2009har Abstract

download 2009har Abstract

of 28

  • date post

    13-Jul-2015
  • Category

    Documents

  • view

    106
  • download

    0

Embed Size (px)

Transcript of 2009har Abstract

MARKA MOLEKULER TERPAUT SIFAT TOLERANSI ALUMINIUM DAN KARAKTER AGRONOMI PADA POPULASI F2 TANAMAN PADI (Oryza sativa L)

HARIYANTO

SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR 2009

PERNYATAAN MENGENAI TESIS DAN SUMBER INFORMASI Dengan ini saya menyatakan bahwa tesis yang berjudul Marka Molekuler Terpaut Sifat Toleransi Aluminium dan Karakter Agronomi pada Populasi F2 Tanaman Padi (Oryza sativa L) merupakan gagasan dan karya saya bersama pembimbing yang belum pernah dipublikasikan dalam bentuk apapun. Sumber informasi yang berasal atau dikutip dari karya yang diterbitkan maupun tidak diterbitkan oleh penulis lain telah disebutkan dalam teks dan dicantumkan dalam daftar pustaka dibagian akhir tesis ini.

Bogor,

Juni 2009

Hariyanto NRP G351060171

ABSTRACT HARIYANTO. (Moleculer Markers Linked to Aluminum Tolerance Trait and Agronomic Characters in Rice F2 Population (Oryza sativa L). Supervised by MIFTAHUDIN and DWINITA W. UTAMI. Rice is a staple food for the most people in Indonesia. Rice demand will continuously increase as the world population increase. To fulfill the demand, rice production should be increased through both extensification and intensification efforts. The later effort could use marginal lands including acid soils that widely distributed in Indonesia. However, Al toxicity is the main constraint for crop production in acid soils. The high Al solubility in acid soils will rice root system, inhibit growth and decrease production. The objective of this study is to analyze molecular markers that linked to physiological parameter of Al tolerance trait and agronomic characters in rice F2 population derived from a cross between the Al-sensitive rice variety IR64 and the Altolerant rice variety Hawarabunar. The physiological and agronomical characters that were studied in this research were root length increment, plant height, total empty grain per panicle , total filled grain per panicle and 1000 grain weight. To perform root length increment analysis, the seedlings were grown on minimum culture solution containing 15 ppm of Al for 72 hours. The root length was measured before and after being Alstressed. The difference between both measurements is called as root length increment. Plant height was observed when 50% of population has flower. All yield components were observed after harvest. Root length increment analysis showed that this character was multigenic trait as well as plant height and yield components characters. Among 21 polymorphic simple sequence repeats (SSR) that were analyzed, 18 markers showed 1:2:1 segregation pattern for homozygous IR64 : heterozygous : homozygous Hawarbunar ratio. Linkage analysis between molecular markers and physiological characters using single marker analysis method showed that OSR13, RM514, RM251 located on chromosom 3 were linked to root length increment. The other six markers that are located chromosome 3, linked to several agronomic characters. Those markers were RM 231 and RM 545 linked to the plant height, RM 489 linked to the total empty grain per panicle, RM 545 and RM 232 linked to the 1000 grain weight. Another marker (RM 174) that is located on chromosome 2 was linked to the total filled grain per panicle. (Keyword : rice, Al tolerance, SSR marker , linkage)

RINGKASAN HARIYANTO. (Marka Molekuler Terpaut Sifat Toleransi Aluminium dan Karakter Agronomi pada Populasi F2 Tanaman Padi (Oryza sativa L). Dibimbing oleh MIFTAHUDIN dan DWINITA W. UTAMI. Padi merupakan sumber bahan makanan pokok penduduk sampai saat ini. Kebutuhan beras terus meningkat seiring dengan pertambahan jumlah penduduk. Untuk memenuhi kebutuhan tersebut perlu dilakukan upaya peningkatan produksi baik dengan intensifikasi maupun ekstensifikasi. Peningkatan produksi melalui perluasan areal tanam dapat dilakukan diantaranya melalui pemanfaatan tanah-tanah asam. Akan tetapi, kendala utama yang dihadapi dalam pemanfaatan tanah asam adalah kelarutan aluminium (Al) tinggi yang akan mengakibatkan terhambatnya pertumbuhan padi. Pemuliaan tanaman untuk mendapatkan varietas toleran Al dapat dilakukan secara konvensional, tetapi langkah ini memerlukan waktu lama. Sebagai alternatif adalah penggunaan marka molekuler sebagai alat bantu seleksi. Beberapa varietas padi mempunyai sifat peka dan toleran terhadap Al . Varietas IR64 yang peka Al dan Hawarabunar yang merupakan padi gogo toleran Al. Generasi F2 dari persilangan kedua varietas tersebut digunakan dalam penelitian. Tujuan dari penelitian ini adalah 1) menganalisis karakter pertambahan panjang akar sebagai parameter sifat toleransi Al pada padi, 2) mengevaluasi kaitan antara karakter tinggi tanaman, jumlah butir bernas per malai, jumlah butir hampa per malai dan bobot 1000 butir dengan sifat toleransi Al pada padi, 3) menganalisis pola pewarisan sifat toleransi Al pada padi, 4) mengidentifikasi marka molekuler terpaut sifat toleransi Al pada padi. Pengamatan karakter pertambahan panjang akar (PPA) dilakukan pada kecambah padi yang telah mendapat cekaman aluminium 15 ppm selama 72 jam pada kultur hara pH 4. Pertambahan panjang akar diukur sebagai selisih panjang akar sebelum dan setelah cekaman aluminium. Karakter tinggi tanaman diamati ketika populasi F2 sudah 50% berbunga sedangkan komponen produksi diamati setelah panen. Analisis pola pewarisan karakter fisiologi dan marka molekuler dilakukan dengan uji Khi-Kuadrat pada 379 individu F2, sedangkan analisis keterpautan antara marka molekuler dan sifat toleransi Al dilakukan dengan menggunakan Software QTL Cartographer Ver. 2.0. Hasil penelitian menunjukan bahwa karakter pertambahan panjang akar, tinggi tanaman dan komponen produksi merupakan karakter poligenik. Dari 21 marka yang dianalisis diperoleh 18 marka bersegregasi secara bebas dengan rasio IR64 : heterozigot : Hawarabunar adalah 1 : 2 : 1. Analisis keterpautan dengan marka tunggal diperoleh bahwa marka OSR13, RM514 dan RM251 terpaut dengan karakter pertambahan panjang akar terletak pada kromosom 3. Enam marka SSR lain yang terdapat pada kromosom 3 terpaut beberapa karakter agronomi. Marka tersebut antara lain RM 231 dan RM 545 terpaut dengan karakter tinggi tanaman, RM 489 terpaut dengan karakter jumlah butir hampa per malai, RM 545 dan RM 232 terpaut dengan karakter bobot 1000 butir. Satu marka SSR (RM 174) pada kromosom 2 terpaut dengan karakter jumlah butir bernas per malai. Kata kunci : Padi, toleransi aluminium, marka SSR, pautan.

Hak Cipta milik IPB, tahun 2009 Hak Cipta dilindungi Undang-Undang

1. Dilarang mengutip sebagian atau seluruh karya tulis ini tanpa mencantumkan atau menyebutkan sumbernya. a. Pengutipan hanya untuk kepentingan pendidikan, penelitian, penulisan karya ilmiah, penyusunan laporan, penulisan kritik, atau tinjauan suatu masalah. b. Pengutipan tersebut tidak merugikan kepentingan yang wajar IPB. 2. Dilarang mengumumkan dan memperbanyak sebagian atau seluruh karya tulis ini dalam bentuk apapun tanpa izin IPB.

MARKA MOLEKULER TERPAUT SIFAT TOLERANSI ALUMINIUM DAN KARAKTER AGRONOMI PADA POPULASI F2 TANAMAN PADI (Oryza sativa L)

HARIYANTO

Tesis Sebagai salah satu syarat untuk memperoleh gelar Magister Sains pada Departemen Biologi

SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR 2009

Judul Tesis Nama NRP

: Marka Molekuler Terpaut Sifat Toleransi Aluminium dan Karakter Agronomi pada Populasi F2 Tanaman Padi (Oryza sativa L) : Hariyanto : G 351060171

Disetujui Komisi Pembimbing

Dr. Ir. Miftahudin, M.Si Ketua

Dr. Dwinita W. Utami, M.Si Anggota

Diketahui Ketua Program Studi Biologi Dekan Sekolah Pascasarjana

Dr. Ir. Dedy Duryadi S, DEA

Prof. Dr. Ir.Khairil Anwar Notodiputro, MS.

Tanggal Ujian :

Tanggal Lulus :

PRAKATA Alhamdullilah, puji syukur penulis panjatkan kepada Allah SWT atas limpahan nikmat dan rahmatnya sehingga penulis dapat menyelesaikan Tesis dengan judul MARKA MOLEKULER TERPAUT SIFAT TOLERANSI ALUMINIUM DAN KARAKTER AGRONOMI PADA POPULASI F2 TANAMAN PADI (Oryza sativa L) tepat pada waktunya. Penulis menyadari bahwa selesainya tesis ini menyertakan berbagai pihak. Untuk itu ucapan terima kasih penulis sampaikan kepada : 1. Dr. Ir. Miftahudin, M.Si selaku ketua komisi pembimbing yang telah memberikan kesempatan kepada penulis untuk ikut dalam proyek penelitian Kerjasama Kemitraan Penelitian Pertanian dengan Perguruan Tinggi (KKP3T) sehingga penelitian ini dapat berjalan dengan lancar. 2. Dr. Dwinita W. Utami, M.Si selaku anggota komisi pembimbing, juga staf kelompok peneliti Biologi Molekuler Balai Besar Penelitian Pertanian dan Genetik (BB-Biogen) di Cimanggu yang telah banyak membantu demi lancarnya penelitian ini. 3. Dr. Ir. Utut Widyastuti Suharsono, M.Si selaku penguji luar komisi yang telah banyak memberikan semangat untuk mengikuti pendidikan Pascasarjana di IPB 4. Dekan Sekolah Pascasarjana IPB dan Ketua Program Studi Biologi atas kesempatan yang diberikan kepada penulis untuk mengikuti pendidikan Pascasarjana di IPB. 5. Departemen Agama RI atas beasiswanya, sehingga penulis dapat melanjutkan pendidikan di Institut Pertanian Bogor. 6. Drs. Muhadin, M.Ag selaku Kepala MAN Majenang yang telah memberikan ijin penulis untuk melanjutkan pendidikan di IPB. 7. Ibu Yuri, selaku staf laboratorium Biologi Molekuler Balai Besar Penelitian Pertanian dan Genetik (BB-Biogen) di Cimanggu yang telah banyak membantu demi lancarnya penelitian ini. 8. Ibu Dewi, ibu eka, ibu yeni, pak akhmad, andik serta rekan-rekan BUD DEPAG 2006 dan 2007 yang tidak dapat penulis sebutkan satu persatu, penulis mengucapkan terimakasih yang sebesar-besarnya atas bantuan, kerjasama dan dukungannya selama ini. 9. Secara khusus untuk keluarga penulis, Mularmawati, S.Pd, ananda Saefulloh Maruf Muttaqin dan Risma Dwicahya Novianti atas dorongan, kesabaran, pengertian dan doanya. 10. Bapak dan Ibunda tercinta, bapak dan ibu mertua, atas segala pengorbanan baik moril maupun materiil. Penulis berharap agar hasil penelitian bermanfaat dan memberikan tambahan pengetahuan bagi dunia pendidikan dan masyarakat pada umumnya. Amiin. Bogor, Juni 2009 Hariyanto

