Credimat guia autoconstructor

of 123 /123
GUIA DE AYUDA PARA EL AUTOCONSTRUCTOR MINISTERIO DE VIVIENDA, ORDENAMIENTO TERRITORIAL Y MEDIO AMBIENTE

description

GUIA DEL CONSTRUCTOR

Transcript of Credimat guia autoconstructor

Page 1: Credimat guia autoconstructor

GUIA DE AYUDAPARA EL

AUTOCONSTRUCTOR

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

Page 2: Credimat guia autoconstructor
Page 3: Credimat guia autoconstructor

GUIA DE AYUDAPARA EL

AUTOCONSTRUCTOR

Page 4: Credimat guia autoconstructor

Arq. Diana Méndez en los análisis previos, preparación y ajuste de textos.Arq. Jorge Barcala autor (realización de textos y dibujos).Arq. Daniel Camacho en la corrección final.

D i a g r a m a c i ó nD i a g r a m a c i ó nD i a g r a m a c i ó nD i a g r a m a c i ó nD i a g r a m a c i ó n y armado y armado y armado y armado y armado:::::Claudia MongiardinoArq. Jorge Barcala

Ministro de Vivienda, Ordenamiento Territorial y Medio AmbienteIng. Carlos Colacce

Subsecretario de Vivienda, Ordenamiento Territorial y Medio AmbienteArq.Jack Couriel

Director de la Dirección Nacional de ViviendaArq. Gonzalo Altamirano

Programa CREDIMAT

Page 5: Credimat guia autoconstructor

PROLOGOSolucionar el déficit de vivienda, mejorar la capacidad y calidad

del stock habitacional existente en nuestro país, requiere de diferentesprogramas que se complementen así como de la participación de diver-sos actores.

Dentro de este marco el Ministerio de Vivienda, Ordenamiento Territorialy Medio Ambiente y la KFW, agencia de cooperación financiera del Go-bierno Alemán, han puesto en marcha el CREDIMAT, programa novedosoque integra al sector público, Instituciones privadas y a la población,aunando esfuerzos con un fin común: mejorar la vivienda de las familiasde bajos ingresos y por lo tanto su calidad de vida.

El MVOTMA transfiere recursos a diversos Ejecutores, creando fon-dos rotatorios con el objetivo de brindar créditos sociales de bajo costopara el mejoramiento habitacional de las familias con ingresos de hasta60 UR.

La presente Guía de AyudaGuía de AyudaGuía de AyudaGuía de AyudaGuía de Ayuda fue creada como un servicio delPrograma CREDIMAT, teniendo en cuenta que muchas familias de escasosrecursos solucionan su problema habitacional por medio de la autocons-trucción o ayuda mutua.

Con la Guía conformada por fichas técnicas que pueden ser usa-das en forma independiente según la obra a realizar, se pretende facili-tar y ayudar a dichas familias que tendrán con el CREDIMAT una nuevaopción para mejorar, ampliar o construir su vivienda.

El objetivo es mejorar la calidad de la construcción para que losrecursos y el tiempo invertido en obra, no se pierdan por falta de cono-cimiento que lleva a defectos constructivos, cálculos errados o utilizaciónde sistemas no apropiados.

No sustituye el asesoramiento de los técnicos, tampoco es un aná-lisis exhaustivo o profundo de la temática constructiva, es simplementeuna guía con recomendaciones de los rubros y sistemas constructivos co-munmente usados en obras por autoconstrucción en las áreas urbanas ysuburbanas de nuestro país.

Se debe tener en cuenta antes de su aplicación que no es posiblesu utilización sin considerar las distintas zonas, suelos, materiales dispo-nibles y reglamentaciones municipales de cada lugar. Se desliga la res-ponsabilidad técnica de las obras realizadas en base a la presenteGuía.

Arq. Diana MéndezArq. Diana MéndezArq. Diana MéndezArq. Diana MéndezArq. Diana MéndezSUM CONSULSUM CONSULSUM CONSULSUM CONSULSUM CONSULTTTTT

Page 6: Credimat guia autoconstructor

Contenido

HERRAMIENTASHERRAMIENTASHERRAMIENTASHERRAMIENTASHERRAMIENTAS

LO PRIMEROLO PRIMEROLO PRIMEROLO PRIMEROLO PRIMERO

REPLANTEOREPLANTEOREPLANTEOREPLANTEOREPLANTEO

ESTRUCTURAESTRUCTURAESTRUCTURAESTRUCTURAESTRUCTURA

CIMIENTOSCIMIENTOSCIMIENTOSCIMIENTOSCIMIENTOS

CIMIENTO CORRIDO DECIMIENTO CORRIDO DECIMIENTO CORRIDO DECIMIENTO CORRIDO DECIMIENTO CORRIDO DEHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEO

PATIN CORRIDO DEPATIN CORRIDO DEPATIN CORRIDO DEPATIN CORRIDO DEPATIN CORRIDO DEHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO

DADOS DEDADOS DEDADOS DEDADOS DEDADOS DEHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEO

PATIN DEPATIN DEPATIN DEPATIN DEPATIN DEHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO

PAREDESPAREDESPAREDESPAREDESPAREDES

VIGAS DEVIGAS DEVIGAS DEVIGAS DEVIGAS DECIMENTACIONCIMENTACIONCIMENTACIONCIMENTACIONCIMENTACION

C O N T E N I D OC O N T E N I D OC O N T E N I D OC O N T E N I D OC O N T E N I D O

Page 7: Credimat guia autoconstructor

Contenido

REFUERZOSREFUERZOSREFUERZOSREFUERZOSREFUERZOSEN LOS MUROSEN LOS MUROSEN LOS MUROSEN LOS MUROSEN LOS MUROS

LOSA DELOSA DELOSA DELOSA DELOSA DEHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO

AGUAAGUAAGUAAGUAAGUACORRIENTECORRIENTECORRIENTECORRIENTECORRIENTE

DESAGÜESDESAGÜESDESAGÜESDESAGÜESDESAGÜES

REVOQUESREVOQUESREVOQUESREVOQUESREVOQUES

PAVIMENTOSPAVIMENTOSPAVIMENTOSPAVIMENTOSPAVIMENTOS

AZULEJOSAZULEJOSAZULEJOSAZULEJOSAZULEJOS

ABERTURASABERTURASABERTURASABERTURASABERTURAS

TECHOSTECHOSTECHOSTECHOSTECHOSLIVIANOSLIVIANOSLIVIANOSLIVIANOSLIVIANOS

TECHOSTECHOSTECHOSTECHOSTECHOS

VIGAS DEVIGAS DEVIGAS DEVIGAS DEVIGAS DEHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO

PILARES DEPILARES DEPILARES DEPILARES DEPILARES DEHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO

Page 8: Credimat guia autoconstructor

Herramientas 1 - 1

A continuación describiremos una serie de herra-mientas que suelen ser comunes en una obra. No sontodas las que se pueden usar y muchas podrán ser sus-tituidas por otras.

A cada una de ellas se le ha diseñado una repre-sentación gráfica que se podrá encontrar luego, en lasdistintas fichas. Las mismas tendrán una descripciónelemental que servirá para identificar aquellas herra-mientas que se desconozcan.

VEAMOS LAS HERRA-MIENTAS MASCOMUNES EN

UNA OBRA

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

HERRAMIENTAS

J.G.BARCALA

Page 9: Credimat guia autoconstructor

Herramientas 2

(ángulo recto): Normalmente en madera, aluminio o hierro.

Ideal para preparar canchadas de material como mezcla, hormigón,etc.

HILOEs sumamente necesario en el transcurso de una obra, el más comúnes la chaura ya que es resistente y es fácil de ver.

CINTAMETRICA

Las hay de varias longitudes, como también de materiales.

PLOMADADE PUNTA

Nos sirve para bajar puntos exactos en un replanteo.

ESCUADRA DE90 GRADOS

PALADE PUNTA

Es buena para comenzar a excavar, ya que la punta favorece lapenetración en el terreno.

PALAANCHA

Nos servirá para excavar en terrenos duros o semiduros.PICO

PISONSe usará para apisonar el suelo o un contrapiso. Se puede hacerfácilmente llenando una lata con hormigón y colocándole un cañocomo elemento de agarre.

SERRUCHOPara asegurar un buen corte, deberemos cuidar que los dientes seencuentren siempre trabados y afilados.

MARTILLO DECARPINTERO

Se caracteriza por la uña que tiene atrás que sirve para sacar cla-vos.

HACHA DECARPINTERO

Permite cortar, clavar (parte de atrás), y desclavar ya que incluyeuna uña.

UÑAHecha en hierro, se utiliza para desencofrar o sacar clavos.

Page 10: Credimat guia autoconstructor

Herramientas 1 - 3

TENAZALas hay de carpintero y de herrero (esta última tiene medio filoachatado para usarla como pinza y poder tirar del alambre sincortarlo).

SIERRADE MANO

Se usa para cortar metal y caños de plástico. Se compran las hojasde repuesto aparte.

GRIFALas hay para cada diámetro de hierro que tengamos que doblar.Para los más grandes donde hay que hacer mucha fuerza se lepuede extender el brazo de agarre con un caño de hierro.

METRODe madera o plástico.

NIVEL DEBURBUJA

Sirve para nivelar superficies. Cuando se compra conviene probarlode uno y otro lado para asegurar que marque igual. Los hay conburbuja para nivelar elementos verticales y otros con burbuja incli-nada para superficies a 450. Se los encuentra de distintos largos;hechos en madera, plástico o aluminio siendo generalmente estosúltimos los de mayor calidad.

NIVEL DEMANGA

Realizado con una manguera transparente a la que se le colocaagua. Los niveles superiores de agua se mantienen a igual altura.Conviene usar mangueras de paredes gruesas.

BALDELos hay metálicos o de plástico, tienen una capacidad de 10 litrosde material (1/4 bolsa de portland).

TACHONormalmente metálico tiene una capacidad de unos 20 litros dematerial (1/2 bolsa de portland).

PLOMADAConsta de una pesa de hierro, un taco de madera de igual ancho quela pesa y un hilo de unos 2 metros. La usaremos para verticalizarelementos, (aplomar).

MACETALas hay de distintos pesos, complementa el uso de la punta y elcortafierro.

CORTAFIERROY PUNTA

La usaremos para cortar y picar sea ladrillo, hormigón, etc. Los hayde varios tamaños.

Page 11: Credimat guia autoconstructor

Herramientas 4

CUCHARALas hay de varios tamaños, algunas de punta aguda y otras redon-deadas. Sirve para colocar material.

LLANA

REGLALas hay de madera o de aluminio, con diversas longitudes. Lausaremos para la ejecución de revoques, pisos, para nivelar, etc.Hay que cuidar que estén derechas, hecho que comprobaremosmirándola desde la punta. Es necesario mantenerla limpia.

REGLA

Utilizada normalmente para desgastar madera, la aplicaremos enel desgaste de los caños de plástico.

FRATACHO

Es metálica, se usa para lograr superficies muy lisas, por ejemploen la colocación de enduído sobre una pared.

REGLA

PINCELETAEs buena para agregar agua al mortero que tengamos en el baldey para mojar la pared que tengamos que revocar.

HACHUELALa utilizaremos para cortar ladrillos.

MAQUINAPARA CORTAR

Se utiliza para cortar baldosas cerámicas de piso o revestimientosde pared. Tienen incluida una regla y guía para ubicar el corte.Las hay de distintas calidades y tamaños. Para cortar puede tam-bién usarse un lápiz de vidia.

TERRAJACon ella se realizan las roscas a los caños de agua o gas. Las haypara caños de hierro o de plástico. Estas últimas vienen con lascuchillas para caños de 1/2, 3/4 y 1 pulgada.

PAPEL DE LIJALas hay de distinta rugosidad. Se distinguen por números, cuantomás bajo sea éste, más fina será.

ESCOFINA

PINCELLos hay de muchos tamaños y calidades, según el uso que desee-mos darle.

Son de madera. Se utilizan para emparejar las superficies de losrevoques. Conviene mantenerlos limpios para que no rayen el tra-bajo que realizamos.

Page 12: Credimat guia autoconstructor

Lo Primero 2 - 1

Invertir tiempo previamente a construír algo es muyimportante. No sólo tenemos que pensar en lo quepodamos necesitar ahora, también conviene proyec-tarse al futuro. Tal vez la familia crezca y haya queromper mucho para aumentar un dormitorio; y aúnpeor puede que no podamos ampliar más nuestracasa, si no lo hemos previsto antes.

J.G.BARCALA

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

LO PRIMERO

Siempre es buenopensar en el futuro

Don Anastasiohabía trabajado de

capatáz antes de jubilarse

¿Sabe?Sr. Anastasio, ahoraque tenemos el terre-nito queremos hacer-nos una casa,

chiquitavió

Yo tengo algo de expe-riencia y puedo darlesuna mano

Para comenzar hay quepensar en el tipo de casa

quenecesitan

Con un dormitorioalcanza para mi y

la Julieta

Page 13: Credimat guia autoconstructor

Lo Primero 2 - 2

Todo tiempo que se invierta enpensar antes de comenzar la obraserá un ahorro de dinero después.Solucionar problemas imprevistosdurante la obra sale caro.

Algunas cosas atomar en cuenta:

Mejor me hago unacasa a nuestro

gusto.

Pasemos a dibujar lavivienda que queremosporque después tendre-mos que consultar a untécnico ya que ellos sa-ben como se presentaa la Intendencia

Me dijeron que hayen la Intendencia unPlan Económico.

Sí, te dan un plano yahecho y de esa formaqueda todo regularizado

Antes de construir hay que pedir un permiso en la Inten-dencia, la cual aprueba los planos de la vivienda. De esamanera se evitan multas en el futuro o problemas cuando sequiera vender la casa. Conviene tratar que el sol entre por las ventanas, siemprepodremos estar a tiempo de evitarlo, pero no de hacerlo en-trar si no orientamos bien las ventanas. Trataremos de evitarlas ventanas hacia el sur. Si se junta el baño a la cocina con un muro entre ellos, seahorra en cañerías, ya que por éste podemos hacer correrun mismo caño para las dos cosas. No conviene hacer pasillos muy largos, se desperdicia áreay materiales en lugares que sólo nos servirán para caminar.

Page 14: Credimat guia autoconstructor

Lo Primero 2 - 3

Aquí presentamos un ejemplo dedistribución de habitaciones

Pueden existir muchasvariantes

Page 15: Credimat guia autoconstructor

Lo Primero 2 - 4

Hay ordenanzas que hay querespetar por exigencia de la Intendencia

ORDENANZAS MUNICIPALES DE MONTEVIDEO

VENTILACIONSUPERFICIEMINIMA

Obligatorioponer:inodoropileta, ducha

BAÑOUNO SOLOY PRINCIPAL

ESTARCOMEDORDORM

2,40 m2

LADOMINIMO

2,50 m

1,20 m

ALTURAMINIMA

2,20 m

50% de lasuperficie deiluminación

deben poderseabrir totalmente

COCINAQUE DA AOTROLOCAL

Puede serentre

3 a 5 m2

3/4 partes de lasuperficie deiluminacióndeben poder

abrirse totalmen-te hay que

agregar un tirajede 30x30 con

campana sobrezona de fuego

1,40 m 2,20 m Superficieamboslocales

dividido 10mínimo

2m2

No esnecesario

luz natural

Superficiedividido

10

LUZNATURALDIRECTA

4,20 m2COCINACERRADA

1,60 m 2,20 m Superficiedividido 10

mayorsiempre que

0,4 m2

10 m2UnahabitaciónLas otras 6,50m2

7 m2

2 m

1,80 m

2,40m

2,20m

Te puedes asesorar en Montevideoen los Centros Comunales y en elinterior en las intendencias.

OTRAS ORDENANZAS:-Las paredes del baño tienen que es-tar revestidas hasta 1,80m., o revo-cadas con portland lustrado.-En la cocina el revestimiento mínimosobre la mesada es hasta los 50 cm.

NOTA: Este cuadro es un extrac-to de las ordenanzas municipales deMontevideo, cada departamento pue-de tener sus variaciones. Siempre esfactible conocerlas en la Intendencia ocon algún técnico.

