Biokimia Sel

download Biokimia Sel

of 31

  • date post

    03-Jan-2016
  • Category

    Documents

  • view

    26
  • download

    2

Embed Size (px)

description

biokomia

Transcript of Biokimia Sel

  • BIOKIMIA SELKOMPONEN-KOMPONEN KIMIA SEL

  • Atom = unit yang paling kecil dari suatu unsur Contoh : atom C, atau H, atau O, dll.Element = substansi yang tidak bisa dipecah ke dalam unsur lebih sederhana. Contoh adalah 5O2, atau O2, atau H2, dll. Catatan masing-masing hanya satu jenis Compound (campuran) = dua atau lebih unsur-unsur kombinasi secara kimiawi. ( Mempunyai 2 atau lebih unsur) Air- H2O- adalah suatu campuran terdiri dari H& O. Molecule = unit yang paling kecil kebanyakan campuranContoh adalah gula C6H12O6, air H2O dll.C6H12O6 dan H2O adalah campuran. O2 dan H2 bukan campuran.

  • Sel merupakan dasar dari suatu bangunan yang hidup.Sel terbuat dari bahan kimia berupa susunan elemen.Bagaimana bahan kimia dapat berfungsi dalam kehidupan

  • Sebuah sel hidup tersusun oleh sejumlah unsur yang terbatas, empat diantaranya C, H, N, dan O yang menyusun dari 99 % dari berat sel59% Hydrogen (H) 24% Oxygen (O) 11% Carbon (C) 4% Nitrogen (N) 2% Lainnya - Phosphorus (P), Sulphur (S), dll.

  • H dan O (air) paling banyak terdapat di dalam sel (sekitar 70 %), merupakan medium untuk reaksi di dalam selKarbon (C ), sangat dominan terdapat di dalam selEmpat jenis molekul kecil yang pokok di dalam sel yaitu merupakan kombinasi dari atom sederhana, membentuk :gugus metil (-CH3), hidroksil (-OH), karboksil (-COOH), dan asam amino (-NH2), selalu muncul berulang dalam molekul biolologi

  • Makromolekul dalam selEmpat unsur organik pokok dalam makhluk hidup:1. Proteins (50 %)2. Carbohydrates (15 %)3. Lipids (10 %)4. Nucleic Acids (15 %)Dan unsur lain

  • 1. ProteinSecara garis besar dibedakan dua kelompok :protein globuler protein serabut (fibrous protein). Kebanyakan enzim merupakan protein globuler. Protein serabut merupakan protein struktural yang penting, misalnya fibroin pada sutera dan keratin pada rambut dan bulu domba.

  • 1. ProteinBeberapa protein berikatan :Dengan materi nonprotein, dalam bentuk gugus prostetik (bekerja sebagai kofaktor enzim)Dengan molekul berukuran besar seperti lipoprotein (dengan lemak)glikoprotein (dengan karbohidrat).

  • 1. ProteinProtein tersusun dari sejumlah asam amino yang satu sama lain dihubungkan secara kovalen oleh ikatan peptida. Terdapat 20 macam asam amino, tetapi sel tersusun dari kombinasi merekaAsam amino dapat menyusun ribuan macam protein yang berbeda.Tiap polipeptida biasanya terdiri atas 100 hingga 1.500 asam amino.

  • 1. ProteinAsam-asam amino secara kimia berbeda-beda, namun semua memiliki sebuah gugus asam karboksilat (COO-), dan sebuah gugus amino (NH3)

  • 1. ProteinKegunaan proteins : hampir semua jaringan tubuh disusun oleh proteinOtotmembran sel dan sebagian besar organelEnzim dan hormon dll

  • FeathersFeathersMuscles

  • 2. Karbohidrat karbohidrat (Gula) dalam bentuk sederhana adalah monosakarida, mempunyai senyawa dengan rumus umum (CH2O)n, dengan n sebuah bilangan bulat dari 3 hingga 7. Gula dalam bentuk terbuka mempunyai sejumlah gugus hidroksil yang dapat berikatan dengan molekul gula yang lain melalui ikatan glikosidik membentuk disakarida Dengan cara yang sama akan terbentuk oligisakarida (trisakarida, tetrasakarida dst.), pada akhirnya terbentuk molekul polisakarida yang besar dengan ribuan unit monosakarida

  • 2. Karbohidrat Gula merupakan sumber energi bagi kebanyakan sel

    Contoh reaksi C6H12O6 (heksosa), menjadi CO2 dan H2O

    C6H12O6 + 6O2 6CO2 + 6H2O + energi

    Energi yang dihasilkan dari reaksi ini disimpan dalam bentuk molekul yang sangat penting yaitu ATP atau NADH

    Molekul polisakarida sederhana pada sel-sel hewan disimpan dalam bentuk glikogen.

    Sedangkan pada tumbuh-tumbuhan disimpan dalam bentuk amilum (pati)

  • 2. KarbohidratMolekul polisakarida sederhana yang terdapat di luar sel hewan terikat secara kovalen :dengan protein membentuk glikoprotein, dengan lipid membentuk glikolipid.

    Pada tumbuh-tumbuhan sangat penting untuk membentuk selulose merupakan komponen utama penyusun struktur dinding sel.

  • 3. Lipid3. Lipid = fats, oils, & waxes, Merupakan energi yang, tersusun dari C, H, Olipid mengandung lebih banyak energi daripada karbohidrat.Cadangan energi dari lipid digunakan pada waktu tertentu.