RIWAYAT HIDUP Penulis dilahirkan di Blitar, Jawa Timur pada tanggal 14 Juli 1970, sebagai anak pertama dari tiga bersaudara pasangan Bapak Amirudin Iskandar dan Ibu Suryati. Penulis menikah dengan Mularmawati, S.Pd dan dikaruniai dua putra-putri, Saefulloh Maruf Muttaqin dan Risma Dwicahya Novianti. Penulis menyelesaikan pendidikan sarjana di Universitas Muhammadiyah Malang, Fakultas Keguruan dan Ilmu Pendidikan jurusan Biologi tahun 1996. Pada tahun 2006, penulis mendapat kesempatan untuk melanjutkan studi S2 pada program studi Biologi, di Sekolah Pascasarjana Institut Pertanian Bogor dengan Beasiswa dari Departemen Agama RI. Saat ini penulis bekerja sebagai guru Biologi pada Madrasah Aliyah Negeri Majenang di Cilacap Jawa Tengah.

DAFTAR ISI Halaman DAFTAR TABEL .......................................................................... DAFTAR GAMBAR ..................................................................... DAFTAR LAMPIRAN .................................................................. PENDAHULUAN Latar Belakang ..................................................................... Manfaat Penelitian ............................................................... Tujuan Penelitian ................................................................. TINJAUAN PUSTAKA Tanah Asam ......................................................................... Respon Tanaman terhadap Cekaman Aluminium............... Mekanisme dan Kriteria Tanaman Toleran Aluminium ...... Genetika dan Sifat Toleransi Aluminium ........................... Simple Sequence Repeats ................................................... BAHAN DAN METODE Waktu dan Tempat .............................................................. Bahan Tanaman ................................................................... Alur Penelitian ..................................................................... Metode Penelitian ................................................................ Cekaman Al dan Pengukuran Pertambahan Panjang Akar.. Analisis Karakter Agronomi ............................................... Analisis Marka Molekuler .................................................. Isolasi DNA ........................................................................ Kuantifikasi DNA............ Kualitas DNA.............. PCR (Polymerase Chain Reaction) . Analisis Data ... HASIL DAN PEMBAHASAN Respon Tanaman Padi terhadap Cekaman Al ..................... Analisis Segregasi Karakter Fisiologi dan Agronomi ......... Analisis Marka Molekuler ................................................... Analisis Keterpautan antara Marka Molekuler dengan Sifat Toleransi Al pada Padi ................................................ KESIMPULAN DAN SARAN Kesimpulan .......................................................................... Saran ..................................................................................... DAFTAR PUSTAKA ..................................................................... LAMPIRAN-LAMPIRAN............................................................. xi xii xiii 1 2 3 4 4 6 7 9 11 11 11 12 12 12 12 12 14 14 14 15 17 20 24 26 29 29 30 34

DAFTAR TABEL Halaman 1 2 Komponen PCR yang digunakan untuk Amplifikasi DNA dengan primer SSR ............................................................. Respon Pertambahan Panjang Akar dari padi varietas IR64 dan Hawarabunar terhadap Cekaman 15 ppm Al selama 72 jam ..................................................................... 3 4 5 6 Rata-rata nilai Pertumbuhan dan Komponen Produksi Padi varietas IR64 dan Hawarabunar pada Tanah Asam ............. Uji Khi-Kuadrat dari pola Segregasi Karakter Fisiologi dan Agronomi Populasi F2 1gen dan 2 gen ................................ Uji Khi-Kuadrat pada Marka Molekuler .............................. Keterpautan Karakter Fisiologi dan Agronomi pada kromosom ............................................................................ 26 20 25 18 17 15

DAFTAR GAMBAR Halaman 1 2 3 4 5 6 7 Bagan alir pelaksanaan penelitian . Distribusi normal pertambahan panjang akar pada populasi F2 hasil persilangan IR64 dengan Hawarabunar . Distribusi normal tinggi tanaman pada populasi F2 hasil persilangan IR64 dan Hawarabunar.. Distribusi normal jumlah butir hampa per malai pada populasi F2 hasil persilangan IR64 dengan Hawarabunar...... Distribusi normal jumlah butir bernas per malai pada populasi F2 hasil persilangan IR64 dengan Hawarabunar.. Contoh elektroforesis hasil PCR marka RM452 pada gel agarose superfiner 3% dalam buffer TBE 1x ............. Peta genetik 21 marka SSR yang diuji pada kromosom 1, 2, dan 3 ........................................................ 26 24 23 22 21 21 11

DAFTAR LAMPIRAN Halaman 1. 2. 3. 4. 5. Deskripsi varietas padi IR64 ............................... Deskripsi varietas padi Hawarabunar ......................................... Komposisi media minimum untuk kultur hara percobaan cekaman Al pada padi ................................................................ Sekuen 14 pasang primer SSR pada kromosom 2 yang dianalisis ...................................................................................... Sekuen 7 pasang primer SSR pada kromosom 3 yang dianalisis ...................................................................................... 6. Hasil uji t-student (=5%)untuk karakter fisiologi tetua IR64 dan Hawarabunar pada tanah asam dan tanah biasa .................. 7. Penanaman padi secara gogo pada tanah Podsolid Merah Kuning di rumah kaca Cikabayan, IPB Bogor ............................. 8. Hasil analisis contoh tanah asam di Balai Penelitian Tanah ....... 9. Hasil uji t-student (=5%)untuk karakter agronomi tetua IR64 dan Hawarabunar pada tanah asam dan tanah biasa .................. 43 41 42 40 39 38 37 35 36

PENDAHULUAN

Latar Belakang Padi (Oryza sativa L) merupakan salah satu bahan pokok untuk kebutuhan pangan bagi masyarakat pada umumnya. Seiring dengan bertambahnya jumlah penduduk yang sangat pesat serta beralihnya lahan pertanian untuk pemukiman dan industri, maka lahan yang tersedia untuk pertanian tanaman pangan, khususnya padi, menjadi semakin berkurang. Hal ini akan berakibat pada terganggunya kelangsungan produksi beras nasional. Langkah yang harus diambil pemerintah adalah membuka lahan pertanian baru di lahan marginal yang kebanyakan merupakan tanah asam. Salah satu kendala pengusahaan pertanian di tanah asam adalah pH tanah yang rendah serta kandungan Al terlarut yang tinggi sampai pada taraf yang dapat meracuni tanaman. Keracunan Al ditandai dengan terhambatnya pertumbuhan akar sebagai akibat terhambatnya pemanjangan sel (Kochian 2000). Disamping itu, kandungan Al terlarut yang tinggi akan mengganggu penyerapan nutrisi sehingga tanaman mengalami defisiensi hara dan rentan terhadap cekaman kekeringan dan serangan hama penyakit (Delhaize & Ryan 1995). tanaman. Usaha pengapuran pada tanah asam merupakan tindakan perbaikan lahan yang dapat ditempuh, tetapi langkah ini membutuhkan banyak biaya dan tidak efisien. Pendekatan lain yang dapat ditempuh untuk mengatasi masalah pada tanah asam adalah dengan menggunakan varietas padi yang toleran terhadap kondisi asam dan cekaman Al. Tanaman padi toleran dapat diusahakan melalui pemuliaan tanaman baik dengan cara konvensional maupun dengan pendekatan biologi molekuler. Pemuliaan dengan metode konvensional membutuhkan banyak tenaga, waktu lebih lama, banyak menemui kendala dan sering kurang efisien (Bennet 1993). Studi mekanisme toleransisi tanaman padi terhadap cekaman Al baik pada tingkat fisiologi maupun molekuler belum banyak diketahui. Pengetahuan tentang karakter fisiologi yang dapat dijadikan sebagai parameter sifat toleransi Al pada padi merupakan langkah awal baik untuk mempelajari mekanisme toleransi tanaman padi terhadap cekaman Al maupun dalam upaya mendapatkan karakter fisiologi yang dapat digunakan sebagai fenotipe sifat toleransi Al. Fenotipe ini selanjutnya dapat digunakan Akibat selanjutnya adalah akan menurunkan produksi

dalam program seleksi dan pemuliaan yang bertujuan untuk mendapatkan varietas toleransi Al. Kemajuan di bidang marka molekuler, terutama pada padi, memungkinkan digunakannya marka tersebut sebagai alat untuk membantu seleksi sifat-sifat yang diinginkan khususnya sifat toleransi Al. Secara umum beberapa kelebihan marka molekuler sebagai alat bantu seleksi antara lain keberadaan marka molekuler tidak dipengaruhi oleh faktor lingkungan, dapat digunakan untuk menyeleksi pada tahap awal pertumbuhan, dan dapat digunakan untuk seleksi sifat yang sangat sulit sekalipun yang apabila menggunakan seleksi fenotipe memerlukan waktu yang panjang, seperti morfologi perakaran, resistensi terhadap hama dan penyakit, serta toleransi terhadap cekaman abiotik seperti kekeringan, garam, defisiensi atau keracunan mineral (McCouch & Tanksley 1991). Salah satu marka yang dapat digunakan dalam seleksi tanaman adalah Simple Sequence Repeats (SSR). Marka ini mempunyai potensi untuk studi polimorfisme pada padi budidaya. Temnykh et al. (2000) menyebutkan bahwa marka SSR mempunyai derajat polimorfisme dalam genom padi. Pemahaman tentang karakter fisiologi dan agronomi tanaman terhadap cekaman Al dan marka-marka yang bermanfaat untuk mengetahui sifat genetiknya sangat penting. Kajian tentang mekanisme toleransi Al dan marka molekulernya masih sedikit. Oleh karena itu penelitian ini dilakukan untuk mengembangkannya sehingga lebih banyak memberikan manfaat. yang tinggi, bersifat kodominan dan telah banyak dipetakan

Manfaat Penelitian Beberapa manfaat yang dapat diambil dari penelitian ini adalah 1) dengan diketahuinya karakter-karakter toleransi terhadap Al baik fisiologi maupun agronomi akan dapat digunakan untuk membantu dalam menyeleksi plasma nutfah dan galurgalur harapan padi dalam usaha pemuliaan tanaman padi , 2) karakter-karakter toleransi Al juga dapat digunakan dalam upaya memahami mekanisme toleransi Al pada tanaman padi, 3) marka molekuler yang terkait dengan karakter-karakter tersebut dapat digunakan dalam seleksi tanaman padi dalam rangka perbaikan varietas untuk

mendapatkan varietas toleransi Al, 4) Dalam jangka panjang varietas toleransi Al yang dihasilkan dapat mendukung peningkatan produksi beras nasional.

