Maria Lina R

of 7 /7
Risalah Seminar Ilmiah Aplikasi lsotop dan Radiasi, 2(}()6 DETEKSI Mycobacterium tuberculosis DAN RESISTENSINY A TERHADAP RIFAMPISIN DENGAN METODE NESTED POLYMERASE CHAIN REACTION/PCR DAN SEKWENSING. Maria Lina R. Pusat Aplikasi Teknologi Isotop dan Radiasi - BATAN ABSTRAK DETEKSI Mycocacterium. tuberculosis DAN RESISTENSINY A TERHADAP RIFAMPISIN DENGAN METODE NESTED POLYMERASE CHAIN REACTION/ PCR DAN SEKWENSING. DNA rpo~ (RNA polymerase sub unit fJ! M. tuberculosis dapat diamplifikasi secara spesifik dengan metode nested PCR. Nested PCR yang dilanjutkan dengan sekwensing dapat secara langsung diaplikasikan untuk mendeteksi M. tuberculosis dan menentukan resistensinya terhadap rifampisin dalam sampel sputum.maupun isolat klinis. Dalam penelitian ini digunakan 20 isolat klinis dan 30 sampel sputum yang diamplifikasi dengan primer yang dirancang daTi bagian gen rpofJ M. tuberculosis. Metode fenol-kloroform dan metode Boom masing-masing digunakan untuk ekstraksi DNA isolat klinis dan sampel sputum. Sekwensing hanya dilakukan untuk hasil PCR dari sampel sputum. DaTi 20 isolat klinis, 15 isolat positif terdeteksi sebagai M. tuberculosis dengan nested PCR, 4 isolat tergolong MOTT (Mycobacteria Other Than Tuberculosis) dan 1 isolat non- mycobacteria. HasH nested PCR pada 30 sampel sputum dengan 25 sampel BTA (BasilTahan Asam) positif dan 5 sampel BTA negatif, menunjukkan hasil positif pada 21 sampel. Besarnya produk first-round dan second-round PCR masing-masing adalah 205 bp dan 157 bp. Berdasarkan hasil sekwensing daTi produk amplifikasi yang positif pada sampel sputum, diperoleh M. tuberculosis daTi 8 sampel tidak mengalami mutasi pad a bagian gen rpo~. ABSTRACT NESTED POLYMERASE CHAIN REACTION / PCR AND SEQUENCING METHODS FOR DETECTION OF Mycobacterium tuberculosis AND ITS RESISTANCE TO RIFAMPICIN. The rpo~ (RNA polymerase sub unit~) DNA of M. tuberculosis can be specifically amplified by using a nested PCR The nested-PCR linked to DNA sequencing was applied directly to detect M. tuberculosis and determine the rifampicin resistance either in clinical isolates or sputa. Samples used in this research were 20 clinical isolates and 30 sputa which were amplified with the region of rpo~ DNA of M. tuberculosis. DNA of clinical isolates and sputum samples were extracted by means of fenol-kloroform and Boom's methods, respectively. Sequencing method was just applied for sputum samples. Of 20 clinical isolates, 15 isolates were positive of results as M. tuberculosis with nested-PCR., 4 isolates were MOTT and 1 isolate was non-mycobacteria. The nested-PCR could detect 21 sputum samples of 30 samples consist of 25 samples with positif AFB (Acid fast bacilli! and 5 samples with negative AFB. First-round and second-round PCR products were 205 bp and 157 bp, respectively. Results of the sequencing method from positive amplified sputum, revealed that mutation of rpo~ gen region did not occur in M. tuberculosis of 8 sputums samples PENDAHULUAN Tuberkulosis (TBe) , pen yak it infeksi disebabkan M. tuberculosis sampai saat ini masih menjadi masalah serius di seluruh dunia, .karena merupakan penyebab kematian tertinggi. Setiap tahun diperkirakan 8 juta infeksi baru terjadi dan 2,5 sampai dengan 3 juta meninbulkan kematian. (11. Dari seluruh kasus TBC di dunia, 38% terdapat di Asia Tenggara dan lebih dari 95% kasus tersebut terdapat di negara berkembang seperti India, Indonesia, Bangladesh, Thailand, dan Myanmar (21. Dalam Annual report on global TB control 2003, WHO menyatakan ada 22 negara dikategorikan sebagai high-burden countries terhadap TBC. Indonesia termasuk peringkat ketiga tertinggi jumlah kasus TBC di dunia setelah India dan China (31. Berdasarkan hasil Survei Kesehatan Rumah Tangga (SKRT) tahun 2001 (4). TBC menduduki peringkat ke tiga sebagai penyebab kematian (9,4% dari total kematian). setelah penyakit kardiovaskular dan sistem pernafasan. WHO memperkirakan 583.000 kasus baru tuberkulosis terjadi di Indonesia setiap tahun dan 140.000 mengakibatkan kematian (5). Estimasi prevalensi TBC di Indonesia berdasarkan pemeriksaan mikroskopik BTA positif sebesar 148,5 per 49

Embed Size (px)

Transcript of Maria Lina R

  • Risalah Seminar Ilmiah Aplikasi lsotop dan Radiasi, 2(}()6

    DETEKSI Mycobacterium tuberculosis DAN RESISTENSINY A TERHADAPRIFAMPISIN DENGAN METODE NESTED POLYMERASE CHAIN

    REACTION/PCR DAN SEKWENSING.