Debe abrirse laventana

totalmente

La banderola oventana tiene queabrirse completa-

mente y por lomenos tiene que

ser una superficiede 0,6x0,33

Page 16: Credimat guia autoconstructor

Lo Primero 2 - 5

Si el frente del terreno está fuera de escua-dra con respecto a las medianeras, el hacerla casa al borde de la vereda nos puede

Si el predio estriangular,podemos buscarcolocarla paralelaa un lado

generar problemas paraconstruir, especialmen-te si usamos techos in-clinados que generaríanfachadas en cuña

Don Anastasio tienerazón, ahora tengo

que ver donde ubicola casa dentro del

terrenito

UBIQUEMOSLA CASA

Cuando el terreno esrectangular es fácilubicar la casa parale-la a la medianera, yasea retirada de ésta oapoyada en ella.

Hay que pensar enlas dimensiones delas habitaciones

Page 17: Credimat guia autoconstructor

Lo Primero 2 - 6

RERTIRODE FONDO

J.G.BARCALA

Carlitos, la Intendencia no deja colocar la casa en cualquier lugar del terreno.Existen afectaciones que hay que respetar, como retiros, ensanches

que se averiguanen la Intendencia

misma

Cuente nomásDon Anastasio

ENSANCHES RETIROFRONTAL

Suele darse como unadistancia desde la líneade ensanche o desde elborde del predio en estazona sólo se permitenconstrucciones extrema-damente livianas.

Cuando la Intendenciaplanea ampliar la calle,afecta a los predios conensanche, el que lo dacon una medida quetoma normalmente des-de el eje de la calle.No se puede construirnada en esa zona.

Se da como una distan-cia a un terreno lindero.

RETIRO LATERAL

Normalmente viene dadocomo un porcentaje delárea total del terreno.Por ejemplo, en el 20% final delterreno no se puede construir.

Page 18: Credimat guia autoconstructor

Lo Primero 2 - 7

NOTA: Si no se limpia bien el terre-no, no sólo puede salir mal el re-planteo sino que la casa puede lle-gar a ceder en algún sitio.

HERRAMIENTAS

Para esto sí que hayque ser amigo

Tenemos que sacartodas las hierbas

desde la raíz

También laspiedras grandes...

...y los montes detierra y de basura.

Don Anastasio,no olvide el escombro,ese también hay que sacarlode la obra

Nada debe molestar cuando vayamos ahacer el replanteo de mi casa.

LIMPIEZA DEL TERRENO

Primero, junto unosamigos y

me hago unalimpieza del terreno

J.G.BARCALA

Page 19: Credimat guia autoconstructor

Replanteo 3 - 1

Los datos del terreno se obtie-nen de un plano hecho por uningeniero agrimensor que estáen catastro, o también se puedeobtener de los títulos de propie-dad del predio.

EL PRIMER PASO: antes que nada, tenemos queverificar las medidas del terreno. Si no lo hace-mos podemos llegar a construir en terreno ajenoy meternos en problemas.

REPLANTEO

MINISTER IO DE V IV IENDA, ORDENAMIEN-TO TERR ITORIAL Y MEDIO AMBIENTE

Don Anastasio, ¿Quées eso del replanteo?

Chiquilín, el replanteo es cuandopasamos al terreno todolo que hemos dibujadoen el papel, para asíubicar las paredes, lospilares y cimientos.

¿De dónde sacolas medidas

del terreno?

Si tenemos 3 lados del terreno construídos, no tendremos problemas, pero sino es así conviene desde un límite conocido verificar con la cinta métrica

las esquinas del terreno.

J.G.BARCALA

Page 20: Credimat guia autoconstructor

Replanteo 3 - 2

90º

3

5 4

Don Anastasio me dijo quesi se cumplen esas relacio-nes de lados: 3, 4 y 5; pue-do trazar un triángulo - rec-tángulo. Esos lados puedenser 30, 40 y 50 centíme-tros o 3, 4 y 5 metros.

De esta forma marcamos los límites del terreno por medio dehilos o alambre dulce sobre caballetes de madera o

estacas bien firmes

NOTA: Es importante ser preciso en todo re-planteo, tanto del terreno como de loque vamos a construir.

Este caballete tiene que ser fuerte

Hago centro con un hilo y trazo un par de arcos que se cru-cen en 2 lugares (C - D).

Uno los cruces y obtengo la línea en ángulo recto.

Si tengo una línea conoci-da y deseo trazar otra línea enángulo recto sobre un punto"p":

Marco a cada lado de"p" una misma distancia(por ejemplo 1m.), A - B.

OTRO METODO:

Algo paraayudar atrazarangulosrectos

D

B

C

A

2-

3-

1-

Page 21: Credimat guia autoconstructor

Replanteo 3 - 3

El replanteo de lacasa lo haremos de lamisma forma que eldel terreno.

Tenderemos hilosentre un amigo y yo,de caballete a caballe-te, definiendo exacta-mente la ubicación decada muro.

Vamos a comenzartirando 2 hilos de re-ferencia puestos a es-cuadra, ya que la líneadel hilo es perfecta.

¿QUE SE PUEDEREPLANTEAR DE

UN MURO?

Podemos marcar lacara exterior del muro, oambas.

Podemos marcar eleje del muro (o sea lalínea que va por el me-dio exacto del mismo).

Cómoempezar areplantear

Pararecordar:

Los caballetes tienen que estar a nivel y a la misma altura.Es necesario ir verificando las escuadras y medidas mien-tras trabajamos en el replanteo.

NOTA: Es conveniente ubicarlos caballetes a una distanciatal que al hacer las zanjas paralos cimientos no se vayan a mo-ver. Es buena idea usar una dis-tancia de 1 m.

Si aún tenemos extendidos los hilos del terreno po-demos basarnos en ellos para dar ubicación a los quedefinirán los muros.

Page 22: Credimat guia autoconstructor

Replanteo 3 - 4

Marcar la po-sición del hilo enel caballete conun clavo o uncorte de sierra de1 cm para noperder la posicióncuando saquemoslos hilos.

Marcar el ejedel muro es bue-no, ya que esteva a coincidir conel del cimiento.

Verificar antesde comenzar quela escuadra quetenemos tenga unverdadero ángulorecto.

Verificar quelas habitacionestengan sus lados

paralelos. Si me-dimos las diago-nales de un rec-tángulo tienenque ser iguales,si no lo son, en-tonces algún ladoo todos no sonparalelos.

Si nuestracasa se apoyaen una mediane-ra construída, ti-raremos de igualforma un hilo de

Cuando to-memos medidascon una cinta ometro es necesa-rio que ésta estéa nivel. Si toma-mos medidas in-clinadas nos daráerrores.

RECOMENDACIONESreferencia en ella,ya que va a sermás seguro quela pared rugosa.Si no podemosponerlo en la me-dianera, convieneubicar el hilo enel eje de algunafutura pared.

Si no pode-mos hacer coinci-dir el hilo de refe-rencia con ningúnmuro, es mejorque lo ubiquemosa una distanciade 1 m. con res-pecto a la media-nera. Es más fácilsumar y restar a1 m. que a0,75 m..

Las medidasque veamos en losplanos, son siem-pre (salvo que di-gan la contrario),de paredes termi-nadas, tendremosque restarle el es-pesor del revoque,que si es gruesa yfina será 1 1/2 cm.

Page 23: Credimat guia autoconstructor

Replanteo 3 - 5

VEAMOS ALGUNOS EJEMPLOS

Esta sería la ubicación de los hilosde referencia principales para ubicaruna casa al frente, pegada a la vere-da, en caso de que no exista retirofrontal.

Este caso representa la ubicación de una casa conun retiro frontal. El segundo hilo de referencia co-incide con la fachada, pero no así el primero que sehizo coincidir con la medianera a una distancia "d"de la casa.

De esta forma nos quedaría un replanteo deuna casa como la aquí dibujada.

HERRAMIENTAS

Page 24: Credimat guia autoconstructor

Estructuras 4 - 1

Este otro sistema utiliza paratransmitir el peso del techo al suelo,una especie de jaula realizada por ele-mentos verticales llamados pilares y otroshorizontales llamados vigas.

Este sistema tiene como elementoprincipal el uso de las paredes (o algu-nas de ellas), para transmitir el peso deun techo o un entrepiso al suelo.

El peso deltecho en esteejemplo se reparte alo largo de todo el muro. El peso

del techo lorecibirán las vigas,quienes a través de los pilares lobajarán a tierra.NOTA

nes son las estructuras enbase a muros portantes ylas de pilares y vigas.

Los sistemas más comu-

¿Don Anastasio, cómo hagopara levantar mi casa?

ESTRUCTURA ENBASE A PILARES

Y VIGAS

ESTRUCTURA ENBASE A MUROS

PORTANTES

J . G . B A R C A L A

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

ESTRUCTURA

Hasta que no se terminenlos muros principales nopodemos poner el techo.

Page 25: Credimat guia autoconstructor

Estructuras 4 - 2

de hormigón armado, ya que suconstrucción no es confiable,muchosse deshacen al agarrarlos. Sí sirvenpara techos livianos.

TIEMPOS DE DESENCOFRADOPilares 6 a 7 díasVigas

Losas 14 días

El ladrillo de campo ha de serparejo y bien horneado. No pue-den ser crudos que se rompenfácilmente, ni quemados que sondifíciles de cortar y generalmen-te son torcidos, a demás de po-seer fisuras importantes.Sus medidas varían según quiénlos fabrique.

NOTA

LADRILLODE CAMPO

Los huecos habrán de ir siemprepara arriba.

NOTA

LADRILLOREJILLA

Hay que rechazar todos aquellosque estén fisurados o desparejos.

NOTA

LADRILLODE PRENSA

ESTRUCTURA ENBASE A MUROS

PORTANTES

ESTRUCTURA ENBASE A PILARES

Y VIGAS

¿Cómo se hace un hormigón?El hormigón se compone de 2 áridos,

uno grueso que es el pedregullo y otro finoque es la arena gruesa. Estos dos se unencon el cemento portland.

Según para qué se va a usar el hormi-gón, varían las porporciones de sus compo-nentes.

La dosificación más común es:3 de pedregullo2 de arena guresa1 de cemento portland

A estos elementos se les agrega aguadurante el amasado, lo que genera una pastamanejable que podremos colocar dentro demoldes (llamados encofrados), que contendránarmaduras de hierro. Dentro de estos enco-frados endurecerá (fraguará) el hormigón, alcabo de un determinado tiempo se podrá sacarel molde y tendremos nuestros pilares, vigas,losas o lo que hayamos realizado sostenién-dose por sí solas.

Los huecos que queden entre pilares yvigas se podrán llenar con ladrillo, ticholo,bloque o cualqueir mampuesto.

El bloque común no es adecuadopara soportar el peso de una losa

NOTA

Para poder soportar un techo de hor-migón armado, un muro portante tiene queser construido con materiales resistentes:

(un mes apuntaladas)Laterales 3 días

Page 26: Credimat guia autoconstructor

Estructuras 4 - 3

Ninguno de estos tipos de estructuras puede funcio-nar sin una correcta cimentación. Ya que es la queapoya directamente en el suelo.

SOBRE CADA UNO DE LOS DISTINTOS ELEMENTOSHABLAREMOS MAS ADELANTE

A pesar de que nadie ve los cimientos, (yaque van enterrados), son muy importantes y

no se puede escatimar ni dinero niesfuerzo en ellos.

Page 27: Credimat guia autoconstructor

Cimientos 5 - 1

Utilizaremos para ello un mé-todo práctico.Haremos por lo menos 3 po-zos en nuestro terreno de unaprofundidad no menor a 1 me-tro. Es bueno aprovechar la ex-cavación del pozo negro comoparte del estudio.

Si el suelo cede, los muros descienden y si eso ocurre pueden aparecerfisuras en las paredes y en el peor de los casos un derrumbe de la construcción.

Los cimientos son para la casa lo que los pies son para nosotros, si nos fallannos caemos.Todo suelo tiene un máximo de resistencia, elque hay que conocer para hacer una correcta ci-mentación. No se debe superar esa resistencia,por eso las bases se hacen más anchas que lapared. De esa forma se distribuye mejor el pesosobre el terreno.

Para poderconstruír un

muro hayque darle

previamenteun apoyoseguro.

Si no hacemos unabuena base el terrenopuede hundirse por elpeso de nuestra casa

¿Cómo sabemosqué tipo de suelo

tenemos ennuestro predio?

Para definir que cimiento se debe usar, hay que ver primero cómo es el suelo.Veremos entonces si es blando, semi-duro o duro.

J . G . B A R C A L A

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

CIMIENTOS

Page 28: Credimat guia autoconstructor

Cimientos 5 - 2

Si la pala penetrasin mucho esfuer-zo el suelo es blan-do, tiene una resis-tencia baja.

Si para excavar hay queperforar a pico con ungran esfuerzo, diremosque el suelo es duro.Su resistencia es muybuena.

Si la pala rebota o clava pocoen el suelo y es necesario usarel pico para ayudar, clasifica-remos a este suelo como: semi-duro, su resistencia es aptapara una cimentación normal.

Es conveniente preguntarle a los vecinos, el tipo desuelo que encontraron, los problemas o no que tuvieron,el tipo de cimentación que utilizaron y a qué profundidadla hicieron. (Antes de preguntar conviene mirar si la casadel vecino tiene fisuras en sus muros).

Si el terreno es de arena y no aparece agua cuando excavamos no habrá quepreocuparse. Pero si encontramos agua deberemos cimentar más arriba.

LA RESISTENCIA DEL SUELO SE COMPRUEBA AL EXCAVARLO

CONSEJOS IMPORTANTES

Si habiendo llegado a 1 m de profundidad tenemos un sueloblando (sin ser arena).Si nuestro predio se encuentra en un médano de arena.(Habrá que cuidar el desplazamiento de la arena).Si encontramos agua al excavar.Si nos enteramos que el suelo de la zona es de arcilla expansiva(o sea que aumenta su volúmen en presencia de aguas).

Es conveniente consultar a un técnico cuando:

Page 29: Credimat guia autoconstructor

Cimientos 5 - 3

Una método que es posible utili-zar para disminuir el problema del em-puje hacia arriba del suelo, es rellenarcon un material no expansivo como serarena o un hormigón ciclópeo.

Un sistema que ha mostrado darresultado cuando se usa en estos terre-nos una cimentación corrida de hormi-gón ciclópeo es el colocar una capa dehormigón armado por debajo y por enci-ma de la misma.

Cuando sucede eso, el suelo seeleva, pudiendo superar los 10 cm. comoen algunos sitios de Libertad. Al mojarselas primeras capas de tierra se generauna zona bastante impermeable. Es por

eso que conviene construír nuestra cimentación a una profundidad no menor a 1metro.

En el caso que tengamos una estructura que posea vigas de fundación (lasque van por debajo de la tierra para sostener muros), va a ser importante prote-gerla contra esos movimientos, (veremos cómo hacerlo en estructuras de pilaresy vigas).

Para estos suelos expansivos es aconsejable rea-lizar una vereda no menor de 1 metro alrededorde la construcción, esto evitará la acción delagua directamente en la zona de cimentación.

NOTA

Cuando tenemos un suelo de arcillaexpansiva, o sea que modifica su volúmen

según lapresencia de agua, la cosa se complica.

Page 30: Credimat guia autoconstructor

Cimientos 5 - 4

PLATEASAISLADAS CORRIDAS

Patines de hormigónarmado.

Dados de hormigónciclópeo.

Cimentación corrida dehormigón ciclópeo.

Patín corrido de hormi-gón armado.

Losa de hormigón arma-do sobre el suelo.

Se usa para terrenos con po-quísima resistencia, tales quesi quisiéramos usar cimenta-ciones aisladas, la superficiede ellas serían tan grandesque casi se tocarían.

Sirven para cimentar estructu-ras de muros portantes.

Sirven para cimentar estructu-ras de pilares y vigas.

Dentro de este grupopodemos dividirlas

aún en otrossubgrupos: aisladas,

corridas y las delosas o plateas

generales .Nombraremos

algunas de ellas.

Don Anastasio cuente un pocosobre los tipos de cimentación.

A nosotrosnos interesan lascimentacionessuperficiales.

Los cimientos se pueden clasificar en tres grandes grupos: profundos,semi-profundos y superficiales.

Page 31: Credimat guia autoconstructor

Cimientos 5 - 5

Si las paredes de la zanja se desmo-ronan será necesario ensancharla lo suficientepara que la arena o tierra no caiga sobredonde tenemos que hacer la cimentación.

Si el terreno permite un cortelimpio del mismo será suficienterealizar una zanja del ancho nece-sario para hacer el mismo.