Tujuan Penelitian Tujuan dari penelitian ini adalah 1) menganalisis karakter pertambahan panjang akar sebagai parameter sifat toleransi Al pada padi, 2) mengevaluasi kaitan antara karakter tinggi tanaman, jumlah butir bernas per malai, jumlah butir hampa per malai, dan bobot 1000 butir dengan sifat toleransi Al pada padi, 3) menganalisis pola pewarisan sifat toleransi Al pada tanaman padi, dan 4) mengidentifikasi marka molekuler terpaut sifat toleransi Al pada padi.

.

TINJAUAN PUSTAKA

Tanah Asam Tanah asam merupakan jenis tanah yang mempunyai pH rendah dan kelarutan Al yang tinggi. Jenis tanah ini umumnya berupa lahan kering tropika. Ada tiga ordo untuk jenis tanah ini yaitu Oxisol, Ultisol dan Spodosol. Van Wambake (1991) melaporkan bahwa ordo Ultisol merupakan tanah dengan toksisitas Al tertinggi dibandingkan Oxisol. Kelarutan Al dalam tanah asam sangat dipengaruhi oleh pH tanah. Bentuk Al3+ merupakan bentuk yang beracun dan paling banyak dalam larutan tanah pada tanah dengan pH di bawah 4.0, sedangkan pada pH 4.0-5.5 Al banyak dijumpai dalam bentuk Al(OH)+2 . Tanah dengan pH rendah memiliki kapasitas tukar ion H+ yang tinggi, sehingga menyebabkan penyerapan unsur-unsur lainnya menjadi berkurang, tetapi penyerapan unsur Al menjadi berlebih. Meningkatnya konsentrasi Al terlarut akibat keasaman tanah mengakibatkan terjadinya defisiensi P, K, dan hara mikro seperti seng dan tembaga (MacDiamid & Gardner 1996). Kondisi ini mengakibatkan tanah tersebut memiliki tingkat kesuburan yang rendah. Penurunan kesuburan tanah sebagai dampak degradasi kimia akan berpengaruh pada kapabilitas tanah untuk usaha pertanian. Tanah asam umumnya terdapat di daerah bercurah hujan tinggi dan sebagian berada pada daerah tropik. Di Indonesia jenis tanah asam sebagian besar terdapat di pulau-pulau besar di luar Jawa. Penyebaran tanah asam ini sangat luas mencapai 45,8 juta ha atau 24,3% dari luas daratan (Subagyo et al. 2000).

Respon Tanaman terhadap Cekaman Aluminium Pertumbuhan tanaman sangat tergantung pada lingkungan tumbuhnya. Beberapa jenis tanaman seperti padi, kedelai dan jenis tanaman pangan lainnya sangat sensitif terhadap perubahan lingkungan. Perubahan komponen biotik maupun abiotik dari lingkungan merupakan faktor cekaman bagi tananam yang berakibat pada penurunan pertumbuhan dan produksi. Salah satu cekaman abiotik yang penting adalah kelarutan Al yang tinggi pada tanah asam. Tanah asam dengan pH rendah dan kelarutan Al tinggi akan mempengaruhi pertumbuhan tanaman.

Keberadaan Al merupakan faktor pembatas pertumbuhan pada tanah asam. Bentuk Al yang bersifat toksik bagi tanaman adalah ion trivalen Al3+ yang dominan pada pH tanah dibawah 4 (Delhaize & Ryan 1995). Keracunan Al ditandai dengan terhambatnya pertumbuhan akar sebagai akibat terhambatnya pemanjangan sel. Beberapa laporan menyebutkan bahwa keracunan Al dapat menurunkan dan merusak sistim perakaran yang menyebabkan tanaman rentan terhadap cekaman kekeringan dan mengalami defisiensi hara mineral. Pengaruh Al dalam memblok kanal Ca2+ dan K+ dapat mengakibatkan defisiensi hara (Delhaize & Ryan 1995). Ambang batas beberapa tanaman terhadap kejenuhan Al di tanah asam bervariasi antar jenis tanaman. Secara umum kandungan Al yang tinggi berpengaruh buruk pada tanaman terutama terhadap sistem perakaran seperti pertumbuhan akar terhambat, pendek, tebal, percabangan tidak normal, tudung akar rusak dan berwarna coklat atau merah (Ismunadji & Partohardjono 1985). Pada tingkat molekuler, keracunan Al berhubungan dengan fungsi DNA. Interaksi keduanya dapat menghentikan sifat-sifat fitokimia dan fungsi biologis seperti menghentikan pembelahan sel pada meristem akar dan perpanjangan sel (Matsumoto 1991). Ryan et al. (1997) melaporkan bahwa Al dapat mempengaruhi sel melalui sifat permeabilitas membran sel dan tingkat aktifitas transport pada membran plasma. Pertumbuhan tanaman yang terganggu akibatnya akan mempengaruhi komponen produksi tanaman. Komponen produksi tersebut meliputi jumlah butir bernas per malai, jumlah butir hampa per malai, dan bobot 1000 butir. Menurunnya aktivitas sel akan menurunkan kemampuan metabolisme tanaman, dan suplai asimilat ke biji sehingga banyak dihasilkan butir hampa (Manurung & Ismunadji 1988). Dan berakibat akan menurunkan hasil butir bernas. Beberapa varietas padi seperti IR64 dan Krowal mempunyai respon pertumbuhan akar yang sama terhadap cekaman Al. Pada konsentrasi 60 ppm Al kedua varietas mengalami cekaman oksidatif dan peroksidasi lipid pada membran. Pembentukan MDA pada akar Krowal yang lebih rendah daripada MDA yang terbentuk pada akar IR64 mengindikasikan bahwa pada cekaman yang sama varietas krowal mengalami cekaman oksidatif yang lebih rendah dibandingkan dengan IR64 (Wulansari 2007).

Morfologi akar padi varietas IR64 dan Krowal setelah mendapatkan cekaman Al 60 ppm menyebabkan akar seminal menjadi lebih pendek jika dibandingkan dengan kontrol setelah 6 jam perlakuan cekaman ( Nurlaela 2008).

Mekanisme dan Kriteria Tanaman Toleran Aluminium Tanaman memiliki mekanisme untuk dapat bertahan pada lingkungan tercekam Al. Kochian (1995) menyatakan bahwa ada dua mekanisme toleransi tanaman terhadap cekaman Al yaitu mekanisme eksternal dimana mekanisme toleransi yang dibangun oleh tanaman dengan cara mencegah Al untuk tidak masuk ke dalam sistem simplas. Bentuknya dapat berupa immobilisasi Al pada dinding sel, permeabilitas selektif dari membran plasma, barier pH dari rhizosfer, eksudasi ligan pengkelat Al, atau efluks Alfosfat. Kemudian dapat melalui mekanisme internal kompartementasi Al dalam vakuola, induksi yang terjadi dalam bentuk protein pengikat Al, kelatisasi Al oleh asam organik, protein atau ligand organik lainnya dalam sitoplasma, sintesis pengembangan enzim resisten, sintesis protein pengkelat Al yang spesifik pada membran plasma yang akan menurunkan serapan Al ataupun peningkatan pengeluaran Al. Beberapa asam organik yang terdapat di dalam sel tumbuhan seperti asam malat, asam sitrat, asam oksaloasetat, asam fulfat, asam humat dan fenolat, mempunyai kemampuan untuk mengkelat Al dan mereduksi atau menetralkan pengaruh racun dari Al pada tingkat seluler. Pengkelatan Al dapat terjadi melalui pelepasan asam-asam organik tersebut melalui akar sedangkan proses detoksifikasi terjadi di dalam saluran simplas (Pellet et al. 1995). Ma et al. (2002) melaporkan bahwa cekaman Al juga menginduksi sekresi asam sitrat pada tanaman padi. Respon peningkatan sekresi asam sitrat mengalami peningkatan baik pada varietas yang sensitif maupun toleran cekaman Al sehingga sekresi asam sitrat tidak membedakan secara nyata antara varietas yang sensitif dan toleran cekaman Al. Pada tanaman lain seperti pada buncis yang toleran Al, asam sitrat yang disekresikan dapat mengkelat dan mendetosifikasi Al dalam apoplasma (Miyasaka et al. 1991). Tanaman padi diduga memiliki mekanisme toleransi melalui mekanisme eksternal dengan mengekskresikan asam organik. Irfan (2008) dalam penelitiannya menyebutkan bahwa perlakuan Al memberikan respon yang berbeda antara IR64

(varietas peka) dan Hawarabunar (varietas toleran). Hasil penelitian ini menunjukan bahwa varietas Hawarabunar yang toleran terhadap Al, mensekresikan asam malat lebih tinggi dibandingkan dengan varietas IR64. Wulansari (2007) menyebutkan bahwa tanaman toleran akan mensintesis MDA (malondyaldehyde) sebagai produk odsidasi lipid pada saat tercekam oleh Al. Pada tanah asam tanaman peka dan toleran Al akan menunjukan perbedaan dalam merespon keberadaan Al. Umumnya tanaman peka akan mengakumulasi Al pada akar lebih cepat dibandingkan dengan tanaman toleran (Rincon & Gonzales 1992). Selain itu tanaman peka Al menyerap Al lebih banyak dibandingkan tanaman yang toleran Al (Delhaize & Ryan 1993). Tanaman toleran Al merupakan tanaman yang pertumbuhan dan perkembangannya sedikit dipengaruhi oleh adanya Al. Sedangkan tanaman peka Al, sangat terhambat pertumbuhannya dengan adanya Al. Matsunaga et al. (1998) mengelompokan tanaman toleran dan peka Al menjadi 3 kelompok berdasarkan kriteria akumulasi Al yaitu pengeklusi Al, pengakumulasi Al pada akar dan pengakumulasi Al Tanaman toleran mampu menurunkan keracunan H+ sehingga dapat meningkatkan aktivitas akar dalam penyerapan N, P, dan K (Osaki et al. 1997). Tanaman pengakumulasi Al mampu memacu akumulasi unsur-unsur lain seperti P, S, dan Si dalam daun (Matsunaga et al. 1998). Fenomena tersebut menunjukkan bahwa tanaman yang toleran Al memiliki efisiensi dalam penyerapan unsur hara kondisi cekaman Al. dalam