    Maria Lina R.

    Pusat Aplikasi Teknologi Isotop dan Radiasi - BATAN

    ABSTRAK

    DETEKSI Mycocacterium. tuberculosis DAN RESISTENSINY A TERHADAPRIFAMPISIN DENGAN METODE NESTED POLYMERASE CHAIN REACTION/ PCR DANSEKWENSING. DNA rpo~ (RNA polymerase sub unit fJ! M. tuberculosis dapat diamplifikasi secaraspesifik dengan metode nested PCR. Nested PCR yang dilanjutkan dengan sekwensing dapat secaralangsung diaplikasikan untuk mendeteksi M. tuberculosis dan menentukan resistensinya terhadaprifampisin dalam sampel sputum.maupun isolat klinis. Dalam penelitian ini digunakan 20 isolatklinis dan 30 sampel sputum yang diamplifikasi dengan primer yang dirancang daTi bagian genrpofJ M. tuberculosis. Metode fenol-kloroform dan metode Boom masing-masing digunakan untukekstraksi DNA isolat klinis dan sampel sputum. Sekwensing hanya dilakukan untuk hasil PCRdari sampel sputum. DaTi 20 isolat klinis, 15 isolat positif terdeteksi sebagai M. tuberculosis dengannested PCR, 4 isolat tergolong MOTT (Mycobacteria Other Than Tuberculosis) dan 1 isolat non-mycobacteria. HasH nested PCR pada 30 sampel sputum dengan 25 sampel BTA (BasilTahan Asam)positif dan 5 sampel BTA negatif, menunjukkan hasil positif pada 21 sampel. Besarnya produkfirst-round dan second-round PCR masing-masing adalah 205 bp dan 157 bp. Berdasarkan hasilsekwensing daTi produk amplifikasi yang positif pada sampel sputum, diperoleh M. tuberculosisdaTi 8 sampel tidak mengalami mutasi pada bagian gen rpo~.

    ABSTRACT

    NESTED POLYMERASE CHAIN REACTION / PCR AND SEQUENCING METHODSFOR DETECTION OF Mycobacterium tuberculosis AND ITS RESISTANCE TORIFAMPICIN. The rpo~ (RNApolymerase sub unit~) DNA of M. tuberculosis can be specificallyamplified by using a nested PCR The nested-PCR linked to DNA sequencing was applied directlyto detect M. tuberculosis and determine the rifampicin resistance either in clinical isolates or sputa.Samples used in this research were 20 clinical isolates and 30 sputa which were amplified with theregion of rpo~ DNA of M. tuberculosis. DNA of clinical isolates and sputum samples wereextracted by means of fenol-kloroform and Boom's methods, respectively. Sequencing methodwas just applied for sputum samples. Of 20 clinical isolates, 15 isolates were positive of results asM. tuberculosis with nested-PCR., 4 isolates were MOTT and 1 isolate was non-mycobacteria. Thenested-PCR could detect 21 sputum samples of 30 samples consist of 25 samples with positif AFB(Acid fast bacilli! and 5 samples with negative AFB. First-round and second-round PCR productswere 205 bp and 157 bp, respectively. Results of the sequencing method from positive amplifiedsputum, revealed that mutation of rpo~ gen region did not occur in M. tuberculosis of 8 sputumssamples

    PENDAHULUAN

    Tuberkulosis (TBe) , pen yak it infeksidisebabkan M. tuberculosis sampai saat inimasih menjadi masalah serius di seluruh dunia,.karena merupakan penyebab kematian tertinggi.Setiap tahun diperkirakan 8 juta infeksi baruterjadi dan 2,5 sampai dengan 3 jutameninbulkan kematian. (11. Dari seluruh kasusTBC di dunia, 38% terdapat di Asia Tenggara danlebih dari 95% kasus tersebut terdapat di negaraberkembang seperti India, Indonesia,Bangladesh, Thailand, dan Myanmar (21. DalamAnnual report on global TB control 2003, WHO

    menyatakan ada 22 negara dikategorikan sebagaihigh-burden countries terhadap TBC. Indonesiatermasuk peringkat ketiga tertinggi jumlah kasusTBC di dunia setelah India dan China (31.Berdasarkan hasil Survei Kesehatan Rumah

    Tangga (SKRT) tahun 2001 (4). TBC mendudukiperingkat ke tiga sebagai penyebab kematian(9,4% dari total kematian). setelah penyakitkardiovaskular dan sistem pernafasan. WHOmemperkirakan 583.000 kasus baru tuberkulosisterjadi di Indonesia setiap tahun dan 140.000mengakibatkan kematian (5). Estimasi prevalensiTBC di Indonesia berdasarkan pemeriksaanmikroskopik BTA positif sebesar 148,5 per

    49

  • Risalah Seminar Ilmiah Aplikasi Isofop dan Radiasi, 2006

    100.000 orang (6). Program pemberantasantuberkulosis menjadi lebih rumit akibatmunculnya kuman penyebabnya yang resistenterhadap oat (obat anti tuberkulosis) disebabkanpenggunaan obat yang tidak tepat baik dosismaupun lamanya.

