or abnormal gene expression patterns in cloned embryos and fetuses Suggest incomplete reprogramming. Finally, ethical debate related to human oocyte manipulations add to the limitations. It is there fore desirable to develop alternative strategies to oocyte-de pendent therapeutic cloning. The results described herein indicate that mESC extract-mediated reverse lineage commit ment of terminally differentiated murine fibroblasts and re differentiation of these reprogrammed cells support the fea sibility of this approach and provide evidence that the stem like cells obtained using this methodology are functionally competent for tissue repair. 0.132. This is the first study to demonstrate that mESC extracts can not only reprogram Somatic cells towards multi potency but more importantly, de-differentiated Somatic cells can trans-differentiate into endothelial, skeletal muscle and cardiomyocytes in vivo and repair damaged tissues, in experi mental critical limb ischemia and acute myocardial infarction and critical limb ischemia models. The histological evidence is well Supported by physiological data that shows significant improvements in left ventricular function and hind limb per fusion in AMI and HLI models, respectively. Taken together our biochemical, molecular and functional data provide an oocyte-independent approach for the generation of functional autologous multipotent cells from terminally differentiated Somatic cells. Refinement of techniques and additional experimental data to elucidate applicability of this approach in primary Somatic cells of different lineages may hold sig nificant promise for future use of Such generated cells in regenerative medicine, including cardiac repair and regenera tion. I0133. The results reported above, were obtained using the following materials and methods. Cell Culture

I0134 NIH3T3 Swiss-Albino fibroblasts (ATCC) were cultured in DMEM (Sigma-Aldrich) with 10% FCS,

US 2010/01 3597.0 A1

L-glutamine, and 0.1 mMB-mercaptoethanol. The D3-mESC were obtained from ATCC (CRL-1934TM) and cultured in DMEM medium supplemented with 10% FBS, 1 mM Sodium pyruvate, 100 U/ml penicillin G, 100 ug/ml Strepto mycin, 2 mM glutamine, 1 mM MEM nonessential amino acids, 50 uM2-mercaptoethanol, 100 mMMTG and 10 ng/ml of LIF (Gibco BRL, Rockville, Md.), in A 5% CO, incubator at 37° C. D3 cells were cultured free of feeder cells and sub-cultured every 3-5 days with one medium change in between days. Cell Extracts

0135. The mouse embryonic stem cells (mESC) and 3T3 cells extract was prepared as described by Taranger et al., Mol Biol Cell. 16:5719 (2005), which is herein incorporated by reference. Briefly, the cells were washed in phosphate-buff ered saline (PBS) and in cell lysis buffer (100 mM HEPES, pH 8.2, 50 mMNaCl, 5 mMMgCl, 1 mM dithiothreitol, and protease inhibitors), sediment at 10,000 rpm, re-suspended in 1 Volume of cold cell lysis buffer, and incubated for 30-45 minutes on ice. Cells were Sonicated on ice in 200-ul aliquots using a Sonicator fitted with a 3-mm-diameter probe until all cells and nuclei were lysed, as judged by microscopy. The lysate was sediment at 12,000 rpm for 15 minutes at 4°C. to pellet the coarse material. The Supernatant was aliquoted, frozen in liquid nitrogen and stored at -80° C. Protein con centration of the mESC and NIH 3T3 cell extracts were deter mined by Bradford assay. Streptolysin-O (SLO)-Mediated Permeabilization and Cell Extract Treatment