Genetika dari Sifat Toleransi Aluminium Menurut Nasution dan Suhartini (1992) padi gogo memiliki keragaman genetik yang besar untuk sifat toleran terhadap cekaman Al. Padi yang berasal dari daerah masam dan berumur panjang lebih toleran terhadap cekaman Al. Keragaman genetik dapat membantu untuk menyeleksi tanaman sesuai dengan sifat yang diinginkan. Tanpa keragaman genetik seleksi yang dilakukan tidak akan efektif. Toleransi tanaman terhadap cekaman Al dikontrol baik oleh gen tunggal maupun sejumlah gen. Pada tanaman gandum (Triticum aestivum L) atau rye (Secale cereale L), sifat toleran Al ditentukan oleh satu atau beberapa gen. Sebaliknya, pada tanaman padi resistensi cekaman Al dikontrol oleh beberapa gen (Wu et al. 2000 ;

Nguyen et al. 2001). Tanaman rye lebih toleran terhadap cekaman Al dibandingkan gandum. Walaupun demikian tanaman gandum merupakan jenis tanaman pertanian yang diteliti secara komprehensif untuk mengetahui mekanisme toleransi tanaman terhadap Al baik secara morfologi, fisiologi sampai molekuler. Mekanisme toleran cekaman Al bervariasi antar jenis tanaman. Keanekaragaman gen toleran tanaman terhadap Al telah dilaporkan pada beberapa spesies tanaman pertanian terutama tanaman serealia dari famili Triticeae (Vitorello et al. 2005). Toleransi Al pada tanaman rye (Secale cereale L) dikendalikan oleh gen tunggal Alt3 yang terletak pada kromosom 4RL. Gen Alt3, AltBH pada gandum dan Alp pada barley, yang semuanya mengendalikan toleransi cekaman Al terpaut dengan penanda molekuler BCD1230 (Miftahudin et al. 2002). Berdasarkan hubungan homeologous diantara anggota Triticeae, Miftahudin et al. (2002) menduga bahwa gen-gen toleran cekaman Al tersebut kemungkinan memiliki fungsi yang sama dalam mengendalikan sifat toleransi cekaman Al. Sifat toleran Al pada padi dikendalikan oleh banyak gen (Cutrim et al. 1981). Wu et al (1997) melaporkan bahwa toleransi padi terhadap keracunan Al lebih banyak dipengaruhi oleh gen-gen yang bersifat aditif. Seleksi sifat yang dikontribusikan oleh gen-gen aditif ini lebih sulit dilakukan, karena kontribusi masing-masing gen hanya memberikan sumbangan sebagian saja pada karakter yang diamati. Gen-gen toleran Al pada padi tidak mengumpul di satu kromosom tetapi terdapat pada lebih dari satu kromosom. Sehingga pemulia tanaman dapat merakit tanaman toleran Al yang mengandung banyak gen (Nguyen et al. 2001). Menurut Nguyen et al. (2002) QTL (Quantitative Trait Loci) untuk panjang akar ketika tercekam Al terdapat pada kromosom 1,6,7 dan 9. QTL pada kromosom 3 memiliki efek yang paling besar dengan gen utama toleran Al (Nguyen et al. 2003). Menurut Prasetiyono et al. (2003) dalam analisis marka tunggalnya mendapatkan 2 marka mikrosatelit pada kromosom (RM248 dan RM445) yang diduga terpaut dengan sifat toleran terhadap cekaman Al dari genetik persilangan padi Dupa dan ITA131. Sedangkan hasil analisis marka interval belum ditemukan marka-marka yang menggambarkan adanya posisi QTL. Adanya variasi genetik sifat toleran Al pada padi (Oryza sativa L) yang telah dilaporkan oleh (Khawatida et al. 1996; Jagau 2000), tetapi belum ditemukan gen yang

berhasil diisolasi dan diklon baik tanaman padi maupun serealia lain dalam rangka mencari galur-galur yang toleran terhadap cekaman Al. Ukuran kromosom padi yang kecil yaitu 430 juta nukleotida (Shen et al. 2004), maka padi dapat dijadikan harapan untuk diisolasi dan diklon gen-gen toleran terhadap cekaman Al. Gen-gen toleran Al tersebut dapat ditentukan melalui pendekatan (a) identifikasi lokus toleran Al seperti pemetaan molekuler; (b) isolasi dan karakterisasi gen-gen yang diinduksi selama cekaman Al; (c) produksi dan evaluasi tanaman mutan; dan (d) memanfaatkan tanaman transgenik dalam studi toleran Al (Samac & Tesfaye 2003)

Simple Sequence Repeats Marka Simple Sequence Repeats (SSR) merupakan marka yang berasal dari sekuen DNA yang bermotif pendek dan berulang secara tandem dengan 2 sampai 5 unit nukleotida yang tersebar dan meliputi seluruh genom, terutama pada organisme eukariotik (Azrai 2005). Adanya bentuk sekuen DNA sederhana yang berulang-ulang menjadikan marka SSR sering disebut short tandem repeat (STRs), simple sequence length polymorphisms (SSLPs) atau mikrosatelit yang sekarang menjadi salah satu marka paling banyak digunakan dalam pemetaan genetik, analisis keragaman genetik dan studi evolusi (Temnykh et al. 2000). Kelebihan-kelebihan marka SSR dibandingkan dengan marka molekuler lain menurut Powell et al. (1996) antara lain : (1) marka terdistribusi secara melimpah dan merata dalam genom dengan variabilitas yang sangat tinggi (banyak alel dalam lokus), bersifat kodominan dan menempati lokasi tertentu pada genom. (2) merupakan alat uji yang memiliki reproduksibilitas dan ketepatan yang sangat tinggi. (3) merupakan alat bantu yang akurat untuk membedakan genotipe, evaluasi kemurnian benih, pemetaan, dan seleksi genotip untuk karakter yang diinginkan. (4) dapat digunakan untuk studi genetik populasi dan analisis diversitas genetik Marka SSR sangat bermanfaat sebagai marka genetik karena dapat mendeteksi keragaman alel pada level yang tinggi, mudah dan ekonomis dalam pengaplikasiannya

dengan menggunakan proses PCR (Prasetiyono et al. 2003). Penggunaan marka DNA sebagai alat bantu seleksi (Marker Assisted Selection/MAS) lebih menguntungkan dibandingkan dengan seleksi secara fenotipik (Azrai 2005). Marka ini banyak digunakan untuk karakterisasi dan pemetaan genetik tanaman seperti padi, anggur, kedelei, jewawut, gandum dan tomat (Gupta et al. 1996 ; Powell et al. 1996).

METODOLOGI

Waktu dan Tempat Penelitian dilakukan di Laboratorium Fisiologi dan Biologi Molekuler, Departemen Biologi FMIPA-IPB Rumah Kaca Cikabayan IPB, Darmaga-Bogor dan Laboratorium Biologi Molekuler BB-Biogen. Penelitian dilaksanakan pada bulan Mei 2007 sampai November 2008.

Bahan Tanaman Bahan tanaman adalah 2 varietas tanaman padi IR64 (peka aluminium), Hawarabunar (toleran aluminium) serta generasi F1 dan F2 hasil persilangan dari IR64 dan Hawarabunar. Deskripsi kedua varietas tersebut seperti pada Lampiran 1 dan Lampiran 2 Alir Penelitian Penelitian ini melibatkan percobaan kultur hara dan percobaan pot untuk mendapatkan data fisiologi, agronomi dan molekuler. Alir penelitian disajikan pada Gambar 1.Kecambah Padi

Kultur Hara Penanaman Tetua, F1, F2 di Tanah Asam

Data Fisiologi Analisis Segregasi Data Agronomi

Isolasi DNA Uji kualitas dan kuantitas DNA Analisis Keterpautan

PCR Analisis Marka Molekuler

Elektroforesis

Data Molekuler

Gambar 1 Bagan alir pelaksanaan penelitian.

Metode Penelitian 1. Cekaman Al and Pengukuran Pertambahan Panjang Akar Benih padi tetua, F1 (persilangan IR64 dangan Hawarabunar) dan F2 direndam dalam larutan kloroks (Byclean) 0,5% selama 15 menit. Setelah dicuci dengan air destilata, biji direndam selama 24 jam dalam air destilata pada suhu ruang dan keadaan gelap. Selanjutnya benih dikecambahkan pada kertas merang lembab selama 3 hari pada suhu ruang. Setelah berkecambah (panjang 10-20 mm), benih tetua, F1 dan F2 ditanam pada tabung falcon 15 mm kemudian diapungkan di atas media kultur hara minimum dengan pH 4,0 (Miftahudin et al. 2002) (Lampiran 3) selama 24 jam dan dilanjutkan selama 72 jam dalam media mengandung 15 ppm Al. Larutan hara diberi aerasi dan pH larutan dipertahankan setiap hari dengan penambahan 1 N HCl. Perlakuan cekaman Al dilakukan di ruang kultur (growth chamber) dengan suhu 25o C dan pencahayaan 300 PPFD (photo proton fluk density) selama 12 jam setiap hari. Pertambahan panjang akar (PPA) utama diukur pada tiap kecambah sebagai selisih panjang akar sebelum dan setelah mendapat cekaman 15 ppm Al selama 72 jam.

2. Analisis Karakter Agronomi Kecambah dari penanaman di kultur hara selanjutnya ditanam secara gogo di tanah Podsolik Merah Kuning Jasinga yang mengandung Aldd 2.77 cmol (+)/kg atau 74.79 ppm dengan pH 4.8 ( Lampiran 4). Pengamatan dilakukan terhadap tinggi tanaman, jumlah butir bernas per malai, jumlah butir hampa per malai dan bobot 1000 butir pertanaman. Tinggi tanaman (cm) diukur dari pangkal rumpun sampai ujung daun tertinggi ditangkup ke atas dan dilakukan setelah tanaman berumur 2.5 bulan (50% tanaman berbunga), sedangkan jumlah butir bernas per malai, jumlah butir hampa per malai dan bobot 1000 butir diamati setelah panen.