    Diagnosis tuberkulosis khususnyatuberkulosis paru, dapat ditegakkan denganpemeriksaan klinik ( anamnesis terhadap keluhanpenderita dan hasil pemeriksaan fisikLpemeriksaan laboratorium, dan pemeriksaanradiologik. Ketiga hasil pemeriksaan tersebutdisatukan untuk diagnosis tuberkulosis. Salahsatu pemeriksaan laboratorium adalahmendeteksi kuman M. tuberculosis sebagaipenyebabnya. Pada umumnya metode yangdigunakan adalah metode konvensional sepertipemeriksaan mikroskopik basil tahan asam(BTA) dan pemeriksaan kultur. Pemeriksaanmikroskopik cukup cepat dan ekonomis akantetapi sensitivitas dan spesifitasnya masih kurangsedangkan pemeriksaan kultur memerlukanwaktu yang cukup lama sekitar 3 - 12 minggu (7,8). Oleh karenanya, untuk mengatasiketerbatasan terse but , diperlukan met ode deteksiM. tuberculosis yang cepat, sensitif dan spesifikseperti metode PCR. Amplifikasi DNA M.tuberculosis dengan target sekwens yang berbedatelah banyak diteliti. menggunakan pasanganprimer dari bagian gen yang conserved seperti genyang menyandi protein 38 kDa, 65 kDa, mtp40(9, 10, 11) ataupun dari sekwens sisipan /insertionsequence seperti IS6110 (11,12).

    Pengembangan metode PCR untuk deteksiM. tuberculosis telah mulai dikembangkan dengantujuan untuk meningkatkan sensitivitas yaitudengan nested PCR. Metode tersebutmenggunakan 2 pasang primer dari bagian yangconserved dari genom bakteri terse but ( 7, 13,14J. Nested PCR yang dikaitkan dengan metodelain seperti nested PCR-SSCP ( 15 ) nested PCRreverse hybridization (16 ) dan nested PCR-sekwennsing (15). Metode tersebut dapatmendeteksi tidak hanya keberadaan M.tuberculosis dalam spesimen klinis akan tetapijuga dapat menentukan resistensinya tehadapoat, berdasarkan adanya mutasi gen penyandisasaran oat pada M. tuberculosis seperti gen rpo~untuk rifampisin.

    Dalam penelitian ini digunakan metodenested PCR dan nested PCR- sekwensing untukmendeteksi M. tuberculosis dalam isolat klinis dan

    sampel sputum dan mengetahui adanya mutasigen rpo~ yang berkaitan dengan resistensinyaterhadap rifampisin.

    BAHAN DAN METODE

    Sampel penelitian.

    50

    Dalam penelitian ini digunakan 20 isolatklinis M. tuberculosis hasil isolasi pasien. dan 30spesimen klinik berupa sputum. Isolat klinikdidapat dari Bagian Mikrobiologi, FakultasKedokteran, Universitas Indonesia dan telah diujisecara konvensional dengan metode kultur.Sampel sputum diperoleh dari PPTI(perkumpulan Pemberantasan TuberkulosisIndonesiaL Kebayoran Baru, Jakarta Selatandengan hasil mikroskopik BTA positif (25sampel) dan negatif (5 sampel). Data dukungpender ita meliputi jenis kelamin dan umur.Penderita terdiri dari 16 orang laki-laki dan 14perempuan dengan umur masing-masingberkisar 18 - 55 tahun dan 17 - 60 tahun.

    Homogenisasi dan Ekstraksi DNA Sputum

    Isolat klinis yang tumbuh dalam mediaLowenstein Jensen diekstraksi DNAnya denganmemanen isolat bakteri terse but dengan caramenambahkan larutan NaCl 0,9%. EkstraksiDNA dilakukan dengan cara sebelumnya (171.yaitu dengan melisis sel bakteri yang telahdipanen dengan larutan TE (Tris-EDTA) 1 x ,SDS (Sodium Dodecyl Sulfate) dan proteinase-K.kemudian ditambahkan larutan fenol-kloroform-

    isoamil alkohol (24: 1) untuk mengekstraksiDNA. Presipitasi DNA dilaksanakan denganmenambahkan etanol dan sentrifugasi dengankecepatan tinggi. Untuk proses PCR, pelet DNAyang diperoleh kemudian dilarutkan denganlarutan buffer TE 1x.

