Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields...
Transcript of Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields...
![Page 1: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/1.jpg)
BIOTECHNOLOGY
MOLECULAR TECHNIQUE FOR IDENTIFICATION AND GENETICS ENGINER
![Page 2: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/2.jpg)
Bioteknologi Adalah teknologi merekayasa pertumbuhan dan metabolisme sel hidup, baik dari mikroba, tumbuhan, hewan maupun manusia untuk produksi komoditi barang maupun jasa yang bermanfaat bagi manusia.
HORMON INSULIN
HORMON PERTUMBUHAN
Review
![Page 3: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/3.jpg)
Introduction to PCRThe Polymerase Chain Reaction
Photo courtesy of Fisher Scientific
![Page 4: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/4.jpg)
DefinitionPolymerase Chain Reaction (PCR): A procedure to amplify a specific DNA region
Yields millions of copies of the target region, Eksponensial amplification.
Makes enough DNA for further molecular work Is the first step in preparing DNA for :
Sequencing Restriction digestion Bacterial cloning
Diagram by Andy Vierstraete 1999
![Page 5: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/5.jpg)
PCR
Exponential increase of the number of copies during PCR
![Page 6: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/6.jpg)
TEKNIK-TEKNIK MOLEKULER UNTUK DIAGNOSTIK dan IDENTIFIKASI
Penggunaan teknik molekuler Untuk keperluan :1.Karakterisasi dan identifikasi Mikroba: – Keragaman genetik – Hubungan filogeni/kekerabatan2. Diagnosis: deteksi dini/cepat dari patogen/Penyakit.3. Rekayasa Genetika, (ClONING, TRANSGENIK
ORGANISM)
![Page 7: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/7.jpg)
Keunggulan teknik molekuler: • Akurasi tinggi: sensitifitas dan spesifisitas • Cepat • Dapat mendeteksi keseluruhan mikroba: Viable
but not (yet) culturable.
![Page 8: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/8.jpg)
PCR (POLYMERASE CHAIN REACTION) BASED METHODS KARRY MULLIS (1982)
Teknik Molekuler berkembang setelah ditemukannya PCR (Polymerase chain Reaction) oleh karry mullis (1982) dimana dengan sebuah alat yang dinamakan ‘’Thermal Cycler” Proses sintesis protein/Amplifikasi (pemanjangan) DNA dapat dilakukan secara invitro (diluar sel).
![Page 9: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/9.jpg)
![Page 10: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/10.jpg)
PCR ,thermal cycler multi-block system
![Page 11: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/11.jpg)
Tahapan teknik molekuler: A. Ekstraksi DNA Produk DNA Genom B. PCR 1. Denaturasi, (94–96°C) pemutusan ikatan hidrogen pada
DNA Genom sehingga DNA menjadi Utas Tunggal .
2. Annealing,(45-60°C), penempelan PrimerTm = 4 (G+C) + 2 (A+T). Annealing Temperature.
3. Ekstension (70-72°C), pemanjangan DNA Target
C. Elektroforesis (Visualisasi )- Identifkasi Produk PCR
![Page 12: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/12.jpg)
1. Ekstraksi DNA
![Page 13: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/13.jpg)
2. PCR
The different steps of PCR
PCR
DNA sequencing
Microarrays
Mass-spec
![Page 14: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/14.jpg)
Roles of PCR Reagents
GoTaq® PCR Mix Taq polymerase
Enzyme that extends growing DNA strand complementary to DNA template
MgCl2
Provides ions needed for enzyme reaction
dNTP’s Nucleotides (Adenine, Cytosine, Guanine, Thymine)
building blocks for new DNA strands
Buffer Maintains optimal pH for enzyme
ddH2O
![Page 15: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/15.jpg)
Roles of PCR Reagents
Primers Anneal to single-stranded DNA template
Provide initiation site for extension of new DNA
Forward primer Anneals to DNA anti-sense strand
Reverse primer Anneals to DNA sense strand
DNA template In this case, the product of our DNA extraction
![Page 16: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/16.jpg)
Quick QuizWhich of the following reagents is NOT in a master
mix?
A. MgCl2
B. Template DNAC. ddH2OD. dNTPs
![Page 17: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/17.jpg)
PCR (Polymerase Chain Reaction)
Bahan Jumlah (µl)
Primer:
Forward
Reverse
1
1
dNTP 2,5
10 x Buffer Ex Taq 2,5
Taq DNA Polymerase 0,2
Steril Destilation Water (SDW) 18,5
Pembuatan Premix
Pair-ID Forwad Primer Reverse PrimerProd Len.