3. Analisis Marka Molekuler 3.1 Isolasi DNA DNA diisolasi dari daun muda tanaman padi tetua, F1 dan F2 yang berumur 4 minggu. Isolasi DNA dilakukan menurut metode Saghai-Maroof et al. (1984). Seberat 1.5 g 2 g daun digerus dengan mortar sampai halus dengan ditambahkan nitrogen cair dan dimasukkan dalam tabung sentrifugasi 15 ml dan ditambahkan 9 ml CTAB (dH20,

1M Tris HCl, 5M NaCl, 0.5 ETDA pH 8.0, 14M BME, CTAB) . Larutan dibolak balik dan dimasukkan dalam waterbath pada suhu 65oC, inkubasi selama 60-90 menit pada suhu tersebut (setiap 10 menit tabung dibolak-balik secara perlahan). Larutan didinginkan selama 4-5 menit pada suhu ruang, ditambahkan 4.5 ml kloroform isoamil Alkohol (CIAA) dengan perbandingan 24:1 (v/v), tabung dibolak-balik secara perlahan selama 10 menit dan disentrifugasi selama 30 menit pada kecepatan 4000 rpm. Fase atas diambil dan dimasukkan ketabung sentrifugasi baru 15 ml. Mengulangi dengan ditambahkan kloroform isoamil alkohol (CIAA) sebanyak 4.5 ml, tabung dibolak-balik secara perlahan selama 10 menit. Larutan kemudian disentrifugasi selama 30 menit pada kecepatan 4000 rpm. Fase atas diambil dan dimasukkan ke tabung sentrifugasi baru 15 ml. Larutan ditambahkan 6 ml isopropanol dingin dan dibolak-balik secara perlahan selama 10 menit. Benang-benang DNA diambil dengan glass hook steril dan dikeringkan di suhu ruang selama 45 menit. Dimasukkan ke dalam tabung efendorf 2 ml yang sudah berisi 1 ml TE (Tris HCl 1M pH 8.0, ETDA 0.5 M pH 8.0, aquades) dan dibiarkan selama 5 menit kemudian digoyang perlahan hingga DNA lepas dari glass hook. Ditambahkan 50 l RNAse dari 10 mg/ml dan didiamkan selama semalam (over nigth). Tabung dibolak-balik hingga DNA larut (untuk DNA yang belum larut diinkubasi kembali sampai DNA larut semua). Kemudian ditambahkan 1 ml fenol, dibolak-balik secara perlahan selama 10 menit, kemudian disentrifugasi dengan 13000 rpm selama 15 menit. Setelah selesai sentrifugasi, fase cair diambil dan dimasukkan ke dalam tabung efendorf baru dan ditambahkan kloroform isoamil alkohol (CIAA) 1 ml dan disentrifugasi lagi pada kecepatan 12000 rpm selama 15 menit. Fase cair diambil dengan pipet dan dimasukkan dalam tabung efendorf 2 ml baru, ditambahkan 40 l NaCl 5 M dan 2 ml EtOH absolut dingin dan dibolak-balik perlahan hingga terlihat benang-benang DNA. Benang-benang DNA diambil dengan glass hook steril dan dimasukkan ke dalam tabung yang berisi 1 ml WASH 1 dan dibiarkan selama 20 menit agar DNA bersih. Setelah itu glass hook yang terdapat DNA dipindahkan ke dalam tabung efendorf yang ditambahkan 1 ml WASH 2 selama 1 menit dan kemudian dimasukkan ke dalam tabung efendorf 1.5 ml yang berisi 300 l TE dan digoyanggoyang hingga DNA lepas dari glass hook dan disimpan semalam pada suhu kamar. Hasilnya disimpan pada suhu 4oC.

3.2 Kuantifikasi DNA Analisis ini bertujuan untuk mengetahui kuantitas DNA. Prosesnya dapat dilakukan dengan mengencerkan suspensi DNA hasil isolasi dengan mengambil 5 l dalam 745 l TE. Pencampuran dapat dilakukan di tabung ependorf. Memasukkan campuran ke dalam cuvet dan membaca absorbansinya dengan spektrofotometer pada panjang gelombang 260 nm. PenyanggaTE (Tris HCl 1M pH 8, EDTA 0.5 M pH 8, Aquades) digunakan sebagai blanko. Konsentrasi DNA dihitung dengan rumus : (OD260 x 50 x Faktor pengenceran) / 1000. 3.3 Kualitas DNA Kualitas DNA dilakukan dengan elektroforesis DNA pada gel agarose 0.8%. Analisis ini dilakukan dengan mengambil 1-2 l DNA (konsentrasi 50 ng/ l dan mencampur dengan larutan pewarna (Bromofenol blue 2.5%, sukrosa 40%). Menyertakan pula secara terpisah DNA penanda kuantitas (biasanya DNA lamda utuh dengan konsentrasi 10 ng/l). Banyaknya DNA penanda sangat tergantung dari perkiraan DNA yang akan dianalisis. Melakukan elektroforesis sampai larutan pewarna menjauhi sumur. Elektroforesis dilakukan sekitar 30 menit, voltase 65 volt dengan buffer TBE (1xTBE, Tris Base, Boric acid, 0.5 M ETDA) kemudian melihat gel di atas UV. Proses ini diakhiri dengan pengambilan gambar pita-pita DNA dengan GelDOC. Kemurnian DNA diukur berdasarkan nilai absorbansi 260 nm terhadap absorbansi 280 nm dengan rumus OD260/OD280. Jika rasio terletak antara 1.8 sampai dengan 2.0 maka DNA tersebut relatif murni dan terbebas dari kontaminan protein.

3.4 PCR (Polymerase Chain Reaction) DNA tetua, F1 dan F2 diamplifikasi pada mesin PCR. Reaksi PCR dilakukan dengan ESCO Switf Maxy Thermal Cycle (USA). Primer yang digunakan dari marka molekuler simple sequence repeats (SSR) sebanyak 21 pasang primer (Lampiran 4 dan 5). Komponen dari reaksi PCR yang digunakan seperti tercantum pada Tabel 1. Tabel 1 Komponen PCR yang digunakan untuk amplifikasi DNA dengan primer SSR. Komponen PCR 10xbuffer (+Mg) Konsentrasi Stok 10X Volume (l) 1 l Konsentrasi Akhir 1x

dNTP 2mM Taq Polymerase Aquabidest DNA Primer F Primer R Total Reaksi

2 mM 5U/l 50 ng/l 10 M 10 M

0.5 l 0.1 l 5.4 l 2 l 0.5 l 0.5 l 10 l

0.1 mM 0.5 U 50 ng/l 0.2 M 0.2 M

Kondisi PCR: 94oC, 5 menit (pradenaturasi); 94oC, 45 detik (denaturasi); 55oC, 45 detik (penempelan primer); 72oC, 1.5 menit (pemanjangan primer ) sebanyak 35 siklus , 72oC 10 menit (pasca PCR) dan Inkubasi 4oC 59 menit. Produk amplifikasi dipisahkan dengan elektroforesis pada 3% superfine resolution agarose (SFR) menggunakan bufer TBE 1X, Voltage 85 selama 2.5 sampai 3 jam. Visualisasi pita DNA dilakukan dengan merendam gel pada larutan etidium bromida (0.5 ug/ml) dan diamati di atas UV transiluminator dan direkam/foto dengan GelDOC

3.5 Analisis Data Untuk keperluan analisis data molekuler, pola pita DNA pada tetua, F1 dan F2 diskor dengan ketentuan sebagai berikut: 1 = pola pita sama posisinya dengan posisi pita dari tetua atau grup toleran (homozigot) 2 = pola pita sama posisinya dengan posisi pita dari tetua atau grup sensitife (homozigot) 3 = pola pita memiliki pita dari kedua tetua (heterozigot) Selanjutnya dilakukan analisis segregasi terhadap data fisiologi, tinggi tanaman, jumlah butir bernas, jumlah butir hampa dan bobot 1000 butir, dan pola pita SSR menggunakan uji Khi-Kuadrat pada = 0.05. Analisis keterpautan antara marka molekuler dan karakater toleransi Al didasarkan pada analisis marka tunggal dengan menggunakan software QTL Cartographer versi 2.0 ( Wang et al. 2003).

HASIL DAN PEMBAHASAN

Respon Tanaman Padi terhadap Cekaman Al Respon tanaman padi terhadap cekaman Al dapat dilihat melalui pertumbuhan akar. Percobaan menggunakan kecambah padi peka (IR64) dan toleran Al (Hawarabunar) berumur 2 minggu yang ditumbuhkan pada media kultur hara yang mengandung 15 ppm Al menunjukkan respon pertambahan panjang akar yang berbeda (Tabel 2). Padi var. Hawarabunar mengalami pertambahan panjang akar rata-rata sebesar 24 mm (46.99%), sedangkan IR64. hanya mengalami pertambahan panjang akar rata-rata sebesar 13.3 mm (29.13%). Pada kondisi cekaman Al. akar padi Hawarabunar mampu untuk tumbuh lebih cepat dan lebih panjang dibanding akar IR64. Seperti diketahui Hawarabunar adalah padi toleran Al sedangkan IR64 adalah padi peka Al (Jagau 2000). Samuel et al. (1997) menyatakan bahwa kriteria suatu tanaman toleran terhadap cekaman Al adalah akar mampu untuk tumbuh terus dengan ujung akar yang tidak mengalami kerusakan. Tabel 2 Respon Pertambahan Panjang Akar dari padi varietas IR64 dan Hawarabunar terhadap cekaman 15 ppm Al selama 72 jam.Karakter Fisiologi Pertambahan Panjang Akar Sebelum Cekaman 32.5 IR64 (mm) Setelah Cekaman 45.8 Selisih 13.3 % selisih 29.13 Hawarabunar (mm) % Sebelum Setelah Selisih selisih Cekaman Cekaman 27.1 51.1 24 46.99

Dari pengamatan kisaran nilai pertambahan panjang akar padi varietas IR64 dan Hawarabunar pada populasi F2 diperoleh nilai 22 mm sebagai pembatas antara padi peka dan toleran Al. Jika nilai PPA dibawah 22 mm tanaman digolongkan dalam kelompok tanaman peka Al, sedangkan jika nilai PPA sama atau diatas 22 mm tanaman digolongkan dalam kelompok tanaman toleran Al. Hasil uji t-student (Lampiran 6) selisih PPA dua populasi IR64 dan Hawarabunar di tanah asam dan kontrolnya menunjukan perbedaan nyata pada =5%. Berdasarkan hal tersebut maka karakter pertambahan panjang akar padi selama mendapat cekaman Al dapat digunakan sebagai parameter sifat toleransi Al. Pertambahan panjang akar IR64 yang jauh berbeda dibanding Hawarabunar disebabkan karena perbedaan sifat dari kedua varietas dalam merespon cekaman Al.