    Proses homogenisasi dan dekontaminasidilakukan untuk spesimen klinis (sputum)dengan tujuan untuk memekatkan sampelsehingga memperbanyak jumlah bakterikhususnya M. tuberculosis yang terkandungdalam sam pel sputum dan untuk mengeliminasimikroba lain selain mycobacteria. Sputumdihomogenisasi dan di-dekontaminasi denganlarutan asetil-L-sistein , NaOH dan Na- sitrat,kemudian disenrtifugasi. Metode untuk ekstraksiDNA sputum adalah metode Boom (18). Seldilisis dengan larutan Tris-HCl, guanidin tiosianatsebagai chao tropic agent, EDTA, dan triton X-lOO.Larutan diatom (pengikat DNA), aseton, etanol70% serta sentrifugasi dengan kecepatan tinggidigunakan untuk ekstraksi dan presipitasi DNA.Untuk proses PCR, DNA hasil ekstraksi dielusidengan buffer TE 1 x .

    Proses PCR dan ElektroforesisAmplifikasi DNA hasil ekstraksi dilakukan

    dengan nested PCR dan dilaksanakan diDepartement of Microbiology, Seoul NationalUniversity College of Medicine, Seoul Korea. Primeryang digunakan adalah TB1 (5'- ACGTGGAGGCGATCACACCGCAGA CGT-3') dan TB2 (5'-TGCACGTCGCGGACCTCCAGCCCGGCA-3')

  • sebagai outer primer sedangkan sebagai inner primerTB3 (5'-TCGCCGCGATCAAGGAGTTCTTC-3') danTR8 (5'-TGCACG TCG CGGACC TCCA-3'). Padaproses nested PCR digunakan campuran pereaksiyang sudah dikemas dalam tabung PCR ( AccuPower PCR Premix; Bioneer, Daejon, Korea) yangterdiri dari 50mM Tris-HCI (pH 8,3), 40 mM KCI,1,5 mM MgClz, 250 pM dNTP, 1U Taq DNApolymerase dan gel loading dye. Konsentrasi akhirouter primer dan inner primer masing-masing 20pmol dan 0,5 pmol. DNA target, ditambahkandalam campuran terse but (1 tabung untuk 1 reaksi)sehingga volume menjadi 20 pI. Program pada 151round PCR dari nested PCR meliputi 1 siklusdenaturasi awal, yaitu pada 94C, 5 menit; 15siklus dengan tiap siklus terdiri dari denaturasipada suhu 94C, 30 detik, annealing 82C, 30 detik,extension, 82C, 30 detik. Program ini langsungdilanjutkan dengan 2nd round PCR dengan 30 siklusdari denaturasi pada 94C, 30 detik; annealing,noc, 30 detik, extension noc, 30 detik, dan tahapakhir adalah extended extension pada noc, 5 menit.

    Hasil nested PCR dideteksi dengan teknikelektroforesis gel agarosa (1,50/0).-Visualisasi DNA

    dilakukan dengan UV (transilluminator~e"telah geldiwarnai dalam larutan'etidiurrroromida)-- -Sekwensing Produk PCR.

    Sekwensing dilakukan hanya untuk 20sampel sputum serta M. tuberculosis H37Rv hasilnested PCR. Persiapan untuk sekwensing dilakukandengan memotong masing-masing DNA sampelpada gel agarosa, kemudian dipurifikasi denganQIAEX II Agarose Gel Extraction. Sekwensingdengan menggunakan inner primer TR8. dandilaksanakan oleh Department of DNA Sequencing,Macrogen Company, Seoul, Korea.

    HASIL DAN PEMBAHASAN

    Nested PCR dalam penelitian ini telahmengamplifikasi DNA rpo~ M. tuberculosis.Produk amplifikasi pada first-round PCRmenggunakan primer TB 1 dan TB2menghasilkan fragmen DNA dengan ukuran 205bp, sedangkan fragmen ukuran 157 bpmerupakan prod uk PCR dengan primer TB3 danTR8 pada second-round PCR (Gambar 1 dan 2).Hasil posit if dari nested PCR yaitu terdapatnyafragmen DNA 205 bp at au 157 bp menunjukkanadanya M. tuberculosis.

    Hasil nested PCR isolat klinis dan sampelsputum beserta hasil BTAnya dapat dilihat padaTabel 1. Dari 20 isolat klinis, 5 isolatmenunjukkan hasil negatif yaitu tidak terlihatfragmen DNA baik fragmen 205 bp maupun 157bp pad a gel agarosa. Isolat terse but adalah R10(Gambar 1, lajur 101 ) dan Z4, Z9, ZlO, Zll(Gambar 2 , lajur 4, 8, 9, 10).