0136. The SLO-mediated permeabilization and extract treatment was performed as follows. NIH3T3 cells were washed in cold PBS and in cold Ca"- and Mg"-free Hank’s balanced salt solution (HBSS) (Invitrogen, Carlsbad, Calif.). Cells were re-suspended in aliquots of 100,000-cells/100 ul of HBSS, or multiples thereof; placed in 1.5-ml tubes; and centrifuged at 1500 rpm for 5 minutes at 4°C. in a swing-out rotor. Sedimented cells were suspended in 97.7 ul of cold Hank's buffered salt solution (HBSS). Tubes were placed in a HO bath at 37°C. for 2 minutes, and 2.3 ul of SLO (Sigma Aldrich) (100 g/ml stock diluted 1:10 in cold HBSS) was added to a final SLO concentration of 230 ng/ml. Samples were incubated horizontally in a HO bath for 50 minutes at 37°C. with occasional agitation and set on ice. Samples were diluted with 200 ul of cold HBSS, and cells were sedimented at 1500 rpm for 5 minutes at 4°C. Permeabilization efficiency of 80% was obtained as assessed by monitoring uptake of a 70,000-M, Texas Red-conjugated dextran (50 g/ml. Invitro gen). After permeabilization, NIH3T3 cells were suspended at 2,000 cells/ul in 100 ul of mESC extractor control NIH3T3 cells extract containing an ATP-regenerating system (1 mM ATP, 10 mM creatine phosphate, and 25 ug/ml creatine kinase; Sigma-Aldrich), 100LMGTP (Sigma-Aldrich), and 1 mM each nucleotide triphosphate (NTP: Roche Diagnostics, Indianapolis, Ind.). The tube containing cells were incubated horizontally for 1 hr at 37°C. in a HO bath with occasional agitation. To reseal plasma membranes, the cell Suspension was diluted with complete DMEM medium containing 2 mM CaCl and antibiotics, and cells were seeded at 100,000 cells per well on a 48-well plate. After 2 hours, floating cells were removed, and plated cells were cultured in complete DMEM medium.

Determination of De-Differentiation

0137 De-differentiation of NIH3T3 following D3-cell extract treatment was determined by the induction of ESC

Jun. 3, 2010

markers both at the mRNA level by quantitative real time PCR and at the protein level by immuno-staining. Both self extract treated and D3-extract treated 3T3 cells were cultured in the presence of 10 ng/ml of LIF for 10 days. The treated cells were then subcultured by plating 1x10° cells per well for an additional 2 days in a 6-well culture plate. Total cellular RNA was harvested and the quantitative real-time RT-PCR was performed to determine mRNA expression of selected embryonic stem cell markers in self extract and D3-extract treated cells, as described previously (40). Primers used to amplify embryonic stem cell markers Nanog, SCF, SSEA1, Oct-4 and c-Kit are listed in table 1. Relative mRNA expres sion of target genes was normalized to the endogenous 18S control gene (Applied Biosystems). Enhanced expression of stem cell specific mRNAs was further corroborated by immu nofluorescence protein staining of induced specific stem cell markers in NIH 3T3 cells treated with D3 extract. For immuno-staining, both control and D3 extract treated NIH3T3 cells were cultured in medium in the absence and presence of LIF for 10 days. Then the cells were harvested and cultured 1x10" cells per well in 4-well slides coated with 0.5% gelatin for another 2 days. The slides were stained with specific antibodies to stem cell markers, c-Kit and Oct-4. De-differentiation was also determined by the lamin B and lamin A/C (markers of Soma) protein expression.

In Vitro Cardiomyocytes (CMC) and Endothelial Cell (EC) Lineage Differentiation of D3-Extract Treated NIH3T3 Cells

0.138. To determine their transdifferentiating potency, dedifferentiated NIH3T3 cells and control cells were cultured in complete DMEM containing 5 ng/ml of LIF and 3 ng/ml of Bone morphogenic protein-2 (BMP2) in 6-well culture plates (1x10 cells per well) and 4-well chamber slides (1x10" cells per well) coated with 0.5% gelatin for 7 days. Total cellular RNA was harvested from 6-well culture plate and used to analyze quantitative expression of cardiomyocyte specific markers, cardiotroponin I and T. connexin 43, GATA4. Mef2c, Nkx2.5 and Tbx5 as determined by real-time PCR (primers listed in table S1). The expression was normalized to that of 18S RNA. The protein expression of sarcomeric acti nin was determined by histochemical staining. For EC lin eage differentiation, D3-treated and control cells were cul tured in medium suitable for inducing endothelial differentiation (10% FBS/EBM-2: Clonetics) medium con taining Supplements (SingleCuot Kit; Clonetics) for 7 days. mRNA expression for endothelial cell (EC) markers, CD31, Flk1 and VEGFR3 was determined by real-time PCR (prim ers listed in table 1) and by incubated with Dil-acLDL (Bio medical Technologies) for one hour followed by Isolectin B4 staining. The dual stained cells were identified as endothelial cells.