Hambatan ini disebabkan karena adanya akumulasi Al pada daerah perakaran. sehingga menyebabkan rusaknya sel tudung akar. Permukaan akar yang rusak biasanya berwarna kecoklatan dan mudah patah (Marschner 1995). Pada inti sel tudung akar Al akan mempengaruhi DNA dan akibatnya pembelahan sel terhambat (Matsumoto 1991). Untuk mengetahui respon tanaman padi terhadap cekaman Al pada tanah asam. maka padi IR64 dan Hawarabunar ditanam secara gogo pada tanah asam (Lampiran 7) Podsolik Merah Kuning Jasinga dengan pH 4.8 dan Aldd sebesar 2.77 cmol(+)/kg atau 74.79 ppm (Lampiran 8) Tinggi tanaman. jumlah butir hampa per malai. jumlah butir bernas per malai. dan bobot 1000 butir diamati sebagai karakter fisiologi dan agonomi. Hasil percobaan menunjukkan bahwa secara umum kedua varietas mengalami penurunan pertumbuhan dan komponen produksi kecuali jumlah butir hampa yang mengalami peningkatan (Tabel 3). Tabel 3 Rata-rata nilai Pertumbuhan dan Komponen Produksi Padi varietas IR64 dan Hawarabunar pada Tanah Asam.Karakter Agonomi Tinggi Tanaman Jumlah Butir Hampa per malai Jumlah Butir Bernas per malai Bobot 1000 butir IR64 kontrol 100.7 14.3 89.8 22.6 asam 100.3 20.8 82.9 17.4 t-hit 0.266 1.926 1.553 4.552 P. val 0.794 0.058 0.143 0.001 kontrol 180.4 75.2 178.9 27.2 Hawarabunar asam 174.8 67.6 148.8 24.6 t-hit 1.435 0.797 1.621 1.092 P. val 0.172 0.438 0.126 0.292

Hasil pengamatan terhadap tanaman padi pada tanah asam (Tabel 3) diperoleh rata-rata tinggi tanaman pada tetua IR64 dan Hawarabunar berturut-turut adalah 100.3 cm dan 174.8 cm. Jika dibandingkan dengan kontrol secara berturut-turut tinggi tanaman kedua tetua adalah 100.7 cm dan 180.4 cm. Berdasarkan hasil uji t-student (=5%) (Lampiran 9) pada (Tabel 3) perlakuan tanah asam tidak menyebabkan penurunan yang nyata dari tinggi tanaman pada kedua varietas. Hal ini mengindikasikan bahwa tinggi tanaman tidak dipengaruhi oleh perlakuan tanah asam (Cekaman Al). Sehingga peubah tinggi tanaman tidak dapat dijadikan parameter toleransi terhadap cekaman Al (tanah asam) pada tanaman padi. Jumlah butir hampa per malai dari kedua varietas yang ditanam pada tanah asam (Tabel 3) diperoleh rata-rata sebesar 20.80 butir dan 67.6 butir berturut-turut untuk IR64 dan Hawarabunar. Jika dibandingkan dengan kontrol secara berturut-turut jumlah butir

hampa per malai kedua tetua adalah 14.3 butir dan 75.2 butir. Dari uji t-student pada (=5%) bahwa perlakuan tanah asam (Tabel 3) tidak menyebabkan penurunan atau peningkatan yang nyata dari jumlah butir hampa per malai pada kedua varieats. Hasil ini menunjukan bahwa perlakuan tanah asam (Cekaman Al) tidak mempengaruhi jumlah butir hampa per malai. Sehingga peubah ini tidak dapat dijadikan parameter toleransi terhadap cekaman Al pada tanaman padi. Rata-rata jumlah butir bernas permalai pada perlakuan tanah asam (Tabel 3) untuk tetua IR64 dan Hawarabunar masing-masing adalah 82.9 butir dan 148.8 butir. Jika dibandingkan dengan kontrol secara berturut-turut jumlah butir bernas per malai kedua tetua adalah 89.8 butir dan 178.9 butir. Hasil Uji t-student (Tabel 3) pada =5% menunjukan perlakuan tanah asam tidak menyebabkan penurunan yang nyata dari jumlah butir bernas per malai pada kedua varietas. Berdasarkan hasil ini dapat disimpulkan bahwa jumlah butir bernas per malai tidak dipengaruhi oleh perlakuan cekaman Al (tanah asam). Kondisi ini menunjukan bahwa peubah jumlah butir bernas per malai tidak dapat dijadikan parameter toleransi terhadap tanah asam pada tanaman padi Perlakuan tanah asam (Tabel 3) diperoleh rata-rata bobot 1000 butir pada tetua IR64 dan Hawarabunar masing-masing adalah 17.4 g dan 24.6 g. Jika dibandingkan dengan kontrol secara berturut-turut bobot 1000 butir kedua tetua adalah 22.6 g dan 27.2 g. Hasil uji t-student (=5%) pada (Tabel 3) menunjukan bahwa bobot 1000 butir pada IR64 dipengaruhi oleh kondisi tanah asam dan ini tidak berpengaruh pada bobot 1000 butir varietas Hawarabunar. Hal ini menunjukan bahwa peubah bobot 1000 butir dapat digunakan sebagai parameter toleransi Al pada padi. Jagau (2000) melaporkan bahwa beberapa padi gogo lokal seperti Gogol. Krowal dan Hawarabunar mempunyai kemampuan dapat tumbuh dan berproduksi dengan baik dalam kondisi tercekam Al pada tanah asam. Analisis Segregasi Karakter Fisiologi dan Agonomi Pertambahan Panjang Akar. Pola segregasi karakter pertambahan panjang akar ( PPA) pada populasi F2 menunjukkan bahwa sebanyak 128 tanaman memiliki nilai PPA mengikuti nilai PPA tetua 1 (IR64), sedangkan 238 tanaman mengikuti nilai PPA tetua 2 (Hawarabunar) (Tabel 4). Untuk mengetahui apakah rasio fenotipe mengikuti pola pewarisan gen tunggal (3:1) maka dilakukan Uji Ki-Kuadrat. Berdasarkan uji

tersebut didapatkan bahwa nilai 23:1

hitung

(19.41) lebih besar dari

23:1

Tabel

(3.811)

pada db=1 dan =5%. Dari analisis 2 gen (dihibrid) nilai Khi-Kuadrat untuk rasio 15:1 dan 9:7 diperoleh 2hitung lebih besar dibanding dengan 2Tabel (Tabel 4). Dari pengujian tersebut dapat disimpulkan bahwa segregasi PPA pada populasi F2 tidak mengikuti pewarisan gen tunggal maupun 2 gen. Analisis sebaran karakter PPA pada populasi F2 menunjukan sebaran normal dengan nilai tengah sebesar 20 mm (Gambar 2). Hal ini membuktikan bahwa karakter PPA bersifat poligenik. Tabel 4 Uji Ki-Kuadrat dari pola segregasi parameter fisiologi dan agonomi populasi F2 1 gen dan 2 gen.Parameter fisiologi dan agonomi Pertambahan Panjang Akar Tinggi Tanaman Jumlah Butir Hampa per malai Jumlah Butir Bernas per malai Bobot 1000 Butir Jumlah tanaman dengan fenotipe IR64 128 9 60 245 205 HB 238 370 319 134 174 Jumlah total tanaman 366 379 379 379 379 19.41 103.47 16.99 21.68 88.38 515.32 9.71 59.38 547.97 1017.42 11.46 263.65 120.04 10.85 0.72 23:1hitung

215 :1hitung

29:7hitung

22 kelas fenotif Tabel

3.811 3.811 3.811 3.811 3.811

Tinggi Tanaman. Populasi F2 menunjukkan bahwa sebanyak 9 tanaman memiliki nilai tinggi tanaman mengikuti nilai tinggi tanaman tetua 1 (IR64), sedangkan 370 tanaman mengikuti nilai tinggi tanaman tetua 2 (Hawarabunar) (Tabel 4). Berdasarkan uji Ki-Kuadrat didapatkan bahwa nilai 23:1 hitung (103.47) lebih besar dari 23:1 Tabel (3.811) pada db=1 dan =5%. Dari analisis 2 gen (dihibrid) nilai KhiKuadrat untuk rasio 15:1 dan 9:7 diperoleh 2hitung lebih besar dibanding dengan 2Tabel (Tabel 4). Dari hasil tersebut dapat disimpulkan bahwa segregasi karakter tinggi tanaman pada populasi F2 tidak mengikuti pewarisan gen tunggal maupun 2 gen. Analisis sebaran karakter tinggi tanaman pada populasi F2 menunjukan sebaran normal dengan nilai tengah sebesar 125.8 cm (Gambar 3). Hal ini membuktikan bahwa karakter tinggi tanaman bersifat poligenik

70 60 50

IR64

HB

Frekuensi

Frekuensi

40 30 20 10 0

0

6

12

18

24

30

36

Pertambahan panjang akar (mm) Pertambahan panjang akar (mm)

Gambar 2 Distribusi normal pertambahan panjang akar pada populasi F2 hasil persilangan IR64 dengan Hawarabunar.

50

IR6440

HB

Frekuensi

Frekuensi

30

20

10

0

90

100

110

Tinggi tanaman (cm)

120 130 140 Tinggi Tanaman (cm)

150

160

Gambar 3 Distribusi normal tinggi tanaman pada populasi F2 hasil persilangan IR64 dengan Hawarabunar. Jumlah Butir Hampa. Segregasi karakter pada populasi F2 untuk jumlah butir hampa per malai menunjukkan bahwa sebanyak 60 tanaman memiliki nilai jumlah bji hampa mengikuti nilai jumlah butir hampa per malai tetua 1 (IR64), sedangkan 319 tanaman mengikuti nilai jumlah butir hampa per malai tetua 2 (Hawarabunar) (Tabel 4). Berdasarkan uji Ki-kuadrat

didapatkan bahwa nilai 23:1 hitung (16.99) lebih besar dari 23:1 Tabel (3.811) pada db=1 dan =5%. Dari analisis 2 gen (dihibrid) hasil uji Khi-Kuadrat untuk rasio 15:1 dan 9:7 diperoleh 2hitung lebih besar dibanding dengan 2Tabel (Tabel 4). Artinya segregasi jumlah butir hampa per malai pada populasi F2 tidak mengikuti pewarisan gen tunggal maupun 2 gen. Analisis sebaran karakter jumlah butir hampa per malai pada populasi F2 menunjukan sebaran normal dengan nilai tengah sebesar 50.8 butir (Gambar 4). Hal ini membuktikan bahwa karakter jumlah butir hampa per malai bersifat poligenik70 60 50