    Ib'salah Seminar Ilmiah Aplikasi Is%p dan Radiasi, 2006

    Dari hasil tersebut diperkirakan ke lima isolatadalah mycobacteria bukan M. tuberculosis(MOTT = Mycobacteria Other Than Tuberculosislat au bukan mycobacteria (non-mycobacteria). DNArpo~ MOTT atau non-mycobacteria tidakteramplifikasi pada first round nested PCR denganprimer yang sarna menggunakan suhu annealingyang tinggi (15). Fragmen DNA rpo~ berukuran342 bp dapat diamplifikasi dengan menggunakanprimer MF & MR dari 44 strain acuan (referencestrain) mycobacteria akan tetapi tidak adaamplifikasi pada DNA non-mycobacteria (191.Oleh karenanya, untuk mengetahui apakah kelima isolat terse but di at as tergolong dalammycobacteria atau non- mycobacteria, dilakukanjuga amplifikasi dengan primer MF & MR. IsolatlOR ternyata non-mycobacteria karena tidak adafragmen DNA 342 bp sebagai hasil amplifikasi,sedangkan 4 isolat lainnya (Z4, Z9, ZlO, Zll)mempunyai fragmen tersebut, menunjukkanisolat2 terse but tergolong dalam genusmycobacteria. Dari hasil restriksinya denganenzim restriksi HindII terlihat 4 isolat adalah

    MOTT karena fragmen 342 bp tidak terestriksi(data tidak diperlihatkan). Restriksi produk PCRdengan primer MF-MR dengan enzim HindII,dapat membedakan antara M. tuberculosiskompleks dan MOTT yaitu 2 fragmen (232 bp,110 bpI merupakan hasil restriksi M. tuberculosiskompleks , sedangkan untuk MOTT tidakdirestriksi (342 bpI (20). Hasil deteksi 5 isolatterse but secara konvensional dengan kulturmenunjukkan hasil posit if. Hal ini membuktikannested PCR lebih spesifik dibanding dengankultur. Dari hasil penelitian KIM dkk (15),menunjukkan amplifikasi dengan first round-nested PCR menggunakan primer TB 1 dan TB2pada 48 isolat klinik hasil identifikasi dengan tesbiokimia dan sekwensing 16S rDNA parsial,memberikan hasil positif hanya pada 20 isolatklinis sedangkan 28 isolat yang lain hasilnyanegatif. Semua isolat sesuai dengan hasilidentifikasi dengan tes biokimia dan sekwensingyaitu 20 isolat adalah M. tuberculosis dan 28 isolatadalah MOTT. Amplifikasi juga tidak terjadi pada19 strain acuan mycobacteria dan 9 strain non-mycobacteria. Produk PCR 322 bp pada nestedPCR dengan primer yang mengamplifikasi daerahgen yang menyandi protein 38-kDa (proteinantigen b) M. tuberculosis, hanya dapatmendeteksi M. tuberculosis kompleks dan tidakpada 10 strain acuan MOTT (21).

    Pada Tabel 1 terlihat hasil second round -

    PCR dari 30 sam pel sputum, 21 sampelmenunjukkan hasil posit if mengandung M.tuberculosis yaitu terdapatnya fragmen 157 bpdan sebaliknya 9 sampel negatif (Gambar 3).Dari hasil pemeriksaan secara mikroskopik pada9 sampel tersebut, 8 sampel menunjukkan hasil

    51

  • Risalah Seminar Ilmiah Aplikasi lsotop dan Radiasi, 2006

    BTA + 1 dan +2. Kemungkinan besar 8 sampeltersebut bukan terinfeksi M. tuberculosis akan

    tetapi terinfeksi MaTT. Identifikasi mycobacteriasecara mikroskopik langsung dari sputum tidakdapat mengidentifikasi species mycobacteria yangmenunjukkan met ode pemeriksaan terse butkurang spesifik.(8, 22). Tabel 1 jugamemperlihatkan hasil positif nested PCR pada 4sampel dari 5 sampel sputum dengan BTAnegatif. Penelitian CHENG dkk (23)menunjukkan hasil pemeriksaan mikroskopikdari 144 spesimen pulmonary dan extrapulmonarydari pasien dengan diagnosis secara klinikterinfeksi M. tuberculosis, hanya 25 % positifpada pemeriksaan BTA nya sedangkan 80% hasilposit if diperoleh dengan metode PCR. Pendapatumum menyatakan pasien dengan BTA negatiftidak berperan secara nyata menyebarkaninfeksi akan tetapi dari hasil penelitian BEHRdkk yang dikutip oleh GARCIA-QUINTANILLAdkk (24). diperoleh 27% kasus TB di SanFrancisco, California ditransmisi dari kasusdengan BTA negatif.

    Hasil nested PCR yang dilanjutkan dengansekwensing fragmen 157 bp dari gen rpo~ dalampenelitian ini dilakukan hanya pada 20 strain M.tuberculosis dari sample sputum dan M.tuberculosis H37Rv sebagai strain standar. Dari 20strain M. tuberculosis tersebut, hanya 8 sampeldan M. tuberculosis H37Rv yang dapatdiinterpretasikan hasil sekwensingnya sedangkanstrain M. tuberculosis yang lain tidak dapatdiinterpretasikan. Kemungkinan yangmenyebabkan tidak diperolehnya DNA yangmurni saat dipurifikasi pada 12 strain dari sampelsputum terse but dikarenakan terdapatnya DNAmultiband hasil PCR pada gel agarosa.Berdasarkan hasil sekwensing, pada strainstandar dan 8 strain M. tuberculosis dari sampelsputum ternyata tidak terjadi mutasi. Jadi strain2tersebut masih sensitif terhadap rifampisin.Dasar dari strain M. tuberculosis resisten terhadaprifampisin adalah adanya mutasi pada gen rpofJ.Beberapa peneliti menyatakan lebih dari 95%strain M. tuberculosis resisten rifampisindisebabkan adanya mutasi pada bagian DNA 81bp dari gen rpofJ yang menyandi RNA polymerasesub unit fJ (25,26, 1).