VEAMOS COMO REPLANTEARUN CIMIENTO CORRIDO

Si ahora tiramos un par de hilos tendremos entonceslos bordes de nuestro futuro cimiento. Nos queda luego bajarpuntos de referencia, lo haremos con una plomada de punta.Si encalamos un hilo y lo golpeamos contra el suelo tendre-mos marcada la línea por donde deberemos excavar.

Para un cimiento corri-do marcaremos en los caba-lletes la mitad del ancho delcimiento a cada lado del ejedel muro

J.G.BARCALA

Page 32: Credimat guia autoconstructor

Cimientos 5 - 6

Haremos un marco de tabla demadera de 15 cm. que tendrá interior-mente el tamaño del dado o patín dehormigón armado que tengamos queconstruir. Le marcaremos la mitad acada lado para colocarle un par de hi-los que se crucen y definan el centrodel marco.

En los caballetes que tenemos re-planteado los muros, haremos las mar-cas de todos los ejes. Tirando hilosdesde éstos definiremos los puntos enque deberán ubicarse los cimientos (cru-ce de hilos).

Deberemos entonces, bajar conplomada de punta el cruce de los hiloshaciendo coincidir con el cruce de hilosdel marco de madera. Fijando éste a latierra tendremos marcada la zona deexcavación.

PARA UNA CIMENTACIONPUNTAL

Page 33: Credimat guia autoconstructor

Cimiento corrido 6 - 1

Con en el mismo eje de la ci-mentación y apoyada a lo largo deésta, construiremos una carrera de hor-migón armado del ancho del muro quelevantaremos y de una altura de unos30 cm (2 tablas).

La armadura correspondrá a 4 hie-rros comunes de 10mm. con estribosde hierro común de 6 cada 25 cm.Como la carrera estará en contacto conla humedad de la tierra nos asegurare-mos un recubrimiento de hormigón deunos 3 cm.

Cada tanto po-demos agregarlehierros de 6 tipo"U" invertidos quepenetren en la ci-mentación unos 30a 40 cm. A estoshierros los haremos terminar en ganchos.

nivelado y compactado.

Este tipo de cimiento no espráctico para profundidades desuelo firme que superen el metro ymedio.

La zanja que realizaremospara su construcción no podrá sermenor de 40 cm de ancho, ya quese complica trabajar en un espacio

tan reducido. Su fondo deberá estar

El llenado de la zanja se hará en capas alternadas dehormigón y piedra granítica, antes de ellas colocaremos

una de arena gruesa de 5 cm.de altura. No deberemos usar piedraextremadamente grande ya que correremos el riesgo de un mal llenado dejando huecos en elcimiento.

J . G . B A R C A L A

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

CIMIENTO CORRIDODE HORMIGON CICLOPEO

Page 34: Credimat guia autoconstructor

Cimiento corrido 6 - 2

X 1 = m3 de piedra granítica 0,25 = m3 de arena gruesa 0,45 = m3 de pedregullo 3,4 = bolsas de cemento portland

Metros cúbicostotales de hormigón

ciclópeo

4 = m de hierro común de 6 4 = m de hierro común de 10 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 0,5 = kilos de alambre para atar hierro 10 = tablas para encofrado 0,5 = kilos de clavos de 2 pulgadas

XMetros cúbicos

totales decarrera

NOTA: Son cantidades aproximadas

Hagamos los metrajes y veamosque materiales necesitamos para

esta cimentación.

Teniendo los volúmenes totales multiplicaremos por los siguientes valores para obtener la totalidad delos materiales.

Calcularemos 1 metro lineal de cimentación. Debere-mos entonces medir el recorrido de todas las paredes parasaber la totalidad de materiales.Mediremos primero lo correspondiente al hormigón ciclópeo.

Volumen de hormi-gón armado en 1metro de cimiento.

ALTURA x ANCHO x 1 m =

Si hacemos:

= Volumen dehormigón ciclo-peo en 1 metro decimiento.

ALTURA x ANCHO x 1 m

Haremos lo mismo con la carrera de hormigón armado:

Page 35: Credimat guia autoconstructor

Patín corrido 7 - 1

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

PATIN CORRIDODE HORMIGON ARMADO

Es la cimentación ideal pararealizar sobre terrenos arenosos

o de una resistencia baja.

Veamos un patín corrido enhormigón armado

casos hay que ensanchar la base del cimiento, sehace más fácil realizarlo con hormigón armado.

Para construir un patíncorrido de hormigón armadoconviene hacerlo calcular porun técnico especialista.

Este tipo de cimiento esnecesario realizarlo cuando elpeso de la construcción es im-portante y el suelo es de bajaresistencia. Como en estos

J.G.BARCALA

Veremos algunas generalidades:

En general el ancho superará los40 cm ya que como dijimos anterior-mente se usan cuando es necesario en-sanchar la base. La primer capa de hor-migón de recubrimiento de la armaduraserá de 4 a 5 cm. Sobre ésta apoyare-mos la parrilla de hierros. Los hierros

principales que van a lo ancho no debe-rán ser nunca menores a 8 mm. Loshierros que van a lo largo pueden sermenores e ir separados cada 25 cm.Se puede reducir la cantidad de hormi-gón haciendo chanfles a partir de los15 cm del fondo.

Page 36: Credimat guia autoconstructor

Patín corrido 7 - 2

VEAMOS COMO METRAR UNPATIN CORRIDO

0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 10 = tablas para encofrado 1 = kilos de clavos de 2 pulgadas 1 = kilos de alambre para atar hierro

Volúmen totalde patín X

El hierro dependerá del técnico calculista. Para una aproximación de lo quenecesitamos podría multiplicarse el volumen total de patín por 25 kilos.

Patín sin carrera su-perior.Calcularemos lasáreas de:

Patín con una carrerasin pendientes latera-les.Calcularemos lasáreas de:

Patín con una carrerasobre él, donde apo-yará el muro.Calcularemos lasáreas de:

Las áreas sumadas y multiplicadas por 1 m nos dará el volúmen en metroscúbicos que deberemos multiplicar por la totalidad de metros lineales de muros quetengamos que cimentar. Ese valor total lo multiplicaremos por las cifras de abajopara obtener la cantidad de material necesario (aproximado), para su construcción.

El metraje dependerá del diseño de patín que nos presente el técnico calculista. Haremossiempre el cálculo de 1 metro.

Page 37: Credimat guia autoconstructor

Dados 8 - 1

La altura que se suele dar aun dado de hormigón ciclópeo seencuentra en el orden de los 60 a90 cm. Su ancho rondará los 40a 50 cm, y su largo los 60 cm.

La separación razonable en-tre uno y otro es entre los 2,80 a3 m.

Cuando por alguna razón, dos dados se juntan mucho, podemos (y esconveniente), unirlos, transformando su largo no ya a 60 cm, sino a lo quefuera necesario, (por ejemplo 1,50 m).

Los dados de hormigón ciclópeo se hacen colocando en el pozo realizado para la cimen-tación una serie de capas de hormigón y piedra granítica. No llevan varillas de hierro.

J . G . B A R C A L A

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

DADOS DEHORMIGON CICLOPEO

Page 38: Credimat guia autoconstructor

Dados 8 - 2

1 = m3 de piedra granítica 0,25 = m3 de arena gruesa 0,45 = m3 de pedregullo 3,4 = bolsas de cemento portland10 = tablas para encofrado (si es necesario) 1 = kilos de clavos de 2 pulgadas

En los planos de estructura, enla parte correspondiente a cimientospodremos encontrar las distintas di-mensiones de nuestros dados de hor-migón ciclópeo.

Deberemos hallar el volúmen deun prisma:

ALTO x ANCHO x PROFUNDIDAD

Así haremos con todos para lue-go sumarlos y obtener la totalidad dehormigón ciclópeo que necesitaremosen obra.

Este valor total, lo multiplicare-mos entonces por los de la tabla deabajo para obtener las cantidades delos distintos materiales que compon-drán los dados.

Metrar los dados de hormi-gón ciclópeo es fácil.

XTotal dehormigónciclópeo

Page 39: Credimat guia autoconstructor

Patines 9 - 1

PATIN

PRESTEMOS ATENCION A ALGUNOS DETALLES

Para colocar laarmadura debere-mos antes haceruna capa de 5 cm.de hormigón paraluego apoyarla.

Se hará unaparrilla según losplanos. Todos loshierros deberán es-tar doblados en suspuntas y bien ata-dos.

Veamos unafundacióncon patines

El patín de hormigón armado viene a ser como el pie del pilar. Según el peso que apoyesobre él, será el tamaño de esta fundación. En los planos de estructura encontramos las medidasnecesarias para su realización, como así también los hierros que tendremos que colocarle y ala profundidad que deberemos hacerlo.

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

PATIN DEHORMIGON ARMADO

J.G.BARCALA

Page 40: Credimat guia autoconstructor

Patines 9 - 2

Línea divisoria

Si la cimentación nuestra cae justo enun ángulo del terreno respetaremos los15 cm. en ambos lados.

En este caso los patines sólo podránpasar para el otro lado de la línea divisoria15 cm., que corresponden a la medianeradel vecino. El resto ha de quedar de nues-tro lado.

Si la cimentación de la obra del veci-no da justo donde está la nuestra, entonces ellos podrán picar los 15 cm sinperjudicar el equilibrio de nuestra casa.

Cuando los muros denuestra casa van justo porla línea de nuestro predio,

tenemos que cuidar que loscimientos no queden del

lado del vecino

Page 41: Credimat guia autoconstructor

Patines 9 - 3

Veamos los materialesque necesitaremos paraconstruír un patín de

hormigón armado.

El tipo de hierro y cantidad deberemos obtenerloleyendo los planos de estructura, ya que allí nos di-rán cual irá y cada cuanto deberá colocarse.

De igual forma si multiplicamos la totalidad dehormigón por 25 kilos, tendremos una buena aproxi-mación en peso de lo que necesitaremos. Con ellospodremos obtener precios dentro del mercado.

Metrajetotal de

hormigónM3

0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland10 = tablas para encofrado (aproximado) 1 = kilos de clavos de 2 pulgadas 1 = kilos de alambre para atar

X

hacer es metrar los patines. Para ello nos basaremos en los planos de estruc-tura, ya que allí tendremos las medidas. Obtenida la cantidad de hormigón,que necesitamos para la obra la multiplicaremos por los valores siguientes,esto nos dará una buena aproximación de los materiales que deberemos con-seguir.

Lo primero que se deberá

Page 42: Credimat guia autoconstructor

Vigas de cimentación 10 - 1

Si nuestra cimentación es por medio de patines, las vigas de cimentaciónapoyarán en los pilares que nacerán de éstos.

Si nuestra cimentación es de dados de hormigón ciclópeo, las vigas apo-yarán sobre éstos y de estas nacerán los pilares.

PILAR

PATIN

VIGA

Para el armado de las vigas de cimentación ver vigas de hormigón armado.

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

VIGAS DECIMENTACION

Para poder soportar losmuros de la planta bajanecesitamos apoyarlos envigas.

J.G.BARCALA

DADO

VIGA

Page 43: Credimat guia autoconstructor

Vigas de cimentación 10 - 2

Hay terrenos ar-cillosos que cuando sehumedecen se co-mienzan a hinchar au-mentando su volú-men. La fuerza quegeneran hacia arribaes muy importante ypueden generar fisurasimortantes en nuestraconstrucción.

DESCALCE DE LAS VIGAS DE CIMENTACION

Dos formas de liberarlos fondos de vigas

Para evitar ese problema se deja libre de tierra unespacio debajo de las vigas.

NOTA:No es convenienteusar viruta en vez dearena porque la ma-dera cuando se pu-dre perjudica al hor-migón.

HERRAMIENTAS

Para saber cuánto material necesitamos en obra, deberemos realizar anteslos metrajes correspondientes a todas las vigas de cimentación.

Tomaremos las medidas de cada una y multiplicaremosALTURA X ANCHO X LARGO. Si sumamos los volúmenes obtenidosllegaremos a conocer la totalidad de metros cúbicos de hormigón que debemoshacer. Multiplicaremos entonces este valor final por los correspondientes a latabla inferior, obtendremos así la cantidad de materiales que necesitaremos enobra para la realización de nuestras vigas de cimentación.

Metrajetotal de

hormigónX

2 = kilos de clavos de 2 pulgadas 2 = kilos de alambre

0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 60 = tablas para encofrado (aproximado)

La cantidad de hierro dependerá de lo que indiquen los planos de es-tructura. Pero si al metraje total de hormigón para vigas lo multiplicamos por85 k, tendremos una aproximación del kilaje que necesitaremos en obra.

Page 44: Credimat guia autoconstructor

Paredes 11 - 7

Verificar que lasuperficie esté

horizontal. Usar 2reglas y el nivel demanga. Si no loestá hay quecorregirlo.

Limpiar lasuperficie del

cimiento.

Verificar los caballetes de re-planteo, si están bien bajare-

mos los puntos con plomada depunta y los marcaremos en elcimiento haciendo unas líneascon el canto de la cuchara sobrearena y portland.

A SEGUIRPASOS

Ahora comenzaremos a levantarlos muros.Veremos primerocómo se hace usando ladrillos.

Luego veremosrecomendaciones para eluso de otros materiales,

¿sí?

J.G.BARCALA

MINISTER IO DE V IV IENDA, ORDENAMIEN-TO TERR ITORIAL Y MEDIO AMBIENTE

PAREDES

Page 45: Credimat guia autoconstructor

Paredes 11 - 8

Las reglas tienen que estar bien fijas, las podemos clavar con unpar de tablas a estacas enterradas firmemente. Las tablas usadas(escuadras), tienen que estar ubicadas en las 2 direcciones princi-pales de la regla como indica el dibujo arriba a la izquierda.

El hilo tiene que quedar siempre tenso. Hay que cuidar que no se enganche,ha de quedar libre para que no engañe.

Conviene verificar cada tanto que las reglas continuen a plomo.

Otra forma de llevar el hilo es colocando un ladrillo encada extremo del muro, midiendo con el metro la altura dela hilada. Sobre éstos colocaremos otro cruzado (sin ma-

terial) al que ataremos el hilo definiendo así para elresto de la hilada la altura y posición a seguir.

NOTA

Colocaremos una regla de alu-minio o madera, en cada extremodel muro, bien aplomadas en sus 2sentidos principales. A ellas debe-mos colocarle un hilo que coincidacon la cara exterior de la pared quequeremos levantar.

Para que ésto suceda la cara de laregla por la cual deslizará el hilo deberácoincidir con la del futuro muro.

El hilo nos servirá para ir marcandocada hilada de ladrillo que levantemos y nosasegurará que al respetarlo nuestra paredesté a plomo y conforme un plano bien he-cho.

Para ladrillo visto, es convenien-te marcar en las reglas de madera laaltura de cada hilada, la que se cal-cula sumando la correspondiente alladril lo más la de la junta, loharemos de arriba hacia abajo.

LADRILLO VISTO

Page 46: Credimat guia autoconstructor

Paredes 11 - 9

Pondrermos una cucharada dearena, cemento portland e hidrófugosobre la superficie del cimiento,luego la extenderemos usando la propia cuchara.

lo pondremos con lapanza hacia arriba.

Si el ladrillo tie-ne cierta curvatura,

Es bueno poner ma-terial en la cara chica delladrillo para ayudar a lle-nar las juntas verticales.

Pero no deben estar chorreando.

Debemos mojar los ladrillosantes de usarlos.

Podremos termi-nar de acentarlo con unosgolpecitos de la cucharacon la que retiraremos losexcedentes laterales dematerial para colocarlosen las juntas verticales.

Asentaremos elladrillo empujando ymoviendolo en vaivén.

Para colocar el la-dirllo es convenienteseguir un movimientodeslizante como indicael dibujo.

PARA RECORDAR:

Si no se moja elladrillo, éste chuparáel agua del material yterminará despegán-dose .

Page 47: Credimat guia autoconstructor

Paredes 11 - 10

Verificaremos cada 5 o 6 hiladas la verti-calidad del muro, usando plomada, y la hori-

zontalidad usando una regla larga sobre éste ala que le colocaremos un nivel de burbuja.

Las juntas tienen que quedar no menos de1 - 11/2 cm de ancho dependiendo que sea ladrillode prensa o de campo.

Para que el muro sea resistente es convenienteir alternando las juntas verticales entre una hiladay la siguiente.

ello, aplastaremos el ma-terial con la cuchara deplano (planchado). Hay que

Es necesario que no quedeningún huequito. Para

empezar de abajo para arriba.Continuaremos levantando el muro con la mismatécnica pero usando una combinación de mezclagruesa con cemento o arena y articor.