IR64

HB

Frekuensi Frekuensi

40 30 20 10 0

30

60

90 120 150 Jumlah butir hampa per malai Jumlah butir hampa per malai

180

210

Gambar 4 Distribusi normal jumlah butir hampa per malai pada populasi F2 hasil persilangan IR64 dengan Hawarabunar. Jumlah Butir Bernas. Pola segregasi karakter pada populasi F2 untuk jumlah butir bernas per malai menunjukkan bahwa sebanyak 245 tanaman memiliki nilai jumlah bji bernas mengikuti nilai jumlah butir bernas per malai tetua 1 (IR64), sedangkan 134 tanaman mengikuti nilai jumlah butir bernas per malai tetua 2hitung 2

(Hawarabunar) (Tabel 4). Hasil uji Ki-Kuadrat menunjukan bahwa nilai 23:1 (21.68) lebih besar dari 3:1 Tabel

(3.811) pada db=1 dan =5%. Dari analisis 2 gen

(dihibrid) hasil uji Khi-Kuadrat untuk rasio 15:1 dan 9:7 diperoleh 2hitung lebih besar dibanding dengan 2Tabel (Tabel 4). Dengan demikian dapat disimpulkan bahwa karakter jumlah butir bernas per malai pada populasi F2 tidak mengikuti pola pewarisan gen tunggal maupun 2 gen. Analisis sebaran karakter jumlah butir bernas per malai pada populasi F2 menunjukan sebaran normal dengan nilai tengah sebesar 82.1 butir (Gambar

5). Hal ini membuktikan bahwa karakter jumlah butir bernas poligenik

per malai bersifat

Bobot 1000 Butir. Populasi F2 menunjukkan bahwa sebanyak 205 tanaman memiliki nilai sedangkan 174 bobot 1000 butir mengikuti nilai bobot 1000 butir tetua 1 (IR64), tanaman mengikuti nilai bobot 1000 butir tetua 2 (Hawarabunar)2 3:1 hitung

(Tabel 4). Uji Ki-Kuadrat terhadap pola segregasi karakter bobot 1000 butir menunjukkan bahwa nilai (171.05) lebih besar dari 23:1Tabel

(3.811) pada

db=1 dan =5%. Dari analisis 2 gen (dihibrid) hasil uji Khi-Kuadrat untuk rasio 15:1 diperoleh 2hitung lebih besar dibanding dengan 2Tabel (Tabel 4), akan tetapi untuk rasio 9:7 diperoleh 2hitung lebih kecil dibanding dengan 2Tabel . Hasil ini mengindikasikan bahwa nilai bobot 1000 butir dikendalikan oleh 2 gen.120

IR64100

HB

80

Frekuensi Frekuensi

60

40

20

0

0

75

150

225 300 375 Jumlah butir bernas malai Jumlah butir bernas perper malai

450

525

Gambar 5 Distribusi normal jumlah butir bernas per malai populasi F2 hasil persilangan IR64 dengan Hawarabunar Analisis Marka Molekuler Marka molekuler yang digunakan dalam penelitian ini adalah marka SSR yang tersebar di kromosom 2 (sebanyak 14 marka) dan 3 (sebanyak 7 marka). Primer-primer tersebut digunakan untuk mengamplifikasi DNA dari 379 tanaman F2. Marka SSR bersifat kodominan sehingga dapat membedakan genotipe heterozigot dan homozigot, Alel-alel SSR dapat mendeteksi segregasinya pada populasi F2. Berdasarkan hasil PCR yang dipisahkan pada gel elektroforesis (Gambar 6) dilakukan skoring dengan membandingkan antara pita-pita populasi F2 dengan kedua tetua dan F1-nya.

37 36 35 33 32 31 30 29 28 27 26 25 24 22 21 20 MF1 HB IR19 18 17 16 15 14 13 11 10 8 7 6 5 4 3 2

77 76 75 74 72 71 68 67 66 65 63 62 61 60 59 58M F1 HBIR57 56 55 5150 49 48 4746 4544 43 4240 39 38

115114112110109108105104103102101100MF1HB IR 99 97 96 95 92 90 89 88 87 86 85 83 81 80 79 78

Gambar 6 Contoh elektroforesis hasil PCR marka SSR RM452 pada gel agarose superfiner 3% dalam buffer TBE 1x Hasil uji 2 untuk pola segregasi 1:2:1 (homozigot sensitif : heterozigot : homozigot toleran) pada populasi F2 (Tabel 5) memperlihatkan dari 21 marka SSR yang diuji 85.71% bersegregasi mengikuti pola segregasi 1:2:1 atau mengikuti pola pewarisan gen tunggal, sedangkan 14.29% tidak bersegregasi mengikuti pola 1:2:1. Marka yang memiliki segregasi menyimpang ini terdapat pada kromosom 2 (RM341 dan RM250) dan kromosom 3 (RM489). Terjadinya penyimpangan rasio 1:2:1 mengindikasikan bahwa marka tersebut tidak mengikuti pola pewarisan gen tunggal artinya mungkin saja marka-marka tersebut lebih dari satu kopi pada genom padi. Tabel 5 Uji Ki-Kuadrat pada marka molekulerMarka molekuler RM211 RM279 RM555 RM450 RM174 RM452 RM341 RM475 RM526 RM573 2 2 2 2 2 2 2 2 2 2 Kromosom Jumlah tanaman dengan genotipe IR64 87 94 99 83 100 106 59 97 88 102 Heterozigot 207 185 186 188 195 192 197 193 195 193 HB 85 100 94 108 84 81 122 89 96 84 Jumlah tanaman 379 379 379 379 379 379 378 379 379 379 2.25 0.113 0.255 3.32 0.451 1.369 21.622 0.467 0.657 0.619 5.991 5.991 5.991 5.991 5.991 5.991 5.991 5.991 5.991 5.991 21:2:1hitung 21:2:1Tabel

RM112 RM250 RM498 RM138 RM489 RM545 RM517 RM232 RM168 RM570 RM442

2 2 2 2 3 3 3 3 3 3 3

85 104 96 83 149 88 108 96 111 91 95

205 236 194 188 192 210 179 202 191 195 192

88 39 86 108 38 81 92 81 77 92 92

378 379 376 379 379 379 379 379 379 378 379

2.27 12.313 0.123 1.468 65.084 4.693 2.515 2.836 5.427 0.388 0.113

5.991 5.991 5.991 5.991 5.991 5.991 5.991 5.991 5.991 5.991 5.991

Hasil analisis 21 marka yang digunakan dalam penelitian ini menunjukan adanya polymorfisme yaitu pita-pita yang mengikuti sifat homozigot dari varietas IR64 dan varietas Hawarabunar serta heterozigot pada F1-nya. Dalam penelitian sebelumnya, McCouch et al. 2002. mendapatkan marka-marka SSR yang polymorfisme dari 610 marka SSR yang diuji pada padi. Setiap marka yang polymorfisme memperlihatkan band-band dari varietas IR64 dan varietas Kasalath yang dianalisis. Dalam penelitian ini , 14 % marka tidak mengikuti hukum mendel (1:2:1). Hasil ini berbeda dengan penelitian sebelumnya yang menghasilkan 27.27% marka SSR tidak berperilaku seperti mendel (Prasetiyono et al. 2003). McCouch et al. (1988) dari hasil penelitiannya menyatakan bahwa 18% marka SSR yang menyimpang dari perilaku mendel terdapat pada padi.

Analisis Keterpautan antara Marka Molekuler dengan Sifat Toleransi Al pada Padi Marka-marka SSR yang digunakan dalam penelitian ini dipetakan secara genetik dalam kelompok pautan. Peta genetik yang dihasilkan menunjukkan marka-marka tersebut membentuk kelompok pautan dengan total jarak genetik kromosom 1. 2 dan 3 berturut-turut sebesar 161.8. 157.9 dan 224.2 cM (Gambar 7). Rata-rata jarak antar marka untuk kromosom 1. 2 dan 3 berturut-turut sebesar 16.18. 11.28 dan 16.01 cM.

cM

Marka

cM

Marka

cM

Marka

Gambar 7 Peta Genetik 21 marka yang diuji pada kromosom 1, 2, dan 3. Pendekatan analisis marka tunggal digunakan dalam penelitian ini. Pendekatan analisis marka tunggal untuk menguji keterpautan tidak membutuhkan informasi susunan marka pada peta pautan (Prasetiyono et al. 2003). Hasil analisis statistik untuk analisis marka tunggal berdasarkan persamaan regesi linier sederhana dengan uji F pada = 5% yang dilakukan menggunakan progam QTL Cartogapher ver. 2.0 dapat dilihat pada Tabel 6. Untuk identifikasi marka SSR yang terpaut sifat toleransi Al dan karakter agonomi juga digunakan data SSR dari kromosom 1 (Akhmad 2008)

Tabel 6 Keterpautan Karakter Fisiologis pada Kromosom.No Karakter Fisiologi dan Agonomi Pertambahan Panjang Akar Tinggi Tanaman Jumlah Butir Hampa per malai Jumlah Butir Bernas per malai Bobot 1000 Butir Marka OSR13 RM514 RM251 RM231 RM545 RM489 RM174 RM545 RM232 Kromosom P. value 0.019* 0.041* 0.004** 0.046* 0.008** 0.048* 0.029* 0.009** 0.001**

1 2 3 4 5

3 3 3 2 3

Keterangan : **berbeda nyata pada =1%. * berbeda nyata pada =5% Hasil analisis keterpautan dengan QTL Cartogapher menunjukan bahwa OSR13 (7.6 cM). RM514 (35.2 cM). RM251 (79.1 cM) terpaut dengan karakter pertambahan panjang akar. RM231 (11.5 cM) dan RM545 (25.0 cM) terpaut karakter tinggi tanaman. RM232 (76.1 cM) dan RM545 (25.0 cM) terpaut karakter bobot 1000 butir. dan RM489