Induction of Neuronal and Adipogenic Differentiation

0.139. The neuronal differentiation was performed as described by Kusano et al., Nat Med. 11, 1197 (2005), which is hereby incorporated by reference. Briefly, cells were seeded in complete DMEM medium at 5x10 cells per 90-mm sterile culture dish. Suspension cultures were main tained for 24 hours before adding 10 uM all-trans-retinoic acid (Sigma-Aldrich). Cells were cultured for 3 weeks in retinoic acid, and the medium was replaced every 2-3 days. Subsequently, cell aggregates were washed in complete DMEM medium and plated onto poly-L-lysine (10 ug/ml;

US 2010/01 3597.0 A1

Sigma-Aldrich)-coated plates in complete DMEM medium containing the mitotic inhibitors fluorodeoxyuridine (10 uM; Sigma-Aldrich), cytosine arabinosine (1 LM, Sigma-Ald rich), and uridine (10 uM; Sigma-Aldrich). The culture dishes were stained for neuronal markers nestin and B-tubulin-III. 0140. The adipogenic differentiation was performed as described by Stewart et al., Stem Cells. 21, 248 (2003). Briefly, the cells were cultured for 21 days in complete DMEM/Ham's F-12 medium containing dexamethasone, insulin and indomethacin. Cells were fixed with 4% paraformaldehyde, washed in 5% isopropanol, and stained for 15 minutes with Oil-Red-O (Sigma Aldrich).

Immunochemical Staining

0141 For immunochemical staining cells under different culture conditions were cultured on 4 well slides for various times, rinsed once with PBS and fixed with 4% paraformal dehyde (Sigma) in PBS for 30 minutes. The slides were rinsed three times with PBS and then permeabilized with 0.3% of Triton X-100 (Sigma) in PBS for 5 minutes. After 2 washings with PBS, specific primary antibodies diluted in PBS con taining 1% FBS were added and incubated overnight at 4°C. After 3 additional washes with PBS, the slides were incubated with the respective secondary antibodies for 1 hour at 37° C. The excess secondary antibodies in the slides were rinsed off by washing in PBS three times. Finally to visualize nuclei, slides were stained with Dapi for 5 minutes and washed 3 times with PBS, allowed to dry for 5 minutes and then mounted on Vectashield mounting medium for fluorescence imaging. The photographs were taken in a Nikon TE200 Digital Imaging system.

Determination of Oct4 Promoter Methylation and Bisulfite Genomic Sequencing and Chromatin Immunoprecipitation (ChIP).

0142 Genomic DNA prepared from D3, 3T3/D3 and 3T3 cells was amplified for Oct4 promoter and the PCR product was digested with HpyCH4IV restriction enzymes that cleave at methylated CpG sites. The digested products were ana lyzed on agarose gels. For genomic bisulphate sequencing, genomic DNA from cells was digested with EcoR1 and was used for bisulphite treatment using EZ DNA methylation Gold kit essentially following manufacturer's instructions. The treated DNA was ethanol-precipitated and resuspended in water and then amplified by PCR using mouse Oct4 prim ers (table S1). PCR products were digested with HpyCH4IV (New England Biolabs) restriction enzyme. Because only unmethylated cytosine residues were changed to thymines by the sodium bisulphite reaction, PCR fragments from nonm ethylated genomic DNA were resistant to HpyCH4IV, and those from methylated DNA were digested by the enzymes. The resultant products of restriction mapping were assessed by agarose gel electrophoresis. The remaining PCR products were purified using a commercially available purification column provided by the Wizard DNA Clean-Up system (Promega, Madison, Wis.). Purified samples were directly sequenced to determine the methylation status of all 10 CpG residues present in the amplified promoter region. Chromatin Immunoprecipitation (ChIP) assays were carried out as described in Kishore et al., J. Clin Invest. 115L 1785 (2005).

Jun. 3, 2010

Anti-Acetyl H3, anti-acetyl H4 and anti-dimethyl K9 anti bodies were purchased from Upstate Biotech and Santa Cruz.