Terminadas las 3 primeras hiladas deladrillo, usando el mismo material de arena ycemento portland con hidrófugo, revocaremos

los tres lados del pequeño muro. Solaparemos lacapa impermeable unos 5 cm sobre el cimiento.

Page 48: Credimat guia autoconstructor

Paredes 11 - 11

MURO DE 30

Vimos ya comolevantar un murosimple de 15 cm

Veamos ahora como se colocan losladrillos para un muro de

Se comienza con unmurito de 15 cm., de 2 hi-ladas trabadas al que se loaplaca un ladrillo de canto.

Luego haremos otras2 hiladas trabadas pero des-plazadas hacia la otra caradel muro, para terminar conotro aplacado.

Se comienza la primera hilada con losladrillos colocados a lo ancho del muro.

La segunda hilada secolocará en el otro sentido(a lo largo del muro). Losdos primeros ladrillos de lamisma deberán cortarse alas 3/4 partes para que lasjuntas queden trabadas.

Para cortar un ladrillo se lotoma en la mano y se lo

golpea con la hachuela en elsitio de corte.

Page 49: Credimat guia autoconstructor

Paredes 11 - 12

USANDO EL LADRILLO USANDO VARILLAS

HERRAMIENTAS

Lo hacés con el mismo ladrilloo con varillas de hierro

Cuando levantamos un muro po-demos dejar huecos del tamaño delancho de un ladrillo (cada 4 hiladas).Estos huecos recibirán posteriormentela otra pared. También podrá dejarse1/2 ladrillo hacia afuera para engancharel futuro muro.

Si debemos unir una pared quetenemos que levantar a otra existente,podemos hacerlo colocando varillas dehierro, (basta con un diámetro de6 mm).

Habrá que picar cada 5 o 6 hi-ladas. Usaremos un material de 3 par-tes de arena y 1 de cemento portlandpara amurar las varillas de hierro en lapared existente.

Este método nos puede venir bienpara trabar una pared de ticholos obloques con otra de ladrillo que este-mos levantando.

Si levantamos los 2 muros almismo tiempo podemos hacer así.

varil la de hie-r ro

Carlitos, cuando juntás 2 muros tenésque trabarlos, uno con el otro.

Page 50: Credimat guia autoconstructor

Paredes 11 - 13

EL TICHOLO

Es un material cerámico igualque el ladrillo, se hace con una má-quina. Gracias a su tamaño y a sushuecos que lo hacen liviano las pa-redes se levantan rápidamente.

Hay que mojarlo como al ladri-llo, pero no chupa tanta agua éste.

Para cortarlo se usa el cantode la cuchara, dando un golpe secoen el sitio de corte.

No se puede sacar y volver a colocar un ladrillo o ticholo ya puesto,porque se pierde resistencia en el muro. No vuelven a pegar bien.

Los hay de distintos grosores para levantar muros de 10 cm, 15 ymayores.

Es un material que no sirve para apoyar directamente un techo dehormigón, pero sí para llenar espacios entre pilares y vigas.

Los muros levantados con este material pesan menos que los hechosen ladrillo de campo o prensa.

PARARECORDAR

¿Qué es eso del ticholo?

Page 51: Credimat guia autoconstructor

Paredes 11 - 14

NOTA

EL bloque común no tiene mucha resistencia como para sostener un techo pesado.

Hay muchos bloques que son pobres en cemento y se rompen sencillamente usando nuestrasmanos, es conveniente no aceptar esos bloques.

No es un buen aislante térmico, las habitaciones suelen ser frías y húmedas en invierno ycalurosas en verano; para aislar más conviene aplacarle ladrillos.

Se pueden fabricar bloques usando un moldellamado bloquera y un mortero de 1 parte decemento portland más 8 partes de arena. Parafabricar 100 bloques neceitamos 7 bolsas decemento portland y 2 m3 de arena. Luego dehechos, para usarlos hay que esperar 4 sema-nas.

El bloque no se moja para colocarlo. Si serecibe mojado hay que dejarlos secar antesde usarlos, porque cuando están así se hin-chan y al secarse se retraen despegandose.Por eso conviene tapar el muro que no estéterminado. Cuando se levanta una pared, loshuecos del bloque van para abajo.

Las paredes de bloque hay que reforzarlas con varillas de hierro.

La junta como en cualquier otro manpuesto (ladrillo de prensa, de campo, ticholo o rejilla), tieneque ser continua y jamás debe bajar de 1 cm de espesor.

Hay que tener cuidado cuando se pica porque sedestroza fácilmente.

Por sus dimensiones asegura un levantamientorápido de muros. Se puede construir la estructura

por dentro de los bloques, aprovechando los huecos.

EL BLOQUE

El bloque es un elemento baratopara construír, pero tiene

sus inconvenientes

Page 52: Credimat guia autoconstructor

Paredes 11 - 15

Primero tenés que hacer un metraje delas paredes según el espesor que vayana tener las de 15 por un lado, las de20 por otro. Lo mismo si son de blo-

ques y otras de ladrillo.

Haremos grupos de muros según el tipo de material yespesor que usemos.Juntaremos los resultados de multiplicar los anchos porlos altos de las distintas paredes de esos grupos.

Cuando hayan ventanas o puertas le restaremos lo que ocupan las mis-mas. Cuando tengamos la suma de los distintos grupos de paredes multipli-caremos ese resultado por lo que indiquen las tablas de las páginas 11 y 12.

LA SUPERFICIETOTAL DE LAS DOSPAREDES SERA:

2,75 m2

6,10 m2

8,85 m2

PARED 22,40 x 3 = 7,20 m2

VENTANA1 x 1,10 = 1,10 m2

PARED 12,40 x 2 = 4,80 m2

PUERTA2,05 x 1 = 2,05 m2

VEAMOS EL METRAJEDE 2 PAREDES

Don Anastassio,¿No me da un

ejemplito?

4,80 - 2,05 = 2,75 m2

TOTAL DE PARED 27,20 - 1,10 = 6,10 m2

TOTAL DE PARED 1 +

¿Pero cómo se cuantomaterial tengoque comprar?

Page 53: Credimat guia autoconstructor

Paredes 11 - 16

MUROS DE 10 cmDE ESPESOR

Se pueden hacer con ladrilloso ticholo, algunos lugares ven-den bloquetas finas.

Sólo sirve para separacionesque no requieren gran esfuer-zo, como ser laterales de pla-cares.

x 33 = cantidad ladrillox 0,02 = mezcla gruesa m3

x 3 = kilos de portland

EN LADRILLO DE CAMPO EN ESPEJO

Superficiede muro

EN BLOQUES 12 X 20 X 40x 13 = cantidad bloquesx 0,02 = mezcla gruesa m3

x 2 = kilos de portland

Superficiede muro

EN TICHOLO DE 12 X 25 X 25

Superficiede muro

x 16 = cantidad ticholosx 0,025= mezcla gruesa m3

x 3 = kilos de portland

EN LADRILLO DE PRENSA

Superficiede muro

x 60 = cantidad ladrillox 0,045 = mezcla gruesa m3

x 5 = kilos de portland

EN LADRILLO DE CAMPO

Superficiede muro

x 66 = cantidad ladrillox 0,045 = mezcla gruesa m3

x 5 = kilos de portland

MUROS DE 15 cmDE ESPESOR

Podemos hacerlo de ladrillos,ticholos o bloques.

Este muro ya puede soportarun techo de hormigón si sehace de ladrillo o de rejillapero no de bloques o ticholo.No es un buen aislante de fríoo del calor.

EN TICHOLO DE 8 X 25 X 25 cm

x 16 = cantidad ticholosx 0,02 = mezcla gruesa m3

x 2 = kilos de portland

Superficiede muro

EN LADRILLO DE PRENSA EN ESPEJO

Superficiede muro

x 30 = cantidad ladrillox 0,02 = mezcla gruesa m3

x 3 = kilos de portland

Page 54: Credimat guia autoconstructor

Paredes 11 - 17

x 99 = cantidad ladrillox 0,065= mezcla gruesa m3

x 7 = kilos de portland

x 33 = cantidad rejillónx 0,03 = mezcla gruesa m3

x 3 = kilos de portland

x 13 = cantidad bloquesx 30 = cantidad ladrillox 0,05 = mezcla gruesa m3

x 7 = kilos de portland

x 132 = cantidad ladrillox 0,09 = mezcla gruesa m3

x 9 = kilos de portland

x 49 = cantidad rejillónx 0,045 = mezcla gruesa m3

x 5 = kilos de portland

Cada bolsa de portland lleva 50 ki-los, entonces necesito un poquitomás que 3 bolsas y media (3,6).

Veamos comose usa esta

tabla

Si el metraje de muros de 20 cm me da 60 me-tros cuadrados y lo quiero hacer en ticholo rejillón:60 m2 x 33 = 1980 ticholos60 m2 x 0,03 = 1,8 m3 de mezcla gruesa60 m2 x 3 = 180 kilos de portland.

EN LADRILLO DE CAMPO

Superficiede muro

MUROS DE 20 cmDE ESPESOR

Es un muro que aisla el frío yel calor aceptablemente.

En el caso del bloque y ladrillorequiere un mortero impermea-ble entre ellos, usando arena(3 tachos), más cemento por-tland (1 tacho), más hidrófugosegún las indicaciones del fa-bricante.

Superficiede muro

EN TICHOLO REJILLON

EN BLOQUE CON LADRILLO DECAMPO APLACADO

Superficiede muro

EN LADRILLO DE CAMPO

Superficiede muro

MURO DE 30 cmDE ESPESOR

EN TICHOLO REJILLON

Superficiede muro

La aislación térmica logradacon este tipo de muro es muyaceptable.

Page 55: Credimat guia autoconstructor

Refuerzos en los muros 12 - 1

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

REFUERZOSEN LOS MUROS

VEAMOS CUALES REFUERZOS HAREMOS

Los muros sean de ladrillo o bloques hay que reforzar-los para que aguanten más y no aparezcan fisuras.

Si hemos decidido construir una casa a base depilares y vigas, éstas estarán diseñadas para soportarlas fuerzas que se producen, y los muros serán merastapas entre ellos. Pero cuando nuestras paredes so-portarán peso importante habrá que reforzarlas.

Algo vimos ya cuando hablamos de trabar las paredescon el mismo material o con varillas de hierro.

ESTE

J.G.BARCALA

Page 56: Credimat guia autoconstructor

Refuerzos en los muros 12 - 2

La carrera dehormigón armadose hace del mismo

ancho que el muro, y de una altura jamásmenor de 15 cm (1 tabla de encofrado).

Un alto adecuado sería unos 25 cm. Se le debe colocar una armadura de cuatrohierros de 8mm. tratados, y estribos de hierro común de 6 mm.

La armadura debe ser 1 cm máschica de cada lado que el tamañodefinitivo de la carrera.

Cuando se llenael encofrado dehormigón hayque cuidar deque los hierrosno apoyen con-tra la madera.

CARRERAS

ENCOFRADODebemos mojar el encofrado antes de l lenarlo con hormigón.Sacaremos los encofrados laterales a los 3 días de l lenado.

Page 57: Credimat guia autoconstructor

Refuerzos en los muros 12 - 3

El resultado lo multiplicaremos por la siguiente tabla.

ANCHODE LA

CARRERA

ALTODE LA

CARRERA

LARGODE LA

CARRERA

METROCUBICO

(m3)

X X =

Metroscúbicos dehormigón

0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 40 = tablas para encofrado (aproximado) 2 = kilos de clavos de 2 pulgadas 2 = kilos de lambre para atar Nº18

Largo decarrera

4(cantidad

de varillas)X X

1,10(desperdicioy ganchos)

=Metros de hierro que habráque dividir por 6 si son vari-llas de seis metros o por 12si son de doce metros.

2 veces elalto de lacarrera

2 veces elancho de la

carrera+ = Largo de un solo estribo

Para saber que material necesitamos en la construcción deuna carrera haremos la siguiente cuenta:

Para el hierro tendremos que metrar cada varilla y tomar en cuenta que se vendenen el mercado de 6 metros y 12 metros de largo.

Si dividimos el largo de la carrera entre 0,25 (la separación entre estribos),tendremos la cantidad de estribos que necesitamos.Podemos multiplicar ese número por el largo de un estribo y así obtener el totalde metros de varilla común de 6 mm.Conviene sumarle un 10% que se irán en desperdicios ocasionados por los cortes.

X

Para metrar los estribos podemos tomar:

Page 58: Credimat guia autoconstructor

Refuerzos en los muros 12 - 4

La armadura de los pilares se atana la de la cimentación haciendo unaescuadra en la base

Pondremos los pilares en los ángulosde la casa y en todo otro encuentroimportante de muros. Los muros queno son principales podemos trabarlosusando el mismo ladrillo como yavimos.

Cuando un muro es muy largo, con-viene cortarlo con pilares de traba, paraque no queden paños mayores de 3 o4 metros.

Se puede levantar los muros dejandoel espacio para el pilar. En este casoconviene dejar las puntas de estosmuros lo más rugosas posibles, paraasegurar una buena adherencia. Ter-

minando los muros ataremos la armadura del pilar, limpiaremos la base y colo-caremos un tablero de cada lado el que podremos fijar atando uno a otro conalambre y clavando algunas escuadras. La base del tablero deberá quedar bienfirme, pues allí se ejerce la mayor fuerza al llenar de hormigón.

Podremos sacar los encofrados a los 7 días de llenados.

Los pilares tienen que estar definidosen el momento de hacer los cimientos

Es más cómodo dejar 4 patasatadas al cimiento, que sobresalganunos 40 cm; a las que ataremos lue-go la armadura del pilar.

RECORDAR

PILARES DE TRABA

Los realizaremos con 4 varillas dehierro tratado de 10, con estribos de 6común cada 15 cm.

Page 59: Credimat guia autoconstructor

Refuerzos en los muros 12 - 5

Antes de comenzar a levantar los mu-ros, se marcan la ubicación de las puertas yventanas sobre las vigas y carreras de loscimientos.

Con el filo de la cuchara haremos unalínea en una capa de arena y cemento port-land.

De esta forma sabremos donde termi-nar la pared para dejar el hueco de la puerta.

Todo hueco de ventana o puerta necesita un dintel.Este sostiene lo que queda de muro arriba de él.IMPORTANTE

Y para las puertasDon Anastasio¿Cómo hago?

El dintel puede ser hecho dehormigón armado, de ladrillo arma-do, de perfil de hierro, etc.

Normalmente comienza unos5 a 7 cm. arriba de la abertura, salvoque al hacerlo esté ya puesta la ven-tana o puerta en cuyo caso lo hare-mos directamente sobre ella.

La diferencia que queda sirve paraacuñar el marco contra el dintel concascote, arena y cemento portland.

Para una puerta normal la alturausual de comenzar el dintel es a 2, 10metros, ya que 2,05 metros suele te-ner de alto una abertura estandar quecompremos en una barraca.

Page 60: Credimat guia autoconstructor

Refuerzos en los muros 12 - 6

Ponemos una primera hilada de la-drillos a la que superpondremos un morterode arena y cemento portland (3 x1).

Dentro de este mortero colocaremoslas varillas de hierro según el ancho delhueco, como indica la tabla inferior.

2

ANCHO DE ABERTURA TIPO DE HIERRO2 Varillas tratadas de 83 Varillas tratadas de 8 o2 varillas tratadas de 103 varillas tratadas de 10 o2 varillas tratadas de 12

3 Continuamos el muro otra hiladamás acentada con el mismo mortero,dejando las varillas tipo sandwuich

De 2 a 3 m

De 1,20 a 2 m

Hasta 1,20 m

1Colocamos una tabla bien sujeta a

la altura donde quiero comenzar el dintel,la pondremos de lado a lado del hueco.

DINTEL DE LADRILLO ARMADO

Page 61: Credimat guia autoconstructor

Refuerzos en los muros 12 - 7

Cuando trabajamos con bloques podemos usar para hacer losdinteles aquellos en forma de "U" .

Le ponemos los hierrosdentro y lo llenamos de

hormigón

Tendremos un bigote en cada junta debloque "U" del dintel.

Para poder colocarlo se va rompiendoel fondo del bloque en cada hilada de formade dejar un hueco del alto del muro, al quellenaremos con hormigón luego de puesta lavarilla.

Los hierros van según el anchode la abertura indicada en la página 18.

Si la ventana va a llevar cajón de cortinase le puede dejar bigotes de hierro de 6 mm.,de la altura que éste tendrá.