    Pada umumnya deteksi M. tuberculosis dengannested PCR digunakan untuk meningkatkansensitivitas dengan menggunakan beberapamacam primer yang dirancang dari bagian genatau sekwens sisipan (IS) M. tuberculosis yangconserved. Beberapa primer digunakan untuknested PCR seperti bagian gen yang menyandiantigen protein 65 kDa (7). antigen protein b 38kDa (211, MPB64 (major secreted protein specific toM. tuberculosis complex) (14) dan IS6110 (27).

    52

    Metode nested PCR-sequencing dalampenelitian ini dapat diaplikasikan langsunguntuk mendeteksi selain adanya M. tuberculosisdalam spesimen klinis seperti sputum juga dapatmengetahui resistensinya terhadap rifampisin.

    KESIMPULAN

    Nested PCR dapat mendeteksi M. tuberculosisdalam 15 isolat di antara 20 isolat klinis

    sedangkan 5 isolat lainnya yang negatifdengan nested-PCR ternyata 4 isolat tergolongMaTT dan 1 isolat non-mycobacteria.M. tuberculosis pada 21 sampel sputum dari30 sampel yang terdiri 25 sampel BTA + dan5 sampel BTA -., dapat terdeteksi dengannested PCR.

    Hasil nested PCR- sequencing menunjukkan M.tuberculosis dalam 8 sampel sputum tidakmengalami mutasi pada gen rpo~nya yangmenyatakan bakteri terse but tidak resist enterhadap rifampisin.

    Nested PCR dengan menggunakan primer yangdirancang dari bagian gen rpo~ M. tuberculosismerupakan metode yang cepat, sensitif danspesifik untuk mendeteksi M. tuberculosis baikisolat klinis maupun langsung specimen klinisseperti sputum.

    UCAP AN TERIMA KASIH

    Penulis mengucapkan terima kasih kepada :IAEA (International Atomic Energy Agency) atasbantuan dana melalui program TC (TechnicalCooperation)Prof. Yoon-Hoh Kook, MD. Ph.D., Departmentof Microbiology, Seoul National UniversityCollege of Medicine, Seoul, Korea, atas ijin danfasilitas laboratorium untuk pelaksanaanpenelitian ini.Sdr. Rika Heryani dan Almaida at asbantuannya dalam penelitian ini.

    DAFTAR PUSTAKA

    1. ZHANG, M., YUE, j., YANG, Y.P., ZHANG,H.M., LEI, j.Q., JIN, R.L., ZHANG,X.L., and WANG, H.H. Detection ofmutations associated with isoniazid

    resistance in Mycobacteriumtuberculosis isolates from China. J.Clin. Microbiol. 4l 11 (2005) 5477 -5482.

    2. ALAMSY AH, B. Epidemiologi genetic serta factorresiko Mycobacterium tuberculosis yangresist en inh dan atau rifampisin.Disertasi Program Doktor IlmuKesehatan Masyarakat, ProgramPascasarjana, Fakultas Kesehatan

  • Masyarakat, Universitas Indonesia,Jakarta 2003.

    3. WHO, Global, Tuberculosis Control, WHOReport, Surveillance, Planning,Financing, Geneva 2004.

    4 BADAN PENELITIAN dan PENGEMBANGANKESEHA TAN. Survei Kesehatan Rumah

    Tangga, 2001. Badan Litbang Depkes,Jakarta 2002.

    5. DIREKTORAT JENDRAL PEMBERANTASANPENY AKIT MENULAR danPENYEHATAN LINGKUNGANPEMUKIMAN, DEPARTEMENKESEHATAN REPUBLIK INDONESIA.

    Pedoman pemberantasan tuberkulosisparu, Jakarta 2000.

    6. TIM SURKESNAS BADAN PENELITIAN danPENGEMBANGAN DEPKES RI.. Survei

    prevalensi tuberkulosis Indonesia tahun2004, Jakarta 2005.

    7. PIERRE, C., LECOSSIER, D.,BOUSSOUGANT, Y., BOCART, D.,JOLY, V., YENI, P., and HANCE, A.J.Use of reamplification protocolimproves sensitivity of detection ofMycobacterium tuberculosis in clinicalsamples by amplification of DNA. j.Clin. Microbiol. 29 4 (1991) 712-717.