TmDiff.FPPos.RPPos.
2 GATGGTCAGTGCCTCTCA CCCAGTTGTATAGCGGTA 518 286
586
Primer
![Page 18: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/18.jpg)
Primer design
General notes on primer design in PCR
Perhaps the most critical parameter for successful PCR is the design of primers
Primer selectionCritical variables are: - primer length - melting temperature (Tm) - specificity - complementary primer sequences - G/C content- 3’-end sequence
Primer length
- specificity and the temperature of annealing are atleast partly dependent on primer length
- oligonucleotides between 20 and 30 (50) bases are highly sequence specific- primer length is proportional to annealing efficiency: in general, the longer theprimer, the more inefficient the annealing
- the primers should not be too short as specificity decreases
![Page 19: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/19.jpg)
Contoh Desain Primer
![Page 20: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/20.jpg)
gatggatcatgaataaaactattacgttacttagtgcattattactaccactaagttttgctcacgctgccgagccaacattgtctccagagatggtcagtgcctctcaagtaagaagcgcgcaagcgaaacaaacttacacttatgtccgctgctggtaccgcaccagttattcaaaagatgaacctgcgaccgattgggaatgggcagaaaatccagacggcagttacttcacgcttgatggctactggtggagttcggtttctttcaagaacatgttctacacagacacaccgcaaagtgttatcaagcaacgttgtgagcaaactctggacctagcaaatgaaaacgctgacatcaccttctttgcagccgataaccgtttctcctacaaccatactatctggagcaacgaccctgtcatgcagccagaccaaatcaacaaggtcgtagcattgggtgacagcttgtctgatacaggcaacatctttaatgcatcacaatggcgattcccgaatccaaatagctggttcttgggacacttctcaaacggttttgtgtggactgagtacattgctcaagcgaaaaacttaccgctatacaactgggctgtgggtggcgcggcaggcgaaaaccaatacatcgctctgactggtgtaggtgagcaagtttcctcttacttggcatatgcgaaattagcgaaaaactacaagcctgctaataccctgtttacccttgagtttggtctaaatgacttcatgaactacaaccgtagcgtgccagaagtgaaatcagactacgcggaagccttgattaaactgaccgatgcaggtgcgaagaacttgttgttgatgacactaccagatgcaacacgtgcaccacagtttacctactcgactcaagaagaaatcaacaagatccgcgcgaagatcgtggaaatgaatgagttcatcaaagcacaagcggcgtattacactgcacaaggctacaacgttaccttgtacgatacgcatgcactgtttgaaagcttaacagcaaatccagagcaacacggttttgtaaacgcgagccaagcttgccaagacatcaaccgctcttcatcggtagattacctataccatcactcattgcgttctgagtgtgcgtcttctggctctgataagtttgtattctgggacgtaacacacccgaccacagcaaacaccactacgtggcagaaaaaatgctagaaagtacgaatcaattgtcaaaccatcctttctaa
Sekuen Gen Hemo
Sumber ; (Yuhana et al, 2009)
Forwards
Reverse
![Page 21: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/21.jpg)
Good Primer Design
Length (17-28bp) GC content 50-60% GC Clamp Tm’s between 55-80 Avoid simple sequences – e.g. strings of G’s Avoid primer self complementary
e.g. hairpins, homodimers, heterodimers
![Page 22: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/22.jpg)
Setting PCR Program
Tahapan Suhu(0C)
Waktu
Pre-Denaturasi 94 2 menit
Denaturasi 94 1 menit
Annealing 50 1 menit
Elongation 72 1 menit
Final Elongation 72 2 menit
35 siklus
![Page 23: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/23.jpg)
Considerations
Contamination can easily lead to erroneous results
Avoid contaminating with DNA or PCR product…
DNA stocks, PCR reagents Gloves, tips, pipetters, benches
Carefully measure reagent quantities
Use appropriate cycling conditions
![Page 25: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/25.jpg)
3. Elektroforesis
![Page 26: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/26.jpg)
![Page 27: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/27.jpg)
Visualisasi Produk PCR (Elektroforesis)
Gel agarosa 0,7% (0,21 gr
agarose+30 ml TBE)
Dipanaskan sampai bening dan diamkan
hingga hangat
Dituang ke ke dalam chamber yang sudah
dipasang sisir
Dimasukkan ke bak
elektroforesis
3 µl produk PCR + 4 µl
loading dye
Dimasukkan ke sumur dalam gel
1 µl marker + 4µl
Loading dye
Running (200 Volt, 70 mA)
hingga ¾ bagian dari lebar gel
Diletakkan di atas
ultraviolet illuminator
Pengambilan gambar
![Page 28: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/28.jpg)
![Page 29: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/29.jpg)
DNA Sequencing
The separation of the sequencing fragments
To measure the sizes of the fragments, each of the four reactions would be loaded into a separate well on a gel, and the fragments would be separated by gel electrophoresis
![Page 30: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/30.jpg)
Elektroforesis