El frente lo haremos en base a metal des-plegado.

A cada lado de una abertura hay que reforzar el muro de bloques con la colocación de una varilla de 10 mm. del alto del muro.

DOSIFICACION PARAEL HORMIGON

3 partes de pedregullo2 partes de arena gruesa1 parte de cemento portland

HERRAMIENTAS

Page 62: Credimat guia autoconstructor

Pilares 13 - 1

Significa que el pilar nacea ese nivel .

Significa que el pilar vienede más abajo y continúa.

123456789123456789123456789123456789123456789123456789

Significa que el pilar termi-na a ese nivel.

¿Cómo losveremosdibujados

en los planos?

40

15

En los planos de estructura encontraremos los pilaresnumerados con todas las medidas correspondientes para ubi-carlos correctamente. Encontraremos a su vez las dimensionesque deberán tener, como ser 15 x 40 cm.

También los hierros con los que deberán armarse y laaltura que tendrán.

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

PILARES DEHORMIGON ARMADO

Veamos como son los pila-res de hormigón armado.

J.G.BARCALA

Page 63: Credimat guia autoconstructor

Pilares 13 - 2

Don Anastasio, muestre comoes eso de los ENCOFRADOS

para pilares.

Comenzaremos con el pri-mer marco a nivel de la base delpilar, a los 30 cm. podremos co-locar el segundo.

Luego iremos ubicándonoscada 35 a 40 cm de distancia.

A la altura de encuentro conla viga haremos el corte del late-ral para poder poner la tabla quehará de fondo de ésta.

En la base del encofrado de-beremos dejar una abertura quenos permita limpiar el interior an-tes de llenar de hormigón.

Para asegurar la verticalidaddel encofrado deberemos colocarleescuadras de madera firmementeagarradas al suelo. Las colocare-mos en las 2 direcciones princi-pales del pilar.

Haremos los encofrados depilares con tableros verticales, alos que le colocaremos marcos he-chos de media tabla.

ENCOFRADO

Page 64: Credimat guia autoconstructor

Pilares 13 - 3

VEAMOS COMO COLOCAR LOS HIERROSDE UN PILAR

Para unirlos luego con el resto de laarmadura. Deberemos entonces do-blar los hierros en forma de cuello

de botella paraque mantenganuna misma lí-nea.Dejar los bigoteshace que seamás cómodo eltrabajo en la obra.

Normalmente colocaremos 4hierros iguales según lo que in-diquen los planos, irán sujetospor los estribos, hechos en hie-rro más fino que deberán respe-tar tamaño y separación segúnlos cálculos del técnico.

COMO TERMINAR LOS HIERROS

Para ello deberemos doblar los hierrosdel pilar en forma de "L" para poderatarlos a los de la viga de cimenta-ción.

Deberemos introducir loshierros en la viga supe-rior o carrera doblando laspuntas. Ataremos enton-ces las 2 armaduras.

PATINES

Si hemos dejado bigotes salientesde nuestra

cimentación.

DADOS

Se puede dejar colocada la armaduradel pilar desde el momento en quehacemos los cimientos.

Page 65: Credimat guia autoconstructor

Pilares 13 - 4

Tota lde ho rmigón

de p i l a res

Obteniendo el metraje de homigón de un pilar, podremos multiplicarlo porla totalidad de los pilares iguales que tengamos. Este valor final lo multiplicare-mos por los valores de abajo y obtendremos la cantidad de material necesario.

Para metrar los pilares tomaremos laaltura de ellos desde la cara superior de lafundación hasta la parte más alta de la viga.Haremos entonces el metraje de un pilar dela siguiente manera:

Los hierros dependerán de lo que nos digan los planos de estructura.De todas formas, multiplicar el total de hormigón de pilares por 125 k. nos daráuna aproximación del kilaje de hierro que tendremos que conseguirpara la obra.

0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland80 = tablas para encofrado (aproximado) 2 = kilos de clavos de 2 pulgadas 2 = kilos de alambre para atar

x

ancho x largo x altura = m3 de hormigón.

HERRAMIENTAS

VEAMOS COMO METRAR UN PILAR

Page 66: Credimat guia autoconstructor

Vigas 14 - 1

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

VIGAS DEHORMIGON ARMADO

Junto a estos dibujos se suele agregaruna tabla de datos. En ésta encontrare-mos el tipo de viga que es, el ancho,alto y largo de la misma; el tipo dearmadura longitudinal y los estribos.

V001 (15 x 40) Al número de viga se le suele agregar lasdimensiones en centímetros, colocando pri-mero la base de la viga y luego la altura.(En el ejemplo: 15cm. x 40cm.).

Esto indica que la viga va para arriba de lalosa de hormigón.

Este otro indica que la viga va para abajode la losa.

V 001 V 001

En los planos de estructura, las vigasaparecen numeradas en el siguiente or-den: de arriba hacia abajo (V001-V002)yde izquierda a derecha (V051-V052).

Se las dibuja de apoyo a apoyo con 2 líneas o una con flecha en ambas puntas.

J.G.BARCALA

Page 67: Credimat guia autoconstructor

Vigas 14 - 2

Para recibir el encofrado de viga colocaremos sobre cada puntal (previamentecortados a medida) un par de tablas cortas de aproximadamente 1 m clavadas unaa la otra (cruceta). Estas irán escuadradas de un lado y del otro del puntal con otras

ENCOFRADODescribiremos el ar-

mado de un encofrado parauna viga sencilla de bordeque soportará una losa dehormigón armado.

Más adelante veremosun detalle de viga invertida.

Pongamos el ojo en el clavo yveamos primero unencofrado de viga.

tablas de unos 60 cm de largo. (Ver figura ala derecha).

También le colocaremos unos pequeñosgateles (maderas finas), de unos 5 o 7 cmde ancho, clavadas a lo largo del puntal.

Los puntales que estarán distanciadosentre ellos unos 90 cm., irán apoyados sobreuna tabla o tablón en el suelo. El que deberáestar bien asentado. Para que el fondo de laviga se encuentre a nivel usaremos un par decuñas de madera, que solaparemos debajo decada puntal. Con ellas podremos levantarloslo que sea necesario. Verificaremos con elnivel de burbuja y una regla o en su defectoen ambos extremos con un nivel de manga.

Para conseguir este hormigóncomenzaremos colocando unatabla sobre puntales.

Page 68: Credimat guia autoconstructor

Vigas 14 - 3

Luego de asegurar el fondo (1),comenzaremos a colocar los tableroslaterales (2)(3), los que llevaráncostillas (4) conformadas por unatabla de canto cada 60 cm aproxi-madamente, irán apoyados sobre lascrucetas (5) de los puntales.

Para asegurar su posición ver-tical llevarán una escuadra (6) cla-vada en lo alto de la costilla de un

lado y a la cruceta del otro.

La parte inferior de las costi-llas irán aseguradas por un listónhorizontal clavado a las crucetas.

Sobre las costillas (7) del ta-blero interno deberemos clavar otrolistón (8) de madera para apoyar lascostillas (9) que soportarán las ta-blas del encofrado (10) de la losa.

Page 69: Credimat guia autoconstructor

Vigas 14 - 4

GANCHO

1 Debemos comenzar doblandolos hierros según indican los planos,para ello usaremos la grifa cuyo tama-ño dependerá del diámetro del hierroque vayamos a trabajar.

El doblado de la varilla se debehacer en frío, no se calienta a fuego.

Todo hierro, salvo que indiquenlo contrario los planos de estructura,deberán terminar en un gancho.

Si queda corta una varilla podre-mos empalmarla con otro trozo paratener el largo indicado en los planos.En este caso deberemos solaparnos unos40 diámetros de la varilla que esta-mos uniendo, o sea que si tenemosuna varilla de 10 mm. solaparemos40 cm., con una de 8 mm. solapare-mos unos 32 cm.

Conviene hacer un atado de to-dos los hierros correspondientes a unamisma viga.

NOTAEs importante respetartodo lo que indican losplanos de estructura.Ya que la estabilidad dela casa depende de ello.

Grifa en mano veamoscomo van los hierros

Mínimo 40 diámetros

Page 70: Credimat guia autoconstructor

Vigas 14 - 5

Colocaremos las dos varillascorrespondientes a los ángulos supe-riores de la viga sobre caballetes, cu-yos apoyos sean una barra de hierrode unos 10-12 mm.

2

3

Deberemos ahora dar vuelta la armadura y colgarla de los hierros restantesque apoyaremos en los caballetes. Hecho ésto, los ataremos a los estribos.

Si tenemos un hierro tipo"B" o negativo, convendrá ubicarlo eneste momento, lo colocaremos pordentro de los estribos y luego lo ata-remos a ellos.

4

Marcaremos sobre éstas,la ubicación indicada en los planos para los estri-bos, los que comenzaremos a distribuír colgándolos de las 2 varillas, (varillas pordentro). Una vez colocados todos en sus lugares los ataremos.

5Repetiremos ésto con cadaviga que tengamos, para noentreverarnos le colocaremosun cartelito atado con elnúmero que le correspondaen el plano.

Page 71: Credimat guia autoconstructor

Vigas 14 - 6

VEAMOS METRAJESDE VIGAS

Para tomar el largo de las vigaslo haremos midiendo entre los dospilares.

Tomaremos entonces:

Este valor lo deberemos multi-plicar por la totalidad de vigas igua-les y hacer lo mismo con aquellasque no lo son.

De ésta forma y sumando to-dos los valores obtendremos el me-traje total de hormigón que necesita-remos para construír nuestras vigas.

LARGO X ANCHO X ALTO = m3 DE UNA VIGA

Este total deberemos multiplicarlo por los siguientes valores para saber los mate-riales que requeriremos.

Metrajetotal de

hormigónX

HERRAMIENTAS

0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 70 = tablas para encofrado (aproximado) 2 = kilos de alambre 2 = Kilos de clavos de 2 pulgadas

La cantidad de hierro dependerá de lo que indiquen los planos de es-tructura. Pero si al metraje total de hormigón para vigas lo multiplicamos por115 k, tendremos una aproximación del kilaje que necesitaremos en obra.

Page 72: Credimat guia autoconstructor

Vigas 14 - 7

Veamos un ejemplo de una viga quetiene que soportar el peso de un techo

distancia de 3,50 m.apoyos están separados una

de hormigón armado y que sus

Nuestra viga tendrá una sección de15 cm. de base por 35 cm. de alto.

A R M A D U R A S

Armadura: en la parte baja de la vigacolocaremos 3 hierros, dos serán de 8 mm.tratados y el restante de 10 mm. tratado.

De éstos tres doblaremos el de 10 mm.para que sobre los apoyos tengamos máshierro en la parte de arriba de la viga.

Los hierros superiores serán de 6 mm.(común).

Tendremos que hacer 14 estribos devarilla común de 6 mm., los que separare-mos 24 cm. entre sí.

UBICACIONDE LOS

HIERROSEN LA VIGA

Page 73: Credimat guia autoconstructor

Techos 15 - 1

TECHOS PESADOSTECHOS LIVIANOSComprenden estos techos aquellos de cha-pa galvanizada, fibrocemento, fibra de vi-drio y techos de tejas sobre estructurasde madera, hierro, etc.

Comprenden estos techos los de hormi-gón armado hechos en el sitio, aquellosde losetas de hormigón prefabricadas,de bovedillas cerámicas sobre viguetasde hormigón, etc.

De este otro grupo veremosel techo de hormigón armado.

De este grupoveremos los

techos de chapagalvanizada.

TECHOS

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

Es hora de ver los TECHOS

S e p a r a r e m o slos techos en livia-nos y pesados.

J.G.BARCALA

Page 74: Credimat guia autoconstructor

Techos Livianos 16 - 1

Techos l i v ianos de chapa galvanizada

ALGUNAS VENTAJAS DE UNTECHO LIVIANO O DE CHAPA

- Es de rápida colocación.- No necesita impermeabilizante.- Se consiguen coloreadas de fábricapero también pueden ser pintadas para darun aspecto singular al techo.- Al ser livianas permiten un buen ma-nejo en obra.- Se cortan fácilmente con tijera dechapa o sierra.- Dependiendo del diseño que se eli-ja, puede salvar distancias importantes casisin apoyos intermedios.- Son muy buenas para hacer sobre-techos en casas de cubiertas de hormigón,ésto beneficia térmicamente a la vivienday también ayuda a evitar humedades.- Son de fácil recambio.

ALGUNAS DESVENTAJAS DEUN TECHO LIVIANO DE CHAPA

- Si no se hace una buena aislacióntérmica por debajo de ellas, genera loca-les extremadamente fríos en invierno ycalurosos en verano. Cuando afuera hacefrío, el calor del interior hace condensarel vapor y chorrear agua.- Con el paso del tiempo "envejecen"y pierden el zinc protector oxidándose.- Requieren un buen trato en obraya que son fáciles de doblar.- Si no se respetan los solapes y elresto de ejecuciones indicadas por los téc-nicos fabricantes puede pasar agua alinterior de la vivienda.- Por ser livianas corren el riesgo deser levantadas por fuertes vientos, paraevitar ésto, tienen que estar correctamentesujetadas.

J.G.Barcala

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

TECHOSLIV IANOS

Page 75: Credimat guia autoconstructor

Techos Livianos 16 - 2

C A R A C T E R I S T I C A SSe encuentran en plaza varios largos que van desde1,83 m. hasta pasando los 4,57 m. (a pedido). Losde uso más común son los de 1,83 - 2,13 - 2,44 m.

La chapa viene de 88 cm., pero como hay que solapar-las cubren un ancho real de 80 cm.

Se fabrican 2 espesores, éstos influyen en los pesos ytambién en la separación necesaria entre apoyos.

CHAPAS ACANALADASEste tipo de chapa es la más común en los techos de viviendas, veremos luego

como se arman estos techos.

Considerando que se puede llegar a caminar sobre eltecho, las separaciones máximas entre apoyos ronda-rían los 105 y 115 cm., dependiendo si es una chapafina o gruesa respectivamente.

DISTANCIASENTRE APOYOS:

ESPESOR:

ANCHO:

LARGOS:

Para guardar las chapas en obra hay quehacerlo separadas del suelo y unas sobre

otras coincidiendo las canaletas.Esto evitará el deterioro de las mismas

Page 76: Credimat guia autoconstructor

Techos Livianos 16 - 3

Cuando debemos cubrir el largo del techo con más de una cha-pa, tendremos que solaparlas con un mínimo de 30 cm. En estecaso la pendiente podrá variar

100 cm

Para una chapa que cu-bre la totalidad del techoen su largo la pendientemínima estaría dada por:

100 cm8 cm

15 cm a 20 cm

Las PENDIENTES ylos solapes delas chapas estánextríctamenteligados.

Los techos inclinados pueden escurrirel agua de lluvia en forma directa,

o sea caída libre o puedejuntársela por medio de un

canalón al final de lapendiente

PUNTOS A CUIDARCUANDO EL TECHO TIENE

CAIDA LIBRE:Que el agua no escurra directamente

al vecino. Que el agua no escurra sobre

la puerta de entrada.Que el agua no caiga sobre un

lugar de tierra ya quepodrá zocavar.

Page 77: Credimat guia autoconstructor

Techos Livianos 16 - 4

Podremos hacer las correas en diversos materiales, ma-dera, perfil de hierro, reticuladas en hierro redondo, perfil dechapa, etc.

Para una vivienda lo más normal es el uso de correasde madera, son de fácil trabajo en obra, y suelen ser más eco-nómicas que las demás.

Es conveniente usar madera de primera calidad. No hade ser verde para que al secar no se arquee, ya que necesitare-mos que sea recta. Hay que cuidar de que no esté apolillada yque tampoco tenga muchos nudos, especialmente aquellos nu-dos pasantes o muy grandes.

las paredes están más alejadas debemos entonces, colocar una viga en elmedio. La dimensión de ésta dependerá del material con que querramoshacerla.

C O R R E A SSirven para sujetar las

chapas.Para apoyos entre paredes dis-tanciadas en el orden de los2,50 m. y 3 m., podemoscolocar tirantes de maderaque vayan de una a otra. Paralograr eso nos podemos apro-vechar de las paredes que se-paran distintos ambientes. Si

DISTINTOS T IPOS DE CORREAS

Page 78: Credimat guia autoconstructor

Techos Livianos 16 - 5

separación máxima de105 cm.105 cm máximo

Colocaremos primero lostirantes extremos, el del bordesuperior y el del borde inferior.Deben quedar bien nivelados.Para que ello ocurra la superfi-cie donde éstos apoyan deberáser pareja.