Genome-Wide Expression Profiling and Gene Expression Analyses. 0.143 Affymetrix mouse genome A2 GeneChips were used for hybridization. Using a poly-dT primer incorporating a T7 promoter, double-stranded cDNA was synthesized from 5ug total RNA using a double-stranded cDNA synthesis kit (Invitrogen, Carlsbad, Calif.). Double-stranded cDNA was purified with the Affymetrix sample cleanup module (Af fymetrix, Santa Clara, Calif.). Biotin-labeled cRNA was gen erated from the double-stranded cDNA template through in vitro transcription (IVT) with T7 polymerase, and a nucleotide mix containing biotinylated UTP (3'-Amplifica tion Reagents for IVT Labeling Kit; Affymetrix). The bioti nylated cRNA was purified using the Affymetrix sample cleanup module. For each sample, 15ug of IVT product was digested with fragmentation buffer (Affymetrix, Santa Clara, Calif.) for 35 minutes at 94°C., to an average size of 35 to 200 bases. 10 ug of the fragmented, biotinylated cFNA, along with hybridization controls (Affymetrix), was hybridized to a Mouse 430A 2.0 GeneChip for 16 hours at 45° C. and 60 rpm. Arrays were washed and stained according to the standard Antibody Amplification for Eukaryotic Targets protocol (Af fymetrix). The stained arrays were scanned at 532 nm using an Affymetrix GeneChip Scanner 3000. 0144. During analysis and for quality control, GeneChip(R) arrays were first inspected using a series of quality control steps. Present call rates were consistent across the twelve arrays, ranging from 56% to 63%. The hybridization control BioB was found to be present 100% of the time, and the remaining hybridization controls (BioB, BioC, BioC, Cre) were present 100% of the time. Images of all arrays were examined, and no obvious scratches or spatial variation was observed. A visual inspection of the distribution of raw PM probes values for the twelve arrays showed no outlying arrays. Similarly, digestion curves describing trends in RNA degradation between the 5' end and the 3' end of each probeset were generated, and all twelve proved comparable. Probe sets with no Present calls across the twelve arrays as well as Affymetrix control probe sets were excluded from further analyses. Raw intensity values for the remaining 17.213 probe sets were processed first by RMA (Robust Multi-Array Average) using the R package affy (40). Specifically, expres sion values were computed from raw CEL files by first apply ing the RMA model of probe-specific correction of PM (per fect match) probes. These corrected probe values were then normalized via quantile normalization, and a median polish was applied to compute one expression measure from all probe values. Resulting RMA expression values were log transformed. (Please see the affy manual at www.bioconduc tor.org/repository/devel/vignette/affy.pdf for details). Distri butions of expression values processed via RMA of all arrays were very similar with no apparent outlying arrays. Pearson correlation coefficients and Spearman rank coefficients were computed on the RMA expression values (log-transformed) for each set of biological triplicates. Spearman coefficients ranged from 0.990 to 0.996: Pearson coefficients ranged between 0.991 and 0.997. Differential expression of genes was determined by one-way ANOVA on the RMA expression values of each probe set, using the R package limma (30). A multiple testing adjustment (31) was performed on the result ing statistics to adjust the false discovery rate. Differentially

US 2010/01 3597.0 A1

expressed probes with adjusted p-value <0.01 and a fold change of greater than two (absolute log fold change of greater than 1) were extracted for further inspection. Hierar chical clustering was obtained by using the Pearson correla tion coefficient and average agglomeration method, and the heatmaps were generated using Z-scored probes, in which Z-scores (Subtraction of mean and division by standard devia tion of normalized values) were computed for each probe across all twelve arrays.

CFP-Transduction and Dil Labeling of Cells for Transplan tation.

0145 For tracking of transplanted cells in cardiac tissues, D3-extract treated control NIH3T3 cells were transduced with a lentivirus-GFP construct. For tracking of transplanted cells in hindlimb ischemic tissues, the cells were labeled with DiI before the transplantation.

Teratoma Formation and Histological Analysis. 0146 D3, 3T3 and 3T3/D3 cells were suspended at 1x107 cell/ml in cytokine-reduced matrigel. SCID mice (5 mice/cell type) were injected with 100 ul of cell suspension (1x10' cells) subcutaneously into dorsal flank. Tumors were resur rected when they reached the size of approximately 3 cm (3 week from injection for D3 cells and 7 weeks following 3T3/D3 cell injections (kinetics shown in FIG. 7B). Half of the dissected tumors were Snap frozen, sectioned and were stained with specific primary antibodies.