![Page 31: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/31.jpg)
Quick QuizIf you forgot to add one of your primers your
resultant gel will probably have
A. No bandsB. A smearC. A band of the wrong sizeD. Many bands
![Page 32: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/32.jpg)
Dolly adalah hewan hasil kloning pertama
Teknik Kloning Dolly
Sel telur dari domba donor I diambil, lalu dikeluarkan intinya (yang dipakai hanya sel yang tanpa inti)
Sel dari kelenjar ambing domba donor II diambil DNAnya saja (sel dibuang, hanya inti yang dipakai)
Sel dari domba I dan II digabungkan (dengan arus listrik), kemudian terjadi pembelahan sel (embrio)
Sel yang telah membelah tsb ditanam pada uterus domba betina lain, yang selanjutnya beranak Dolly
Sepanjang hidupnya Dolly tlh melahirkan 2x, disuntik mati krn radang paru-paru dan arthritis pd umur 6,5 thn.
Profil Dolly
Review.
![Page 33: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/33.jpg)
Kloning Pada Manusia?
![Page 34: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/34.jpg)
Kloning Untuk Menghasilkan Sel Sebagai Terapi?
Tujuan jangka panjangriset kloning antara lain adalah di-hasilkannya protein yang dibutuhkan manusia, sbg terapi dgn menciptakan berbagai sel dan organ kompatibel yang siapdi-transplantasikan ke tubuh manusia.
Contoh membuat sel untuk melawan kanker
![Page 35: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/35.jpg)
Cloning Genes
![Page 36: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/36.jpg)
![Page 37: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/37.jpg)
Agrobacterium tumefaciens Agrobacterium tumefaciens,
penyebab penyakit crown gall, pada tanaman.
Mekanisme : parasit pada jaringan tanaman, melibatkan integrasi sebagian DNA bakteri pada tanaman inang yang menyebabkan tumor dan mengubah metabolisme tanaman.
![Page 38: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/38.jpg)
Agrobacterium tumefaciens A. tumefaciens digunakan
sebagai agen kontrol biologi dan sebagai alat untuk enginering gen pada tanaman.
![Page 39: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/39.jpg)
Plasmid Ti Hanya sel yang mengandung plasmid spesifik
(plasmid Ti) yang dapat menyebabkan penyakit. A. tumefaciens strains yang tidak mempunyai plasmid tumbuh sebagai rizosphere – inhabiting bacteria tanpa menyebabkan penyakit.
Bakteri dapat menstimulasi inang untuk memperbanyak dan membelah diri sel secara cepat dan tidak normal. Hal ini karena bakteri tersebut dapat menyisipkan sebagian DNA nya ke dalam kromosom DNA inang yang menyebabkan overproduksi dari cytokinins dan auxins.
![Page 40: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/40.jpg)
Cytokinin dan auksin merupakan plant growth regulators, dan opines yang memberikan nutrient bagi patogen.
Jaringan inang akan terus membesar dan akan membentuk tumor di batang atau akar.
![Page 41: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/41.jpg)
Plasmid Ti
![Page 42: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/42.jpg)
GMO(Genetically Modified Organism)
![Page 43: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/43.jpg)
Ice Plus Protein (Ice Nucleation active Protein)
![Page 44: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/44.jpg)
The methods used by molecular biologists to study DNA have been developed through adaptation of the chemical reactions and biological processes that occur naturally in cells
Many of the enzymes that copy DNA, make RNA from DNA, and synthesize proteins from an RNA template were first characterized in bacteria. This basic research has become fundamental to our understanding of the function of cells and have led to immense practical applications for studying a gene and its corresponding protein.
As science advances, so do the number of tools available that are applicable to the study of molecular genetics.
PCRDNA sequencing
Microarrays
Mass-spec
The new biology lab
Laboratory Tools and Techniques
![Page 45: Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields millions of copies of the target region , ... sel dan organ kompatibel y ang siap ... jaringan tanaman,](https://reader038.fdokumen.com/reader038/viewer/2022102920/5a903dc87f8b9afe568dfc8e/html5/thumbnails/45.jpg)
Terimakasih Semoga Bermanfaat