Del primer tirante al últi-mo deberemos tirar un par dehilos tensos, lo haremos de am-bos extremos.

Este hilo ubicará las ca-ras superiores de todos los ti-rantes que deberemos colocar.

Tenemos de esta formaun plano bien definido

HILO

TIRANTE DE BORDE INFERIOR

TIRANTE DE BORDESUPERIOR

para colocar. Si nos basamos en la chapa acanalada común, y enel espesor menor de ellas, fijaremos nuestros apoyos con una

para la ubicación de las chapas

galvanizadas.

¿Cómo hacemos para armar un techo liviano?

Una vez que tengamos nuestras paredes le-vantadas o las vigas desencofradas, debere-mos distribuir los tirantes de apoyo de laschapas. Las separaciones entre estos depen-derán de la chapa que hayamos comprado

Page 79: Credimat guia autoconstructor

Techos Livianos 16 - 6

Colocaremos por debajo delos hilos el resto de lostirantes, respetando el pla-no definido por los 2 hilosy la separación máxima deapoyos que tolera el tipode chapa que usaremos.

Una vez colocados los tiran-tes deberemos amurarlos.Es sumamente importanteque una estructura de techoliviano se encuentre bienanclada ya que vientos fuer-tes tienden a levantarla.

TERMINACION DE TECHO CON CANALON Y EN CAIDA LIBRE

Comenzaremos a cla-var las chapas por lafaja más baja, siendola primera de ellasaquella que se ubiquedel lado opuesto dedonde vienen los vien-tos principales.

Debemos asegurarnos que el borde interiorde las chapas sea paralelo a la pared, ya que enun trecho largo pueden torcerse fácilmente.

La segunda hilada de cha-pas deberá montarse sobre la pri-mera y así sucesivamente. El so-lape se hará en el orden de los30 centímetros.

Si el borde inferior lleva uncanalón receptor de aguas de llu-via, deberemos fijarlo antes de

comenzar a colocar las chapas.Estos deberán ser colocados conuna pendiente de 1/2 centímetropor metro hacia los embudos dedesagüe. Si el techo tiene caída li-bre, conviene volar la chapa unos30 centímetros con respecto almuro exterior.

Page 80: Credimat guia autoconstructor

Techos Livianos 16 - 7

VEAMOS ALGUNOS DETALLES

EN CASODE QUE LA

CORREA SEAMETALICA .

ESTE ES UN EJEMPLO DE UNAGARRE DE LA CHAPA SOBREUN TIRANTE DE MADERA.

C A N A LO N

Page 81: Credimat guia autoconstructor

Techos Livianos 16 - 8

HERRAMIENTAS

Cuando nuestro techo termine con-tra una pared, deberemos amurar una ba-veta de chapa galvanizada. Usaremos paraello arena y cemento portland con hidró-fugo para evitar la entrada del agua por launión de ésta con el muro.

Cuando el techo comienza directamentedesde un muro que sobresale, deberemos colo-car una pieza especial que tiene la forma de lasondas de la chapa del techo. Esta pieza que irásujeta al muro para su unión con éste, deberácubrirse con una baveta de chapa galvanizadaamurada con arena y cemento portland con hi-drófugo.

Cuando tenemos en nuestro techo unacumbrera por ser éste a 2 aguas, deberemosusar una pieza especial para cumbrera. Ten-dremos que cuidar que el solape de estos ele-mentos no coincida con el de las chapas detecho. Para ello cortaremos la primera cum-brera como indica el gráfico, ésto nos permi-tirá ir desfazados con la chapa.

Page 82: Credimat guia autoconstructor

Losa de hormigón 17 - 1

Deberemos ubicar en obra la alturadel fondo de la losa, ésta será la sumade la altura libre del techo al piso más elrevoque de cielorraso. Ese punto será laubicación de la cara superior del encofra-do que tendremos que construir.

DETERMINACION DE ALTURADE ENCOFRADO

J . G . B A R C A L A

berán estar del nivel defondo de losa a una se-

paración igual al del espesor de la tablaque usaremos para el encofrado (normal-mente 2,5 cm). Para ubicar la parte altadel tirante restaremos los 15 cm. de lastablas de costillas.

Estos tirantes podrán conformarsetambién con 2 tablas de encofrado de15 cm. (una al lado de la otra, clavadas).

Para armar el encofrado comenzaremospor el perímetro, colocando tirantes apo-yados sobre puntales a medida. Sobreéstos apoyaremos las costillas cada 60cm, hechas de tablas separadas entre sí.

La parte de arriba de las costillas de-

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

LOSA DEHORMIGON ARMADO

Veamos unejemplo de una

losa horizontal simple

Page 83: Credimat guia autoconstructor

Losa de hormigón 17 - 2

COSTILLA

IMPORTANTE

Empujando hacia adentro lascuñas podremos levantar el enco-frado. Si no existieran éstas, nopodríamos desencofrar la losa.

De las costillas ya apoya-das colgaremos con alambre elresto de los tirantes, respetandouna separación aproximada a los90 o100 cm.

Luego colocaremos lospuntales para apoyar esos tiran-tes colgados.

Los puntales apoyarán so-bre tablas puestas en el suelo queseguirán la dirección de los ti-rantes. Se usarán cuñas paraajustar la altura de los mismos.

Para asegurar toda la estructura de ma-dera, y que no se muevan los puntales,deberemos clavar tablas en forma de "X".

Una vez colocadas todas las ta-blas planas podremos controlar el nivelpor medio de una regla larga y un nivelde burbuja. Lo haremos en los 2 sen-tidos principales del encofrado. Para llevarlo a nivel deberemos ir ajustando la altura delos puntales por medio de las cuñas, que por último las clavaremos a la tabla del pisopara que no se deslicen.

Queda aún clavar las costillas a todos los tirantes que habíamos colgado, loharemos con tablitas (gateles) bien verticales.

Page 84: Credimat guia autoconstructor

Losa de hormigón 17 - 3

Veamos cómo solucionar un bordecon viga invertida que hace de pretil

para azotea.

Cuando hay que añadir un trozo de pun-tal a otro para llegar a la altura adecuadase hará sobre la parte baja del mismo ynuca se añadirá en el medio. Se haráclavando 4 tablas finas como quien haceuna caja. Estas deberán solapar cada tro-zo de puntal por lo menos 30 - 40 cm.

NOTA

Page 85: Credimat guia autoconstructor

Losa de hormigón 17 - 4

Las losas (o planchadas) son dibujadas en losplanos con un símbolo que define su altura y el tipode varilla de hierro que irá en cada sentido con sucorrespondiente separación.

Pueden graficarse otros elementos como refuerzos (hierros que se agregan enlugares críticos), hierros que se doblan; los que van por debajo y los que van porarriba, etc. Pero las más comunes son las anteriormente descriptas.

10

LECTURA DE PLANOS

Veamos cada una de esos símbolos:

18

Implica hierro tratado (no común) de un diámetro de 10milímetros, puede simbolizarse con un círculo con unaX por encima.

Indica el el sentido en que se colocarán las varillas dehierro.

El número entre estas líneas define la separación quedeberán llevar las varillas (en este ejemplo se separan18 cm las de 10).

Este número en el medio del cuadrado indica el espesorde hormigón que deberá llenarse (la altura del hormi-gón).

Indica lo que es la losa y lo que son sus bordes de apoyo(podrá ser que apoye sobre vigas, o sobre una carrera queesté colocada sobre un muro portante).

12

Page 86: Credimat guia autoconstructor

Losa de hormigón 17 - 5

¿Y los hierrosDon Anastasio?

Esta graficación indica que se colocarán2 hierros tipo "A"...

Se debe respetar todo lo que plantea un plano de estruc-tura. Las medidas de hierro colocadas están estudiadaspara soportar los pesos por los cuales fueron diseñadas.

...y luego uno de tipo "B"...

...para luego seguir con 2 de tipo "A"y así sucesivamente.

2 A

1 B

Si no se indica como debe ser el doblado del hierro tipo "B", tomaremoscomo norma comenzar a doblarlo a una distancia de la viga correspondiente ala décima parte del largo que tiene que recorrer.

A demás de los símbolosdescriptos anteriormente un pla-no puede indicar como debenser doblados los hierros y cuán-tos irán de cada uno.

largo 5

largo 5

Page 87: Credimat guia autoconstructor

Losa de hormigón 17 - 6

Marcaremos con tiza sobre el enco-frado la ubicación de los hierros, respetare-mos la separación indicada en los planospara cada sentido de la armadura.

1

La primer marca se ubica-rá a la distancia de una separe-ción con respecto al apoyo de lalosa (viga o carrera). Continuare-mos con ellas hasta cubrir todoel desarrollo del encofrado.

2 Colocaremos los hierros según el orden que le corresponda, ubicandolosen cada marca.

Se deberá comenzar por aquellos hierros que indiquen los planos, siéstos no dicen nada podemos pensar que por debajo irán aquellas varillas quecrucen el lado más corto de la losa.Si la losa es cuadra-

da y tiene buenos apoyosen todo su contorno, daráigual por cual hierro se co-mience.

Si la losa solo estáapoyada en dos lados loshierros principales, que sonlos que primero se ponencorresponderán a los quevayan de apoyo a apoyo.

VEAMOS COMO COLOCAMOS LOS HIERROS

Page 88: Credimat guia autoconstructor

Losa de hormigón 17 - 7

4

HERRAMIENTAS

Una vez extendidos loshierros principales colocare-mos sobre ellos los que vanen el otro sentido.

Cada cruce de varilla deberá ser atada con alambre dulce (N0 18 va bien), paraello deberemos usar una tenaza de herrero, ya que ésta permite cortar y a su vezapretar, tirando del alambre. La forma de terminar la atadura es retorciendo las 2puntas de alambre.

3

Es conveniente atar las puntas de los hierros a la armadura del apoyo.

Page 89: Credimat guia autoconstructor

Losa de hormigón 17 - 8

Veamos quemateriales necesitamospara nuestra obra

Debemos calcular elvolúmen de hormigón que ne-cesitamos.

Para ello multiplicare-mos los anchos por los lar-gos y por las alturas de cadauna de las losas que tenga-mos que construir.

ANCHODELOSA

ALTODELOSA

LARGODELOSA

x x

El volúmen total de hor-migón deberemos multipli-carlo por cada uno de losvalores indicados en la tablainferior.

Metrajetotal de

hormigónX

0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 50 = tablas para encofrado (aproximado) 2 = kilos de alambre 2 = Kilos de clavos de 2 pulgadas

La cantidad de hierro dependerá de lo que indiquen los planos de es-tructura. Pero si al metraje total de hormigón para losas lo multiplicamos por60 k., tendremos una aproximación del kilaje que necesitaremos en obra.

Page 90: Credimat guia autoconstructor

Losa de hormigón 17 - 9

5 m. X 3,5 m. X 0,10 m. = 1,75 m3 de hormigón.Deberemos metrar la losa para saber las cantidades de mateiales que necesitamos.

Pedregullo 1.75 X 0.9 = 1.6m3Arena gruesa 1.75 X 0.6 = 1.05m3Cemento portland 1.75 X 7 = 12.25 (12 bolsas y 1/4)Alambre 1.75 X 2 = 3.5 kilosClavos de 2 pulgadas 1.75 X 2 = 3.5 kilosTablas 3.5 X 5 X 3 = 52.5 (53)Puntales 3.5 X 5 X 1 = 17.5 (18)

Observemos un ejemplo de una losa de hormigón armado.

Nuestra losa de 3,5 m. por 5 m. se encuentra apoyada en todos sus lados,dará lo mismo para el ejemplo que esté apoyada sobre vigas o carreras. La armare-mos con hierros tratados de 8 mm. en el sentido más corto de la losa y hierrotratado de 6 mm. en el largo. Colocaremos los de 8 mm. primero, para que quedenpor debajo de los de 6 mm.De cada 3 hierros uno irá doblado ( hierro tipo B), esto lo haremos en ambossentidos.

Tendremos entonces 35 varillas de 8 mm.de las cuales 12 irán levantadas en los bordes deapoyo de la losa. Tendremos 22 varillas de 6 mm.de las cuales 7 irán levantadas en sus extremos.Mediremos entonces cada tipo de varilla para saberla cantidad de hierro que debemos comprar.

Page 91: Credimat guia autoconstructor

Aberturas 18 - 1

El mercado nos permite elegir entre diversos tipos deaberturas, tanto en diseño como en material.

En cuanto a mater ial tenemos:Madera Requiere un mantenimiento de pinturaperiódico, hay que protegerla de los golpes espe-cialmente durante la obra, conviene colocar los mar-cos con una mano de aceite de linaza.

Aluminio No requiere mantenimiento, tiene queprotegerse del mortero durante su colocación, loharemos con vaselina, grasa o nylon.

Plástico (PVC) No requiere mantenimiento,hay que cuidarla siempre de los golpes.

Herrería común Están hechas con perfiles de hierro como ser "L" "T". Re-quiere mantenimiento de pintura periódica.

Carpintería metálica Hechas con perfiles especiales de hierro o también enchapa doblada. Requiere mantenimiento de pintura periódica.

Hormigón Se puede encontrar para vidrios fijos o con otros elementos incertosen distinto material para lograr movilidad de hojas. Las hay sólo de hormigón ocombinadas con otros materiales.

ABERTURAS

VENTANASY PUERTAS

¿CUAL ELEGIR?J . G . B A R C A L A

ABERTURAS

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

Page 92: Credimat guia autoconstructor

Aberturas 18 - 2

VENTANA BATIENTE: permite una ventilación total delhueco de la ventana. Se le puede colocar cualquier tipo deprotección exterior como ser cortina de enrollar, postigón,etc. Permite la limpieza fácil de los vidrios sin tener quesalir. Lo que se hace difícil es dejar una endija pequeñaabierta para invierno o días de lluvia.

VENTANA TABAQUERA: muy común en baños, per-mite una ventilación buena, ayuda a generar circulación deaire alta. Es posible colocarla fuera del alcance de la mano,ya que se la puede manejar a distancia por medio de uncomando a simplón. Como suele colocarse alta, se hacedifícil la limpieza de la cara exterior del vidrio.

VENTANA BALANCIN: permite un buen control de laventilación. Se puede mantener abierta aún estando llovien-do. Ayuda a generar una circulación de aire alta. Permiteuna fácil limpieza del vidrio. No es posible colocar cortinade enrollar, ni postigón de protección.

VENTANA CORREDIZA: permite un buen control de laventilación. Acepta cualquier tipo de protección. Permitehacer ventanas de grandes dimensiones de fácil solución.Pero el problema radica en que no se puede abrir más quela mitad de la ventana, aunque ambas hojas sean móviles.

VENTANA DE GUILLOTINA: permite una buena ven-tilación y control de la misma. Acepta cualquier tipo deprotección. Son de difícil limpieza, hay que limpiar unacara desde el exterior. Como en el caso de la corrediza, soloqueda abierta la mitad de la ventana.

VEAMOS ENTONCES ALGUNOS SISTEMAS DE VENTANAS

Page 93: Credimat guia autoconstructor

Aberturas 18 - 3

PUERTA BATIENTE COMUN: es la normal en todavivienda. Las hay para exterior (puerta de entrada), y deinteriores. Existe una gran gama de diseños y precios. Lasexteriores tienen que ser resistentes a la intemperie. Lashay de hoja derecha (si al empujar abren a la derecha), eizquierdas (si al empujar abren a la izquierda).

PUERTA CORREDIZA: La hoja de la puerta corre col-gada por una guía metálica. Sirve para aquellos lugares queno hay lugar para el movimiento de una hoja de puertanormal. Si la guía no está puesta entre dos muros, tendre-mos el problema de que no podremos recostar nada sobrela pared en el sitio que corre la hoja.

PUERTA VAIVEN: es una puerta de uso comunmenteinterior, salvo en locales públicos. Abre para cualquiera delos dos lados, no tiene tope. No es una puerta normal paravivienda, si no tiene buenos herrajes (bisagras de giro),termina golpeando contra el marco.

PUERTA PLEGABLE: son ideales para aquellos lugaresen que ni siquiera podemos poner las corredizas, ya quequedan en el mismo ancho del muro. La hoja se pliegacorriendo colgada de un riel. Son puertas interiores.

PUERTA PIVOTANTE: es una puerta típicamente exte-rior, el eje por el cual gira está alejado del borde de la hoja.No es común en viviendas unifamiliares.