Hind Limb Ischemia, Cell Transplantation, and Laser Dop pler Imaging. 0147 To ascertain the functional efficacy of repro grammed D3-extract treated 3T3 cells in a physiologically relevant model of tissue repair, studies were conducted in a well-established mouse hind limb ischemia model. The hind limb ischemia was established by the excision of femoral artery in the left hind limb in 10 male 8-week old mice (Jackson Labs) essentially as described in our prior publica tion (20). The animals were separated into two groups. Each group received either Dil-labeled-5x103T3 cells or 3T3-D3 cells. The cells were injected at multiple sites into the ischemic muscle. Laser Doppler imaging was carried out to determine blood flow immediately after surgery (day 0) and at day 7 after cell injections. To assess the proliferation of injected cells, a few animals were injected with BrdU intra venously 24 hours before the collection of tissues. Fourteen days after cell transplantation, the tissues were harvested and assayed by histochemical/immuno-fluorescence staining for isolectin B4 (EC identity), Desmin (muscle), BrdU, and DiI followed by fluorescence microscopy. In some experiments, animals were perfused with FITC-BS-1 lectin to identify capillaries before sacrifice and tissue retrieval.

Mice and Establishment of AMI

0148 All procedures were performed in accordance with the guidelines of the Caritas St. Elizabeth's Institutional Ani mal Care and Use Committee. The study involved 8-week-old male FVB mice (n=30; Jackson Laboratories). Mice under went Surgery to induce acute myocardial infarction by liga tion of the left anterior descending coronary artery, as described before (32, 41). Animals were sub-divided into 3 groups, and received intramyocardial injection of 2.5x10" lentiviral-GFP transduced D3-extract treated cells, 3T3 fibro

20 Jun. 3, 2010

blast control cells and saline, respectively, in total volume of 10 ul at 5 sites (basal anterior, mid anterior, mid lateral, apical anterior and apical lateral) in the peri-infarct area.

Physiological Assessments of LV Function Using Echocar diography

0149 Mice underwent echocardiography just before MI (base level) and one, two and four weeks after AMI as described by Iwakura et al., Circulation. 113: 1605 (2006) and Yoon et al., J. Clin Invest. 111: 717 (2003). Briefly, tran sthoracic echocardiography was performed with a 6 to 15 MHz transducer (SONOS 5500, Hewlett Packard). Two-di mensional images were obtained in the parasternal long and short axis and apical 4-chamber views. M-mode images of the left ventricular short axis were taken at just below the level of the mid-papillary muscles. Left ventricular end-diastolic and end-systolic dimensions were measured and functional short ing was determined according to the modified American Society of Echocardiography-recommended guidelines. A mean value of 3 measurements was determined for each sample.

Histology

0150. Mice were euthanized and the aortas were perfused with saline. The hearts were sliced into 4 transverse sections from apex to base and fixed with 4% paraformaldehyde, methanol or frozen in OCT compound and sectioned into 5-lum thickness. Immunoflurorescence staining was per formed to evaluate cardiomyocyte and EC differentiation of transplanted cells; to determine myocardial proliferation (kió7 staining) and apoptosis (TUNEL), essentially as described by Yoon et al., J Clin Invest. 111, 717 (2003).

Fibrosis Area

0151. For the measurement of fibrosis, tissues sections were frozen in OCT compound and sectioned for elastic tissue/trichrome to measure the average ratio of the external circumference of fibrosis area to LV area.

Statistical Analyses.

0152 All experiments were carried out at least 3 times with similar results. Results are presented as mean-SEM. Comparisons were done by ANOVA (GB-STAT: Dynamic Microsystems Inc.) or X test for percentages. All tests were 2-sided, and a P value of less than 0.05 was considered sta tistically significant.

Other Embodiments

0153. From the foregoing description, it will be apparent that variations and modifications may be made to the inven tion described herein to adopt it to various usages and condi tions. Such embodiments are also within the scope of the following claims. The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or Subcombi nation) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof. 0154 All patents and publications mentioned in this speci fication are herein incorporated by reference to the same

US 2010/01 3597.0 A1

extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

1. A method for generating a reprogrammed cell, the method comprising:

(a) contacting a somatic cell comprising a permeable cell membrane with an embryonic stem cell extract, thereby generating a de-differentiated cell; and

(b) culturing the de-differentiated cell in the presence of at least one agent that induces differentiation, thereby gen erating a reprogrammed cell.