    8. HEIFETS, L.B., and BARNES, P.F. Currentlaboratory methods for the diagnosisof tuberculosis. In: Bloom, B.R. (ed.).Tuberculosis, pathogenesis,protection, and control. AmericanSociety for Microbiology, WashingtonDC. (1994) p. (85-110).

    9. SJOBRING, U., MECKLENBURG, M.,ANDERSEN, A.B., and MIORNER, H.Polymerase chain for detection ofMycobacterium tuberculosis. J. Clin.Microbiol. Z8 10 (1990) 2200- 2204.

    10. PAO, C.C, BENEDICT, T.S., YOU, J.B., MAA,j.S., FISS, E.H., CHANG, C. Detectionand identification of Mycobacteriumtuberculosis by DNA amplification. J.Clin. Microbiol. ZB- (1990)1877 - 1880.

    11. BAROUNI, A.S., SARIDAKIS, H.O., VIDOTTO,M.C. Detection of Mycobacterium inclinical samples by multiprimerpolymerase chain reaction. Braz. J.Microbiol. 35 1-2 (2004)

    12. KOX, L.F.F., RHIENTHONG, D., MEDOMIRANDA, A., UDOMSANTISUK, N.,ELLIS, K. van LEEUWEN, J., vanHEUSDEN, S., KUIJPER, S., and KOLK,A.H.J. A more reliable PCR fordetection of Mycobacterium tuberculosisin clinical samples. J. Clin. Microbiol.32 3 (1994) 672 - 678.

    Risa/an Seminar l/mian Ap/ikasi /sotop dan Radiasi, 2006

    13. MIYASAKI, Y., KOGA, H., KOHNO, S., andKAKU, M. Nested polymerase chainreaction for detection of Mycobacteriumtuberculosis in clinical samples. J. Clin.Micobiol. 318 (1993) 2228 - 2232.

    14. MARTINS, L.C., PASCHOAL, LA.,NOWAKONSKI, A.V., SILVA, S.A.B.,COSTA, F.F., and WARD, L.S.Nested-PCR using MPB64 fragmentimproves the diagnosis of pleural andmeningeal tuberculosis. Rev. Soc.Bras. Med. Trop . .3..33 (2000)

    15. KIM, B.J., LEE, K.H., PARK, B. N., KIM, S.J.,PARK, E.M., PARK, Y.G., BAI, G.H.,KIM,S.j., and KOOK,Y.H. Detection ofrifampin-resistant Mycobacteriumtuberculosis in sputa by nested PCR -linked single-strand conformationpolymorphism and DNA sequencing. J.Clin. Microbiol. a9 7 (2001) 2610-2617.

    16. PALUCH-OLES, j. Application of nested PCRand reverse hybridization for diagnosisof central nervous system tuberculosis.European Society if ClinicalMicrobiology and Infectious Disease,14th Europen Congress of ClinicalMicrobiology and Infectious Disease,Prague/Czech Republic, May 1 -4 2004.Abstract

    17.MARIA LINA R., PRATIWI SUDARMONO,dan FERA IBRAHIM. Sensitivitasmetode PCR (polymeerase ChainReaction) dalam mendeteksi isolat klinisMycobacterium tuberculosis. J.Kedokteran Trisakti Z1 1 (2002) 7 - 14.

    18.KOLK, A.H.J., KOX, L.F.F., van LEEUWEN, J.,and KUIJPER, S. Polymerase chainreaction for the M. tuberculosis complex.Laboratory of TropicalHygiene,Department of BiomedicalResearch Royal Tropical Institute,Amsterdam, The Netherland, 1995.

    19. KIM, B.J., LEE, S.H., LYU, M.A., KIM, S.]..BAI, G.H., KIM, S.J., CHAE, G.T., KIM,E.C., CHA, C.Y., and KOOK, Y.H.Identification of mycobacterial speciesby comparative sequence analysis of theRNA polymerase gene (rpof1.). J. Clin.Microbiol..31 6 11999) 1714 - 1720.

    20. KIM, B.J., LEE, K.H., PARK, B.N., KIM,S.J., BAI, G.H., KIM., j.K., andKOOK, Y.H. Differentiation ofMycobacterial species by PCR-restriction analysis of DNA (342 basepairs) of RNA polymerase gene (rpo~).J. Clin. Microbiol. 39 6 (2001) 2102 -2109.

    53

  • Risalah Seminar Ilmiah Aplikasi Isotop dan Radiasi, 2006

    MIYASAKI, Y., KOGA, H., KOHNO, S., andKAKU, M. Nested polymerase chainreaction for detection ofMycobacterium tuberculosis in clinicalsamples. J. Clin. Micobiol. 3.18 (1993)2228 - 2232.

    22. MAGDALENA, J., VACHEE, A., SUPPLY,P., and LOCHT, C. Identification of anew DNA region specific for membersof Mycobacterium tuberculosis complex.J. Clin. Microbiol..3..6 4 (1998) 937-943.