VEAMOS ENTONCES ALGUNOS SISTEMAS DE PUERTAS

Page 94: Credimat guia autoconstructor

Aberturas 18 - 4

Cuando hablamos de unaventilación natural, el efecto deenfriamiento es consecuencia dela dirección y velocidad de la ráfa-ga de aire que cruza la casa.

Por supuesto, influye mu-cho que podamos proteger la ven-tana para evitar la entrada de sol(acero, cortina de enrollar, celo-cías, etc).

Para favorecer la circulaciónde aire en un local es convenientecolocar aberturas en lados opues-tos. Esto genera una ráfaga de airecruzada que en cierto grado pode-mos dirigirla según la ventana quese elija. Por ejemplo: una ventanatabaquera eleva la ráfaga de aire.

Si podemos regular la apertura de una ventana podremosregular la fuerza del aire que circula.NOTA

¿Cómo conviene ventilar,don Anastasio?

Page 95: Credimat guia autoconstructor

Aberturas 18 - 5

la al final para cuidar que el cemento o la cal no la ataquen. Lo mismo convendráhacer con el plástico y con las de perfiles de hierro.

MARCOS DE MADERA

Deberemos marcar sobre losmarcos el nivel donde estará el pisoterminado, como también 1 metro conrespecto a éste. Esta marca deberácoincidir con la que habrá en la obra.

VEAMOS COMO HACER EN OBRA

J.G.BARCALA

Los sitios donde van a irlas aberturas se deben

marcar en el cimientoantes de levantarlos muros. Lo ha-remos sobre una

capa de arena yportland.

De esa forma no coloca-remos pared donde va unapuerta.

Las aberturas pueden co-locarse a medida que se levan-ta el muro, o después, según eltipo de material con que estéconstruída. Por ejemplo, una dealuminio es prefererible amurar-

Page 96: Credimat guia autoconstructor

Aberturas 18 - 6

Marco tipotirante, ubicadoa plomo interior.

Marco tipo cajón,ocupa todo el

espesor del muro.

Cuando colocamos el marco en su lugar de-bemos considerar el futuro revoque o azu-lejo. Sólo así podrá quedar este en el mis-mo plano que el revoque.

NOTA IMPORTANTE

Si la pared está correctamenteaplomada:

Para un revoque de 2 capas, laprimera de mezcla gruesa y la últimade mezcla fina, consideraremos 1,5 cm.

Para un azulejo y su mortero de toma, consideraremos 3 cm.

¿Cuánto ocupa un revoque o unazulejo?

Debemos ubicar la parte inferiordel marco, lo alinearemos con el muropor medio de un hilo que pasará por losmontantes del marco. Si no se ha le-vantado la pared aún, este hilo tam-bién servirá para su replanteo .

Deberemos definir según el mar-co que tengamos la ubicación de éstedentro del espesor del muro.

Page 97: Credimat guia autoconstructor

Aberturas 18 - 7

¿COMO SE REPLANTEA UN PLANO DE REVOQUE?

De uno de los lados de la pared debemos colocarpróximo al techo un taquito de madera, amurado conmezcla gruesa cuya superficie diste de la pared una dis-tancia igual que el espesor del revoque.

Usando una plomada colocaremos próximo al pisootro taco de madera. Si se hace bien, los tacos quedaránexáctamente a igual distancia con respecto al muro.

Repetiremos este proceso del otro lado de la pared.Una vez colocados los cuatro tacos de madera, quedarádefinido el plano de terminación del revoque. Si tiramoshilos entre ellos podremos ubicar exactamente el marco.

Page 98: Credimat guia autoconstructor

Aberturas 18 - 8

Queda ahora nivelar elmarco con respecto a la mar-ca de 1 metro sobre el nivelde piso terminando. Deberáncoincidir ambas marcas, ladel marco y la de la pared.

Para lograr ésto nosaprovecharemos de cuñas demadera con las que levanta-remos el marco lo necesa-rio.

Nos queda nivelar el marco usando la plomada comoindica el dibujo. En ambas direcciones, para asegurarnosque quede bien aplomado.

NOTA: Jamás deberá sacarse las escuadras de un marcohasta que esté amurado.

Usaremos arena y cemento portland (3x1) para amu-rar el marco a la pared. Para lograrlo, éstos deberán tenergrapas (ganchos) que quedarán dentro del muro. Aseguran-do así una correcta adherencia.

Las hojas de las aberturas las deberemos colocar alfinal, pero antes que pintemos, para ya tenerlas

ajustadas.

HERRAMIENTAS

Page 99: Credimat guia autoconstructor

Revoques 19 - 1

REVOQUE EXTERIOR - 3 CAPASEste revoque se hace así:

1er Capa - Arena y cemento portland(3x1), con hidrófugo según indicacionesde fábrica. Esta capa es impermeable,evita que se moje la pared.Esta capa tiene que ser bien cuchareada(apretada con la cuchara), no puede que-dar ningún agujerito. Se termina con unaazotada de mezcla gruesa media líqui-da. Si ésta no se da, la siguiente capano agarrará. Esta azotada tiene que cu-brir la superficie completa, se da con lacuchara, salpicando la pared.

2da. Capa - Mezcla gruesa más ce-mento portland (5 partes de mezcla más

1/2 parte de cemento portland). Si lapared está bien, con 1 cm. de gruesaserá suficiente. Se aplica con cuchara deabajo hacia arriba. Comenzaremos por laparte alta del muro. Se emparejará conla regla (madera derecha o perfil de alu-minio), y de ser necesario con fratachode madera.

3ra. Capa - Mezcla fina y cemento por-tland (1/2 de cemento). Esta capa es laterminación, se fratacha para dar unasuperficie lisa. Se puede variar, para lo-grar distintos efectos estéticos. Puededarse un balai (queda a pinchitos), etc,etc.

Los revoques más comunes son los quese usan para exteriores e interiores.

Dependiendo del tipo de revoque, encon-traremos variación en sus capas.

REVOQUES

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

VAMOS AREVOCAR

J.G.BARCALA

Page 100: Credimat guia autoconstructor

Revoques 19 - 2

Está constituído por dos capas, una primera con mezcla gruesa y otra con fina;la diferencia con los revoques para exteriores es que carecen de la capa hidrófuga, yque la fina usa menos cemento portland (1/4 de cemento).

Para hacer una faja colocaremos un taquitode madera próximo al techo, éste tendrá la alturadel espesor de la capa gruesa de revoque. Esteespesor dependerá de que tan a plomo esté la pa-red; cuanto más perfecta la hayamos levantado,más fina será la capa de revoque.

Si la pared está muy torcida deberemos ircargándola con mezcla de a poquito, para que nose raje y desprenda. Que los muros queden fuerade plomo genera un gasto de mezcla innecesario,y una pérdida de tiempo importante muchas veceses necesario aplacar cascotes de ladrillo o ticholospara cubrir las imperfecciones.

RECORDEMOS:

Primero deberemos hacer dosfajas de revoque verticales. Estas 2rectas conformarán un plano de revo-que.

REVOQUE INTERIOR - 2 CAPAS

¿Don Anastasio, los revoques lo vamos areplantear como hicimos cunado vimos las

aberturas?

Page 101: Credimat guia autoconstructor

Revoques 19 - 3

Para poder revocar una pared,hay que mojarla previamente. Esoevitará que se chupe el agua de lamezcla y ésta termine cayendo. Lapared no debe quedar chorreando, esbueno mojarla con una pinceleta.

Deberemos ir cargando el muro de abajo para arriba, de forma que la mezclaya aplicada de apoyo a la que vayamos a colocar. Pero cubriremos el muro comen-zando por la parte de arriba, de modo de no estropear el trabajo realizado.

Una vez cargada la pared entrelas 2 fajas, pasaremos una reglapor ellas en forma de zig-zag (con-viene en posición inclinada). El re-voque que vaya quedando lo harásiempre con el mismo espesor (elque hemos dado a las fajas).

El material que sobre con elpaso de la regla lo devolveremos albalde.

Arrojar mezcla sobre la paredgenera un desperdicio importante,

ya que cae bastante al suelo. Si colocamos antes una tabla en el piso contra el muro,podremos recuperar buena parte de éste.

Para pegar la mezcla a la pared hayque arrojarla con la cuchara de una dis-tancia muy cercana; para ello usaremosun giro de muñeca.

Page 102: Credimat guia autoconstructor

Revoques 19 - 4

FORMA DE MOVER ELFRATACHO

FORMA DE APLICAR LAMEZCLA CON LA CUCHARA

Y con la fina, DonAnastasio, ¿cómo

hacemos?

La colocaremos sobre lagruesa una vez que éstahaya secado.

Comenzaremos de lo alto de lapared, hacia abajo para no estropear loya hecho, aunque la aplicaremos deabajo para arriba. Esta última capa derevoque habrá de ser fina (1/2 cm.), ydeberemos fratacharla para que quedelisa y pareja, sin ondulaciones.Para comprobar que esté quedando bienpodemos usar una luz rasante. Si laúltima fratachada la hacemos con unaesponja mejoraremos su terminación.

Antes de comenzar tenemos que mojar nuevamente la pared. Deberemosaplicar la mezcla fina por medio de la cuchara (sin arrojarla), lo haremos conla parte de abajo de ésta. Para ayudarnos usaremos el fratacho para sosteneruna cantidad de mezcla como para 2, 3 o 4 cucharadas de material.

Page 103: Credimat guia autoconstructor

Revoques 19 - 5

Es mucho más fácil dar vueltas a lamanibela de la máquina, la que podemos con-seguir en cualquier barraca, pinturería oferretería.

El Balai se puede aplicar sobre una capade mezcla gruesa, también podemos proyec-tarlo directamente sobre el ladrillo o bloque.Es muy común su uso en exteriores.

Otra versión que puede ser más ade-cuada para muros interiores es la de planchar con una llana las puntitas dejadas porel Balai.

Otra posibilidad un tanto más rústica que la anterior podría ser el dar unaazotada de revoque para luego plancharla por medio de regla y fratacho.

BALAI

El Balai puede hacerse a mano o a máquina. En forma manual, tendremosque mojar una pinceleta con mezcla (fina o gruesa), y cemento portland. Próximoa la pared procederemos a golpearla contra un palo, proyectando de esa forma elmortero.

No es necesario quedarnos con una paredlisa, hay otras terminaciones.

Page 104: Credimat guia autoconstructor

Revoques 19 - 6

REVOQUE A LA BOLSAEste tipo de revoque suele usarse sobre una base de ladrillo, permite que la

forma de éstos sea vista.Para su ejecución basta con pasar un trapo sobre el muro recién hecho, exten-

diendo el mortero sobrante de las juntas (por lo que no hay que retirarlo cuando secolocan los ladrillos).

Este tipo de revoquees económico y rápido dehacer, pero es totalemterústico.

Todo revoque conmucha rugosidad es másadecuado para exterioresque para interiores, yaque acumula mucho pol-vo.

GRUESA FRETACHADA CONTERMINACION EN CAL EN PASTA

Este tipo de revoque evita la capa demezcla fina. Ha de fratacharse bien la superfi-cie de la capa de mortero grueso. Sobre ellaaplicaremos cal en pasta por medio de una lla-na.

La cal tapará los poros dejados por la are-na gruesa de la mezcla y la superficie resultan-te será algo parecido a una superficie enduída(no tan perfecta).

Page 105: Credimat guia autoconstructor

Revoques 19 - 7

ALGUNAS COSAS PARA TOMAR EN CUENTA.

Todo caño de hierro habrá que protegerlo con arena y cemento portland, ya quela cal los deteriora, los de plomo los cubriremos con papel o nylon.

Se debe recordar retirar los bolines antes de aplicar la capa de revoque fina.

La segunda capa de revoque fina se puede aplicar cuando la capa de revoquegruesa haya secado un poco.

Si tenemos una superficie de hormigón deberemos dar una azotada de arena ycemento portland chirla (3x1 - 4x1), para obtener así una pared rugosa donde poderprender el revoque.

La aplicación de un mortero de mezcla o arena y cemento portland ha de ser confirmeza, para que no caiga.

Colocar los bolines próximos al techo y a un mismo nivel nos permitirá replantearel revoque del techo. Para ello colocamos los bolines de ambos extremos del muro ycon un hilo replanteamos los otros intermedios.

Las fajas no podrán se hechas hasta que no haya endurecido el mortero de losbolines, y no podremos cargar entre fajas hasta que éstas no hayan endurecido (parapoder pasar la regla correctamente).

Si va a pasar tiempo entre una capa y otra de revoque conviene peinar la mezclapara dar adherencia a la capa.

Toda superficie a la que se le vaya a proyectar un mortero, ha de estar libre depolvo.

A la capa de mezcla fina conviene humedecerla para que no raje el material yseque parejo. Si se quiere una terminación bien lisa se usará una llana (fratachometálico).

Antes de comenzar a revocar, tenemos quehaber colocado los caños de eléctrica, sanitaria, etc.Como así los tacos de madera para la colocación dezócalos, de ésta forma evitaremos los parches.

Page 106: Credimat guia autoconstructor

Revoques 19 - 8

HERRAMIENTAS

REVOQUE INTERIOR 2 CAPAS

0,02 = m3 de mezcla gruesa0,005 = m3 de mezcla fina3 = kilos de cemento porltandX

Metros cuadradosde muro interior

a revocar

REVOQUE EXTERIOR CON HIDROFUGO 3 CAPAS

0,02 = m3 de mezcla gruesa0,005 = m3 de mezcla fina7,5 = kilos de cemento porltand0,01 = m3 de arena gruesa0,2 = litros de hidrófugo

Metros cuadradosde muro exterior

a revocarX

Debemos hallar las áreas totales de las paredes que tenemos que revocar. Paraello haremos en todas ellas: ancho altura . Sumaremos todas las superficiespara multiplicar luego por los valores de las tablas de más abajo.

x

VEAMOS LAS CANTIDADES DE MATERIALES QUENECESITAMOS

Page 107: Credimat guia autoconstructor

Azulejos 20 - 1

Colocaremos ahora 2 pendicolas (alambresatados a 2 puntas), que deberán estar bien aplo-madas y deberán rozar la superficie de los azu-lejos.

Podremos ahora atar un hilo a 2 ganchitoshechos con alambre. Este hilo lo haremos correrpor los alambres, definiendo el plano de la paredterminada, o sea la superficie exterior del azulejoo cerámica.

Si lo ponemos horizontal tendremos elcontrol de cada hilada.

HABLEMOS DELOS AZULEJOS

El método nosservirá para cualquier

cerámica

Colocar cerámica o azulejo es caro, por eso es conveniente usarlo en lugares donde hayamucha humedad y tenga posibilidades de mancharse (baños, cocinas, lavaderos).

J . G . B A R C A L A

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

AZULEJOS

R E P L A N T E O

Para que el azulejo quede bien, es conve-niente comenzar replanteando el plano de la paredterminada. Lo haremos tal como lo hicimos conlos revoques.

Deberemos definir 4 puntos, los que po-drán ser hechos aprovechando un azulejo ya quenos dará el espacio necesario para azulejar.

Page 108: Credimat guia autoconstructor

Azulejos 20 - 2

Este método permite colocar el piso por debajodel azulejo. Una vez colocado el pavimento podremospegar la primera hilada de azulejos.

Para colocar una cerámica o azulejo es necesa-rio sumergirlo previamente en agua por unbuen rato.

Tomando un azulejo con la mano co-locaremos el mortero hecho en base a mez-cla fina (6) y cemento portland (1) en laparte de atrás de éste. Lo haremos con lacuchara.

Lo ubicaremos sobre la madera ajus-tándolo contra la pared. Terminaremos el procedimiento con unos golpecitos delmango de la cuchara. Seguiremos así hasta terminar la hilada. El hilo nos ayudaráa que todos los azulejos se mantengan en el mismo plano, pero de igual formadebemos ir controlando la verticalidad con plomada o nivel de burbuja. Deberemos

No conviene colocar la primer hila-da de azulejos si no tenemos hecho elpiso. Por esa razón se suele ubicar unatabla o regla, cuya superficie superiorcoincida con el inicio del segundo azule-jo. Esta regla servirá de apoyo a la segun-da hilada.

cuidar expresamente que no queden dien-tes, ya que la diferencia aumentará conlas siguientes hiladas de azulejos.

Hay que cuidar de que el materialquede distribuído en forma pareja portodo el azulejo. Si no es así, una vezcolocados, si reciben un golpe puedenromperse.

NO

Page 109: Credimat guia autoconstructor

Azulejos 20 - 3

¿QUE MATERIALES NECESITAMOS?