2. The method of claim 1, wherein the method further comprises providing the cell to a Subject for the repair or regeneration of a tissue or organ.

3. (canceled) 4. The method of claim 1, wherein the contacting occurs in

an ATP regenerating buffer that comprises one or more of ATP, creatine phosphate, and creatine kinase.

5. The method of claim 1, wherein the de-differentiated cell expresses an embryonic stem cell marker selected from the group consisting of Nanog, SCF, SSEA1, Oct-4, and c-Kit.

6. (canceled) 7. The method of claim 1, wherein the de-differentiated cell

has reduced levels of DNA methylation or increased levels of histone acetylation relative to an untreated Somatic cell.

8-9. (canceled) 10. The method of claim 1, wherein the agent is selected

from the group consisting of LIF, BMP-2, retinoic acid, trans retinoic acid, dexamethasone, insulin, and indomethacin.

11. The method of claim 1, wherein the cell is cultured under conditions selected from the group consisting of

in the presence of LIF and BMP-2 to generate a repro grammed cell that expresses a cardiomyocyte specific gene selected from the group consisting of connexin43, Mef2C, Nkx2.5, GATA4, cardiac troponin I, cardiac troponin T, and Tbx5;

in the presence of fibronectin and 10% fetal bovine serum to generate a reprogrammed cell that expresses an endot helial cell marker that is CD31 or Flk-1;

in the presence of all-trans retinoic acid or a derivative thereof to generate a reprogrammed cell that expresses a neuronal marker selected from the group consisting of nestin and B-tubulin; and

in the presence of at least one of retinoic acid, dexametha Sone, insulin, and indomethacin to generate a repro grammed cell that is positive for Oil red O or acetylated LDL uptake.

12-19. (canceled) 20. A method for repairing or regenerating a tissue in a

Subject, the method comprising

Jun. 3, 2010

(a) obtaining the reprogrammed cell of claim 1, and (b) administering the cell to the Subject to repair or regen

erate a tissue. 21-25. (canceled) 26. The method of claim 20, wherein the cell is adminis

tered directly to a subject at a site where an increase in cell number is desired.

27. (canceled) 30. A method of ameliorating an ischemic condition in a

Subject, the method comprising (a) contacting a fibroblast cell comprising a permeable cell membrane with an embryonic stem cell extract in an ATP regenerating buffer;

(b) culturing the cell in the presence of LIF and BMP-2 to generate an endothelial cell; and

(c) administering the endothelial cell of step (b) into a muscle tissue of the Subject, thereby ameliorating an ischemic condition.

31. (canceled) 32. The method of claim 30, wherein the method reduces

apoptosis, increases cell proliferation, increases function, or increases perfusion of the muscle tissue.

33-43. (canceled) 44. A reprogrammed cell obtained by the method of claim

1. 45. The reprogrammed cell of claim 44, wherein the cell is

a differentiated cardiomyocyte, endothelial cell, neuronal cell, adipocyte, or a precursor thereof.

46. The reprogrammed cell of claim 44, wherein the cell expresses a cardiomyocyte marker selected from the group consisting of connexin43, Mef2C, Nkx2.5, GATA4, cardiac troponin I, cardiac troponin T, and Tbx5.

47. The reprogrammed cell of claim 44, wherein the cell is an endothelial cell that expresses an endothelial marker that is CD31 or Flk-1.

48. The reprogrammed cell of claim 44, wherein the cell is a neuronal cell that expresses a neuronal marker that is nestin or B-tubulin.

49. The reprogrammed cell of claim 44, wherein the cell is an adipocyte cell that is positive for Oil red O.

50. A tissue comprising the reprogrammed cell of claim 44. 51. A pharmaceutical composition comprising an effective

amount of a cell of claim 44 in a pharmaceutically acceptable excipient for administration to a Subject.

52. A kit for tissue repair or regeneration comprising a reprogrammed cell obtained by the method of claim 1 and instructions for use of the cell in methods of tissue repair or regeneration.

(12) Patent Application Publication (10) Pub. No.: US 2010 ...

Documents

Transcript of (12) Patent Application Publication (10) Pub. No.: US 2010 ...