    23. CHENG, V.C.C., YAM, W.C., HUNG,I.F.N., WOO, P.C.Y., LAU, S.KP.,TANG, B.S.F. and YUEN, KY.Clinical evaluation of the polymerasechain reaction for the rapid diagnosisof tuberculosis. J. Clin. Pathol. 51(20041 281 - 285.

    24. GARCIA-QUINTANILLA, A., GARCIA, L.,TUDO, G., NAVARRO, M.,GONZALEZ, J., and JIMENEZ deANTA, M.T. Single-tube balancedheminested PCR for detectingMycobacterium tuberculosis in smearnegative samples. J. Clin. Microbiol.38 3 (2000) 1166 -1169

    54

    25. TELENTI, A., IMBODEN, P., MARCHESI,F., LOWRIE, D., COLE, S.,COLSTON, M.J., MATTER, L.,SCHOPFER, K, and BODMER, T.Detection of rifampicin - resistancemutation in Mycobacteriumtuberculosis. The Lancet 341 (19931 647- 650.

    26. YUEN, L.KW., LESLIE, D. and COLOE,P.J. Bacteriological and molecularanalysis of rifampin resistantMycobacterium tuberculosis strainsisolated in Australia. J. Clin. Microbiol3..Z 12 (1999) 3844 - 3850 ..

    27. WHELEN, A.C., FELMLEE, T.A., HUNT,J.M., WILLIAMS, D.L., ROBERTS,G.D., STOCKMAN, L., andPERSING, D.H. Direct genotypingdetection of Mycobacteriumtuberculosis rifampin resistance inclinical specimens by using single-tubeheminested PCR. J. Clin. Microbiol..3..3.3 (1995) 556 - 561.

  • M t Z 3 4 5 6 7 8 9 10

    205 bp157 bp

    Gambar 1. Hasil amplifikasi bagian gen rpo~ isolat klinis Mtuberculosis dengan nested PCR dalam gel agarosa1,5%.

    Lajur M : MarkerDNA 100 bp ladder; Lajur 1 - 10:Isolat klinis Rl - RIO.

    205bp157 bp

    Gambar 2. Hasil amplifikasi bagian gen rpo~ isolat klinis Mtuberculosis dengan nested PCR dalam gel agarosa1,5%.

    Lajur M: MarkerDNA 100 bp ladder; Lajur 1 - 5: Isolat klinis 21- 25;Lajur 6: Isolat klinis 27; Lajur 7 10: Isolat klinis 28 - 211

    M 1 2 3 4 5 6 7 8 9 10 11

    . 157 bp

    Gambar 3. Hasil amplifikasi bagian gen rpo~ M tuberculosis

    dari sputum dengan nested PCR dalam gel agarosa1,5%.

    Lajur M: Marker DNA 100 bp ladder; Lajur 1 : Sampel Sputum

    (S61) ;

    Lajur 2: Sampel sputum (S81) ; Lajur 3 : Sampel sputum (S97) ;

    Lajur 4: Sampel sputum (S99! ; Lajur 5 : Sampel sputum (SIOI) ;

    Lajur 6: Sample sputum (SI02); Lajur 7 : Sampel sputum (S9O) ;

    Lajur 8: Sampel sputum (S91) ; Lajur 9 : Sampel sputum (S94) ;

    LajurlO: Sampel sputum (SIOO); Lajur 11 : M tuberculosisH37 Rv(kontrol positifl

    Risalah S71inarIlmiah Aplikasi Isolop dan Radiasi, 2006

    Tabel I. Hasil nested PCR isolat klinik dan sputum BT Apositif.

    No. Kode sampelHasilHasil nested PCRBTA

    (157bp!1.

    Rl

    2.

    R2 +3.

    R3 +4.

    R4 +5.

    R5 +6.

    R6 +7.

    R7 +8.

    R8 +9.

    R9 +10.

    RIO

    11.

    21 +12.

    22 +13.

    23 +14.

    24

    15.

    25 +16.

    27 +17.

    28 +18.

    29

    19.

    210

    20.

    211

    21.

    S51 +1 +22.

    S52 +2 +23.

    S53 +2 +24.

    S54 +1

    25.

    S55 +1 +26.

    S56 +1

    27.

    S60 +1

    28.

    S61 +3 +29.

    S62 +3 +30.

    S63 +1 +31.

    S64 +1 +32.

    S65 +2

    33.

    S68 +134.

    S70 +1 +35.

    S72 +1 +36.

    S76 +1 +37.

    S78 +1 +38.

    S79 +1

    39.

    S80 +2 +40.

    S81 +2

    41.

    S90 + (tipis)42.

    S91 +43.

    S92

    44.

    S94 + (tipis)45.

    S95 +1 +46.

    S97 +1 +47.

    S99 +2

    48.

    S100 + (tipis)49.

    S101+3 +50.

    S102+2 +

    ') Keterangan: + Pita DNA terlihat jelas; + tip is : Pita DNA

    terlihat tipis

    Sampel no. 120 : Isolat klinik

    Sampel no. 21 - 40, no. 45 47 dan 49 - 50 : Sputum BTA positif

    55

    i: Daftar isi