1 =m2 de azulejo o cerámica (45 azulejos) 0,03 =m3 de mezcla fina 3 =kilos de cemento portland gris 0,5 =kilos de cemento porrtland blanco 0,05 =kilos de carbonato o tierra de color

Superficietotal en m2 x

Debemos metrar las paredes tal comohicimos en el momento que trabajamos conlos revoques.

Mediremos entonces ancho y altura has-ta donde vamos a revestir las paredes. En-

contraremos el área de cada una ( area = ancho x alto ) yterminamos hallando el área total al sumar todas las pare-des.

Multiplicaremos esa superficie total, por los valoresabajo indicados para obtener los materiales necesarios.

Como es difícil que entre unnúmero entero de azulejos en

una pared, hay que pensar dondequeremos que queden los cortes.

Una vez terminada una pared iremos ala otra, repitiendo el procedimiento.Por último haremos la lechada, que ter-

minará cubriendo las juntas de los azulejos. Esta capase hace con cemento portland blanco y carbonato (en

el caso de cerámica o azulejo blanco). Al cemento portland le agregamos tierrade color para aquellos azulejos o cerámicas de color. El agregado que le ponga-mos al cemento no podrá exceder el 50 % (mitad y mitad).

Page 110: Credimat guia autoconstructor

����������� �����

��������� ���������� � ��� ��������� ��� ����� ������ ������������ �������������������

���������������������������� ���������� ������ �� � ���������� �� ��������� �� � �������

���� �������� ����� ������� ���� ��������� ��� ������� ��� � ��� � ����

�� ������ � �� ��������� �!" ���������#����������� ��$��� !���� ���� ������� ��

�����������������$������%� ������������������������������������&���������� ����������%� � ����� ������ ��������� �� !����

'�� �� � �� �� ��� ����

�� ���� ��� ������� �� ������ � #������� ��� ����� ��������� $������ �

(����� � �� ����� ����������"��� ���& ���$������� �������� ���� ��� ��� �� ��� ��� ���"�� �������� ���������� $�� ������������)��

��������

�������� � �� � �� ���� � ���� ������������� � � ���� �������

��������

� � � � � � � � � �

Page 111: Credimat guia autoconstructor

����������� ����

���������� � � �������

*������������� �� ������ �� ������ � �� ����� ������ �����+���� �,����������� �� ���� -%� �� ���� ��� ����� ��������

(������ � �� ��������� ����������������������������� � �� ������ ������������� � � ��������"� ������ ��

(������ � �� ��������������������� ������� � ����� ������� %� � ���&������������������ ������ ������������������������������������� ������� �� ���!����� ����������

�������� � ����� ������� ���� ���������������%���#����������� �����#���&������ %

�� � �� � ������� � ���������� � �� $���

������������� ������#����������������� �%� �������� � !" � ���������

*� � �� � � ������� ����� �� ���� �� ����� � ���� � ��� ���� %� $�� � �������� ������� � �� ����� ���� �

�$�������������������� ��������� � ������&��������������%���#�������&

� �"��� ��*����� �����������������������������������,����"�������-%������� ���������������������� ,����"���������-�

�������������������������������� �����

��������������������������������������������������������������������� ������ ��� ������

Page 112: Credimat guia autoconstructor

����������� �����

.��� ���������$�������� ������ ���������� �������� �������

����� ��� ��������� ���������

(����� ������ � ���!���� �,�����������-%������ ������ �#����$��������� ��� ���$������������������ ����� ���! �����"������������� �������� � � �� ���� � �������� � ��������� �

������� ���������

� � � � �/ 0���� ��� ���� � � � �1%1+2�0������������� !���� � �2 0����� � ��� �������

�� ��

������� �� ����� ���������

� � � � �1%13 0��� ��������� � � � �/2 0����� � ��� �������

������� �� ��������

� � � � �/ 0���� ��� ���� �� � �1%1+2 0���������������� �� � �2 0����� � ��� �������

��

��� ������� �� ��������������� ����� �� ���� ��� ������ �������4�2����5�/�������

������������

��� �

�� ���� ��� ����� ��� �$������� � � � ���$����������"������������ ���������� ��� �&���������� ����� � ���"�� ���� ���� ��� ��� �� ���� ����� ����� 6��� ������ �� ������

*� ��� �� ������� �� ������ ��������� �� ���3� ���� �� ����� �� �� ���!�������� ����������������#� � ��� �� �� ���#����� ��7�� ������������� ������ ����� �� ���� ��� ����� �� ���%� ���� �� �� ��� ������ �� ��� �������)�� ���������� ������� �� ����

Page 113: Credimat guia autoconstructor

Agua corriente 22 - 1

consultar con los vecinos para saber sitienen problemas con el suministro, comoquedarse sin agua o con poca agua en lacanilla en determinada hora del día.

A toda rosca deberemosponerle cinta de teflón o cáña-mo, los que enrollaremos ensentido contrario a la rosca,para que no se salga, eso evi-

tará que se escape el agua.

IMPORTANTE

El agua queentrega O.S.E.

no tiene lamisma presiónen todos lados.

Es conveniente

Si existe ese pro-blema conviene

poner untanque de

agua.

Comenzaremospróximo a la lí-nea del prediocon un trozo de

cañito (niple), al que le colocaremos unallave de paso. Ahí será donde O.S.E.conectará el contador.

Continuaremos enroscando uncaño de 1/2 pulgada a la llave de pasopara luego colocar una canilla.

Veamos una instalación usual (de1/2 pulgada) en viviendas, en que lapresión es correcta sin necesidad decolocar un tanque de agua.

J . G . B A R C A L A

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

AGUACORRIENTE

Hablaremos sobre las insta-laciones en plástico, pues sonfáciles de realizar ya que norequieren de herramientascomplicadas ni caras.

Hablaremos sobre las insta-laciones en plástico, pues sonfáciles de realizar ya que norequieren de herramientascomplicadas ni caras.

Page 114: Credimat guia autoconstructor

Agua corriente 22 - 2

Cuando trabajemos en plástico usa-remos una terraja y la mano. Se in-serta la punta del caño sin rebarbaspor detrás, en una guía que debe serdel mismo tamaño que el caño.

Sosteniendo firmemente el caño,se comienza a girar la terraja en el

sentido que van las agujas del reloj.Una vez que el caño aparezca sobresaliendode la terraja. Giraremos en el otro sentidopara desenroscarlo. Si no podemos sostener el caño conla mano, es buena idea usar una pinza pico de loro.

¿Cómo hagola rosca?

Codo: para los cambios dedirección en ángulo recto.

Te: para hacer una salidaintermedia (continuar otracañería a otro sitio en án-gulo recto).

Cupla: para hacer una ex-tensión de un caño.

Niple: trozo de caño conrosca en ambos extremos.

Llave de paso: sirve paracortar el paso del agua poruna cañería, la colocaremos

inmediatamente después del contadorde agua, antes de un calefón, etc.

Buje o Cupla de reduc-ción: sirve para reducir detamaño de caño. Por ejem-

plo bajar de 3/4 pulgadas a media

Entrerrosca con o sintuerca: sirve para unir delelementos con rosca hem-bra.

Colilla: sirve para conec-tar los aparatos sanitarios ala cañería. Los extremos

Tapón macho o hembra:para tapar una cañería.

pueden ser machos o hembra.

Unión doble: cuando ve-nimos con 2 caños ya ins-talados y tenemos que

unirlos usamos una doble unión.Cruz: sirve para tener 3salidas de caños en distin-tas direcciones. Nos pue-de servir para armar unagrifería para bañera.

PIEZAS COMUNES EN UNA INSTALACION

Page 115: Credimat guia autoconstructor

Agua corriente 22 - 3

Veamos algunos detalles decomo se hace una instalaciónde agua y que elementos la

componen.

Se puede comprar la grifería queviene con un block mezclador con lasllaves laterales ya incorporadas.

Es necesario colocar una llave depaso en la conexión del calefón con elagua fría para poder cortar el ingresode la misma si hay problemas con éste.

NOTA: Si se llega a trabajr concaño de hierro galvanizado, es conve-niente separar el de caliente con el defría en unos 15 cm.

C A L E F O N

DUCHERO

Page 116: Credimat guia autoconstructor

Agua corriente 22 - 4

Para una vivienda de 2 dormitoriosno deberemos tener un tanque menor a500 lt. (lo adecuado sería uno de750 lt.).

Si necesitamos un tanque de aguagrande, más cómodo será dividirlo en 2chicos ya que podremos limpiar unomientras funciona el otro. Es más livianomover los 2 que uno grande.

Las tapas de los tanques de aguadeben ser aseguradas para que no laslevante el viento.

Para tener una buena presión de-beremos levantar el tanque de agua por

lo menos 2 mt. con respecto a la sa-lida del duchero (cuanto más altura esmejor).

Hacer la salida de agua por elcostado, a unos 10 cm del fondo. Per-mite que el contenido de polvo quehay en el agua decante en el fondo ypase en monor grado a la cañería.

Si la salida se hace por debajohabrá que dejar elevado el tanque porlo menos unos 50 cm para poder tra-bajar comodamente.

Los tanques hay que limpiarlosuna vez por año, por decreto municipal.

Page 117: Credimat guia autoconstructor

Agua corriente 22 - 5

Veamos una vivienda para desarrollarun ejemplo de instalación

de agua.

Para poder ver el desarrollo de las cañerías hemos realizado algunos murostransparentes en este ejemplo sencillo y económico podemos localizar las distintaspiezas que ya hemos visto (te, codos, llaves de paso, etc).

HERRAMIENTAS

Si hacemos unaentrada independiente parael baño y otra para la coci-na, podemos colocar unallave de paso que nos per-mita cortar el suministro deagua en el baño sin perderel correspondiente al de lacocina. Esto genera un pe-queño aumento de costopero nos permite tener siem-pre agua dentro de la casa.

Page 118: Credimat guia autoconstructor

Desagües 23 - 1

MINISTERIO DE VIVIENDA, ORDENAMIENTO TERRITORIAL Y MEDIO AMBIENTE

:

DESAGÜES

MINISTER IO DE V IV IENDA , ORDENAMIENTOTERRITORIAL Y MEDIO AMBIENTE

Los desagües secundarios se deben conectar a los de primarios a través de elementos con sifón.

PRIMARIOS:Son los que desagüan

LOS DESAGÜES SE DIVIDEN EN:SECUNDARIOS:

Carlitos, ... para que una instalación de sanitaria seaaceptada en una intendencia, hay que conseguir

firma de un técnico sanitario.

J . G . B A R C A L A

Page 119: Credimat guia autoconstructor

Desagües 23 - 2

codo de 90 gradosdiámetro 40 mm

caño diámetro 40 mm

codo a 45 gradosdiámetro 40 mm

caño 110mm

Codo 90 grados, diámetro 110mm,con 3 entradas en un diámetro de63mm. para poder conectar lasalida de la caja sifonada.Esas entradas vienen tapadas,hay que romper la tapa de laque se va a usar (conviene golpearde adentro del codo hacia afuera).

Los receptáculospara ducheros, vienen

con tapa rejilla, ypueden ser con salida

horizontal o salida vertical.

Desagüede lavatorio

Desagüede inodoro

Desagüede duchero

Caja sifonada, separa losdesagües secundarios de los

primarios. Sirve para desaguar pisos o duchero dependiendo

donde se ubique, viene contapa rejilla.

A cámarade inspección

Existen en el mercado varios materiales para ser usados en unainstalación sanitaria. Hemos elegido sin embargo para describir elPVC, ya que es de fácil utilización.

VEAMOS UN EJEMPLO DE DESAGÜESDE UN BAÑO

Desagüe de bide

Desagüe delavado de piso

Page 120: Credimat guia autoconstructor

Desagües 23 - 3

I M P O R T A N T E

VEAMOS AHORA DONDE TERMINA ESTE BAÑO

La profundidad del colector hay que preguntarla en la Intendencia de Montevideo u OSE en el restodel país. Con el proyecto en mano habrá que calcular, tomando en cuenta las pendientes la altura finalde la instalación. Eso determinará si nos da la profundidad de conexión o tendremos que subir el baño.

Page 121: Credimat guia autoconstructor

Desagües 23 - 4

ALGUNAS ANOTACIONES Las cañerías principales no podrán ir pordentro de un muro medianero.

Deberá ventilarse la cañería principal, co-locando una rejilla de 10 x 10 cm. en la partemás baja y un caño con sombrerete en la partemás alta.

Habrá que poder acceder a los caños através de cámaras de inspección cada vez que:

1- Cambiemos de dirección2- Unamos 2 o más caños3- Conectemos con red cloacal o pozo negro4- Tengamos 25 m de caño5- Cambiemos de material de caños

Las cañerías principales ubicadas en el suelo podrán llevar una pendiente queoscile entre 2 a 5 cm., cada metro de longitud (2% a 5%). Las cañerías secundariaspodrán llevar una pendiente de 1 cm. cada metro, al igual que aquellas cañerías quesólo lleven agua de lluvia.

Conviene siempre, tener definido el nivel del piso terminado para no equivocar-se con las pendientes.

Las cámaras de inspección sirven paraacceder a las cañerías. Las hay de ladrillos,hormigón y PVC.

Para uso doméstico, las cámaras podránhacerse con muros de 15 cm, ya que tendránprofundidades menores a 2 m.

Sus paredes irán revestidas de arena ycemento portland en una relación de 2 partesde arena más 1 de cemento portland y se ter-minará con portland lustrado.

Es conveniente saber la pro-fundidad de conección con elcolector si es que lo hay.

La distancia máxima entreun inodoro y una cámara de ins-pección es de 10 metros.

CAMARAS DE INSPECCION

Page 122: Credimat guia autoconstructor

Desagües 23 - 5

Podemos hacer unpozo negro o unafosa séptica.

POZO NEGRO

Los pozos negros habrán de contruir-se sólidamente, podrán ser hechos de la-drillo, hormigón, piedra, etc.

Deberán ser ubicados con preferen-cia en los espacios libres próximos a la víapública para facilitar el vaciado por el ca-mión barométrico. Está prohibido contruirloa menos de 1 m. de las medianeras, amenos de 5 m. de los aljibes y a menosde 10 metros de los pozos manantiales.

Tampoco podrán ubicarse bajo las habi-taciones.

La capacidad mínima será de 5 m3

hasta el nivel en que desagua en él elcaño de 100mm que viene de la cámarade inspección. Podrán ser cilíndricos oprismáticos. Veremos aquí uno cilíndri-co mínimo, hecho en ladrillo.

Los ladrillos deberán ser de prime-ra calidad y serán levantados con un

mortero compuesto de1 parte de cementoportland y 4 de arenagruesa.

Interiormenteirá revocado con arenay cemento portland,(2 de arena más 1 decemento), llevará unaterminación en cemen-to portland lustrado.

¿Qué hago si no hay colector?

Page 123: Credimat guia autoconstructor

Desagües 23 - 6

Hay que replantear la ubicación de los artefactos sanitarios. Comenzaremos lainstalación, a partir del codo del inodoro al que se unirá luego todo lo demás . La bocadel codo tiene que estar bien horizontal.

Antes de comenzar a pegar conviene tener toda la instalación hecha y puestaen su sitio. Si hay que perforar la pared para que pase el caño de 100mm, habrá quehacerlo en este momento.

Todo corte de caño deberá hacerse derecho, o sea perpendicular al eje del caño.Conviene usar un cajón guía para ello. Hay que sacarle las rebarbas que queden yemparejar el borde con la escofina.

Es conveniente tener el suelo límpio y con unacapa de arena gruesa esparcida para asentar los cañossin dañarlos.

OTRAS ANOTACIONESPERO SOBRE LOS

CAÑOS DE PVC

Para trabajar con ca-ños de plástico requeriremos:-una sierra para metal-un pincel de 1/2 pulgada-papel de lija N01-una escofina o lima.

Para poner el adhesivo, habrá que lijar lassuperficies del caño hasta que pierda el birllo.

El adhesivo se pondrá con el pincel, en lassuperficies ya lijadas. Se hará pasándolo en for-ma longitudinal.

Una vez introducido el caño, no deberá gi-rárselo, ya que podría no pegarse.

No deje que los caños al sol, porque losdaña.

Los golpes pueden dañar las piezas de PVC, tanto cuando las bajamos del camióncomo cuando ya están instaladas. Conviene antes de taparla hacer una pruebade agua a la instalación para ver si pierde.

HERRAMIENTAS