  • 3. Lipid Lemak terdiri atas 4 bagian : 1 molekul gliserol 3 molekul asam lemak Sebuah molekul asam lemak terdiri dari dua bagian yang berlawanan Rantai hidrokarbon panjang, bersifat hidrofobik (nonpolar/tidak larut dalam air)Sebuah gugus asam karboksilat, yang terionisasi dalam larutan (COO), bersifat hidrofilik (polar/larut dalam air), mudah membentuk ester maupun amida

    Asam lemak merupakan sumber energi yang lebih baik dibandingkan dengan glukosa karena dapat diuraikan menghasilkan energi hampir dua kali lipat

  • 3. LipidMolekul asam lemak mengandung 4 sampai 24 atom karbon

    Beberapa molekul asam lemak mempunyai satu atau lebih ikatan ganda antara atom karbon -> lemak tidak jenuh

    asam lemak tak jenuh lebih mudah mengikat atom hidrogen sehingga dalam suhu kamar berbentuk cair -> disebut minyak (lemak pada tanaman)

    Pada hewan asam lemak tidak mempunyai ikatan rangkap berupa butiran-butiran molekul trigliserid, yang tersusun dalam 3 rantai asam lemak yang masing-masing mengikat molekul gliserol (berbentuk padat dalam suhu kamar)

  • 3. Lipid Apabila dibutuhkan, rantai asam lemak tersebut dilepaskan dari trigliserid dan diuraikan menjadi unit-unit karbon ganda berupa gugus asetil dalam molekul yang larut air (asetil CoA) Asetil CoA, melalui beberapa reaksi di dalam sel menghasilkan energi. Fungsi asam lemak yang paling penting adalah pembentuk membran sel yang tersusun dalam bentuk fosfolipid

  • Asam Nukleat Pada organisme hidup terdapat 2 golongan besar asam nukleat Asam deoksiribonukleat (DNA) Asam ribonukleat (RNA)

    Asam nukleat dapat dipecah menjadi monomer -> disebut nukleotida

    Nukleotida berperan penting dalam menyimpan informasi biologi (informasi genetika)

    Nukleotida merupakan senyawa bentuk cincin yang mengandung 3 unsur yaitu gula, nitrogen, dan pospat

  • 4. Asam Nukleat1. gula -> berkarbon 5 (pentosa) 2 jenis gula pada RNA berbentuk ribosa gula pada DNA berbentuk deoksiribosa

    2. nitrogen -> basa nitrogen basa DNA : adenin dan guanin (mempunyai cincin ganda basa purin), timin dan sitosin (mempunyai cincin tunggal basa pirimidin basa RNA: adenin, guanin, sitosin, dan urasil (urasil masuk basa pirimidin pengganti timin) Basa-basa dalam asam nukleat saling berpasangan: G berpasangan dengan C, A berpasangan dengan T atau U

  • 3. Gugus fosfat DNA maupun RNA dibentuk oleh nukleotida trifosfat fosfat pada DNA dATP, dCTP, dGTP, dan dTTP fosfat pada RNA ATP, CTP, GTP, dan UTP

    Nukleotida dapat bertindak sebagai pembawa energi kimia di dalam sel, yang banyak diperankan oleh ATP Nukleotida berperan penting dalam menyimpan informasi biologi (informasi genetika)

  • Alur informasi dari DNA ke RNA sampai protein adalah salah satu dari prinsip pokok dari biologi molekul disebut "dogma sentral."

    CCTGAGCCAACTATTGATGAAPEPTIDECCUGAGCCAACUAUUGAUGAACentral Dogma: DNA -> RNA -> Protein

  • Tata nama nukleosida dan mono, di dan trifosfatnya

  • Fig. 13.2, p. 215DNA

  • AirAir:Penyusun 2/3 dari tubuh.Diperlukan untuk reaksi kimia di dalam sel.Menjaga sel dalam ukuran dan bentuknya.Membantu dalam homeostasis, menjaga perubahan temperatur tubuh.Air merupakan bahan yang paling banyak terdapat di dalam sel (sekitar 90 %), merupakan medium untuk reaksi di dalam sel di dalam sitoplasma terdapat unsur yang terbatas, empat diantaranya C, H, N, dan O yang menyusun dari 99 % dari berat sel

  • Here is a list of Elements, symbols, weights and biological roles.

    ELEMENT (Symbol)Atomic WeightBiological role

    Calcium (Ca)40.1 Bone; muscle contractionCarbon (C)12.0 Constituent (backbone) of organic moleculesChlorine (Cl)35.5 Digestion and photosynthesisCopper (Cu)63.5 Part of Oxygen- carrying pigment of mollusk blood.Fluorine (F)19.0 For normal tooth enamel developmentHydrogen (H) 1.0 Part of water and all organic molecules

  • ELEMENT (Symbol)Atomic WeightBiological role

    Iodine (I) 126.9Part of thyroxine (a hormone)Iron (Fe) 55.8Hemoglobin, oxygen caring pigment of many animalsMagnesium (Mg) 24.3Part of chlorophyll, the photo- synthetic pigment; essential to some enzymes.Manganese (Mn) 54.9Essential to some enzyme actions.Nitrogen (N) 14.0Constituent of all proteins and nucleic acids.Oxygen (O) 16.0Respiration; part of water; and in nearly all organic molecules.enzyme.

  • ELEMENT (Symbol)Atomic WeightBiological role

    Phosphorus (P)31.0High energy bond in ATP.Potassium (K)39.1Generation of nerve impulses.Selenium (Se) 79.0For the working of many enzymes.Silicon (Si)28.1Diatom shells; grass leaves.Sodium (Na) 23.0Part of Salt; nerve conductionSulfur (S)32.1Constituent of most proteins.Important in protein structure:Sulfide bonds are strong.Zinc (Zn) 65.4Essential to alcohol oxidizing

  • KOMPOSISI KIMIA (DALAM SEL BAKTERI)