(20.3 cM) terpaut karakter jumlah butir hampa per malai. Marka-marka tersebut terletak pada kromosom 3. Sedangkan pada kromosom 2 terdapat RM174 (33.1 cM) yang terpaut dengan karakter jumlah butir bernas per malai. Pada penelitian ini tiga marka molekuler untuk pertambahan panjang akar (PPA) dideteksi pada kromosom 3. Hasil ini sesuai dengan hasil penelitian Nguyen et al. (2003) yang mendapatkan QTL toleransi Al pada kromosom 3. Akan tetapi hasil ini berbeda dengan penelitian sebelumnya oleh Mao et al. (2004) dengan menggunakan padi varietas IR1552 yang sensitif Al dan varietas Azuena (toleran Al) untuk memetakan QTL sifat toleran Al. Tiga QTL untuk relatif panjang akar (RPA) dideteksi secara berturut-turut pada kromosom 1, 9, dan 12. Satu QTL untuk panjang akar yang dicekam Al dideteksi pada kromosom 1 setelah 1 minggu dan 2 minggu cekaman Al. Mao et al. (2004) berpendapat bahwa cekaman Al dapat menginduksi biosintesis dari lignin dan komponen-komponen lain dinding sel dari akar. Dua gen yang berhasil dipetakan yaitu satu protein yang belum diketahui fungsinya dan 1 ubiquitin-like protein untuk cekaman Al pada kromosom 1. Dengan menggunakan populasi Backcross Inbred Lines (BILs) dari persilangan Koshihikari dan Kasalath, Ma et al. (2002) di mendeteksi tiga QTL yang diduga mengontrol toleransi Al ditemukan secara berturut-turut pada kromosom 1, 2 dan 6. Alel-alel QTL yang terdapat kromosom 1 dan 2 pada Kasalath menurunkan kemampuan toleransi Al tetapi Wu et al. (2000), telah memetakan QTL dan lokus epistasis karakter toleransi Al untuk relatif panjang akar (RPA) setelah cekaman Al 2 minggu dan 4 minggu. Dua QTL didapatkan juga pada perlakuan Al selama 2 dan 4 minggu pada kromosom 1 dan 12. Sementara QTL pada kromosom 1 hanya terdeteksi pada perlakuan 2 minggu setelah cekaman Al. Nguyen et al. (2002) melakukan pemetaan genetik dengan menggunakan 280 marka DNA. Salah satunya adalah marka SSR untuk menggambarkan posisi dari QTL toleransi terhadap cekaman Al. Tiga karakter yaitu kontrol panjang akar (CRL), panjang akar saat tercekam (SRL) dan rasio panjang akar (RR) telah dievaluasi pada populasi Doubled Haploid (DH) dari persilangan CT9993 dan IR62266 dengan menggunakan larutan hara. Total dari 20 QTL yang mengontrol panjang akar di bawah cekaman Al meningkatkan kemampuan toleransi Al pada kromosom 6.

dan kondisi kontrol (tanpa cekaman Al) ditemukan menyebar pada kromosom 10 dan bersifat multigenik. Marka-marka terpaut sifat toleransi Al yang ditemukan dapat digunakan untuk seleksi tanaman pada progam pemuliaan tanaman untuk mendapatkan varietas toleran Al. Dengan adanya QTL untuk karakter tertentu pada padi dapat diketahui posisi markamarka yang terpaut dengan karakter tersebut pada kromosom.

KESIMPULAN Dari hasil penelitian tentang analisis marka molekular tarpaut karakater sifat tolernasi Al pada populasi F2 persilangan padi IR64 dengan Hawarabunar disimpulkan bahwa: 1. Karakter pertambahan panjang akar dapat digunakan sebagai parameter sifat toleran Al pada padi 2. Secara umum karakter agronomi jumlah tidak dapat dikaitkan dengan sifat toleran aluminium pada padi. 3. Analisis segregasi populasi F2 untuk karakter fisiologi dan agronomi menunjukan pola pewarisan poligenik. Khusus untuk karakter bobot 1000 butir hasil analisis 2 gen (dihibrid) menunjukan bahwa karakter tersebut dikendalikan oleh 2 gen 4. Hasil analisis marka molekuler pada 379 DNA tanaman populasi F2 menunjukkan bahwa 12 dari 14 marka pada kromosom 2 dan 6 dari 7 marka pada kromosom 3 bersegregasi mengikuti pola segregasi 1:2:1. Hasil analisis keterpautan antara marka molekular dan karakter menunjukkan bahwa marka-marka SSR pada kromosom 3 diperoleh marka OSR13, RM514, RM251 terpaut dengan karakter pertambahan panjang akar, RM231 dan RM545 terpaut dengan karakter tinggi tanaman, RM489 terpaut dengan karakter jumlah butir hampa per malai, RM545 dan RM232 terpaut dengan karakter bobot 1000 butir. Sedangkan RM174 pada kromosom 2 terpaut dengan karakter jumlah butir bernas per malai.

SARAN Diperlukan penelitian lanjutan menggunakan marka SSR yang berasal dari kromosom selain 1, 2 dan 3 untuk mendapatkan informasi yang lebih banyak tentang marka molekuler terpaut sifat toleransi terhadap Al dan karakter agronomi pada persilangan padi IR64 dengan Hawarabunar.

DAFTAR PUSTAKA

Akhmad. 2008. Analisis marka molekuler terpaut sifat fisiologi dan tolerans aluminium pada populasi F2 padi. [Thesis]. Bogor : Fakultas Matematika dan Ilmu Pengetahuan Alam, Institut Pertanian Bogor Azrai M. 2005. Pemanfaatan marka molekuler dalam proses seleksi pemuliaan tanaman. J Agro Biogen 1 : 26-37 Bennet J. 1993. Maps and markers. In Genome Analysis of Plant, Pests, and Pathogens. Workshop Handbook. IRRI, Los Banos. P 19-30. CutrimV, Dos A, Nguyen TV, Silva JC, Galvao JD. 1981. Inheritance of tolerance for aluminium in Brazillian rice (Oryza sativa). Rice News Letter. IRRI. Philipines. Delhaize E, Ryan PR. 1993. Aluminum tolerance in wheat (Triticum aestivum L). II. Aluminum-stimulated excretion of malic acid from root apices. J Plant Physiol 103 : 695-702. Delhaize E, Ryan PR. 1995. Aluminum toxicity and tolerance in Plants. Plant Physiol 107 : 315-321 J

Dwinita et al. 2008. Data penelitian pencarian alel penting pada plasma nutfah toleran cekaman biotik dan abiotik. Penel. APBN. BB-BIOGEN Gupta US. 1996. Crop improvement Volume 2: stress tolerance. Science Publishers, Inc. 303 p. Ismunadji M, Partohardjono S. 1985. Program hasil penelitian pengapuran tanah masam untuk peningkatan produksi ianman pangan Balitan. Puslitbangtan. 31 pp. Irfan M. 2008. Sekresi asam malat oleh akar tanaman padi pada kondisi cekaman aluminium. [skripsi]. Bogor : Fakultas Matematika dan Ilmu Pengetahuan Alam, Institut Pertanian Bogor. Jagau Y. 2000. Fisiologi dan pearisan efisiensi nitrogen dalam keadaan cekaman aluminium pada padi gogo (Oryza sativa L). (Desertasi). Institut Pertanian Bogor. Kochian LV. 1995. Cellular mechanism of aluminum toxicity and resistence in plant. Annu Rev Plant Physiol Mol Biol 46: 237-260 Kochian LV. 2000. Molecular Phsiology of Mineral Nutrient Acquisition, Transport and Utilization. Irr. B. Buchanan, W. Gruissem & R. Jones, Eds. Biochemistry & Molecular Biology of Plant. American Society of Plant Physiologists. Maryland. USA

Khatiwada SP, Senadhira D, Carpena AL, Zeigler RS, Fernandez PG. 1996. Variabulity and genetics of tolerance for aluminum toxicity in rice (Oryza sativa L). Theor Appl Genet 93: 738-744 Masunaga T, Kubota D, Hotta M, Wakatsuki T. 1998. Mineral composition of leaves and bark in aluminum accumulators in a tropical rain in Indonesia. Soil Sci Plant Nutr. 44(3):347-358. Manurung, Ismunadji. 1988. Morfologi dan Fisiologi Padi. Badan Penelitian dan Pengembangan Pertanian. Pusat Penelitian dan Pengembangan Tanaman Pangan. Bogor Miftahudin, Scholes GJ, Gustafson JP. 2002. AFLP markers tightly linked to the aluminium tolerance gene Alt3 in rye ( Secale cereale L). Theor Appl Genet 104:626-631 McCouch SR, Tanksley SD. 1991. Development and use of restriction fragment length polymorphism in rice breeding and genetics. p. 109-133. In Khush GS and Toenniessen GH (Eds.). Rice Biotechnology. IRRI. Los Banos, Philippines. McCouch SR et al. 1988. Moleculer mapping of rice nuclear genome. Theor Appl Genet. 76:815-829 McCouch SR et al. 2002. Development and mapping of 2240 new SSR marker for rice (Oryza sativa L.). DNA Research. 9: 199-207 Matsumoto H. 1991. Biochemical mechanism of the toxicity of aluminum and the sequestration of aluminum in plant cells. In Wright RJ et al (Ed) . Plant-Soil Interactions at Low pH. Kluwer Academic Publ. Dordrecht, The Netherlands, pp 825-838 MacDiarmid CW, Gardner RC. 1996. Al toxicity in yeast. A role for Mg. Plant Physiol 112:1101-1109 Miyasaka SC, Buta JG, Howell RK, Foy CD. 1991. Mechanism of aluminium tolerance in snapbeans : root exudation of citric acid. Plant Physiol. 96 : 737 743. Ma Q, Rengel Z, Kuo J. 2002. Short communication: Aluminum toxicity in rye (Secale cereale): root growth and dinamics of cytoplasmic Ca2+ in intac root tips. Ann Bot 89:241-244. Mao et al. 2004. Comparative mapping of QTL for Al tolerance in rice and identification of positional Al-induced genes. J Zhejiang Univ SCI 5:634-643 Nurlaela. 2008. Distribusi dan akumulasi Al pada akar padi dalam kondisi cekaman Al pada larutan hara. [skripsi]. Bogor : Fakultas Matematika dan Ilmu Pengetahuan Alam, Institut Pertanian Bogor.

Nasution I, Suhartini T. 1992. Evaluasi metode uji ketahanan kultivar padi gogo terhadap tanah masam. Prosiding Lokakarya Penelitian Komoditas dan Studi Khusus 1991. AARP-Badan Penelitian dan Pengembangan Pertanian bekerja sama dengan Direktorat Jenderal Pendidikan Tinggi, Jakarta. hlm. 65-80. Nguyen VT et al. 2001. Molecular mapping of genes conferring aluminum tolerance in rice (Oryza sativa L.) Theor Appl Genet. 102: 1002-1010. Nguyen VT et al. 2002. Mapping of genes controlling aluminum tolerance in rice : Comparison of different genetic backgrounds. Molec Genet Genom 267 : 772-780. Nguyen et al. 2003. Identification and mapping of the QTL for aluminum tolerance introgressed from the nem source, Oryza rufipogon Griff., into indica rice (Oryza sativa L). Theor Appl Genet 106: 583-593 Osaki M, Watanabe T, Tadano T. 1997. Beneficial effect of aluminum on growth of plants adapted to low pH soils. Soil Sci Plant Nutr. 43(3):551-563. Pellet DM, Papernik LA, Kochian LV. 1995. Multiple aluminum- resistance mechanism in wheat: roles of root apical phosphate and malate exudation. Plant Physiol 112:591-597. Prasetiyono J, Tasliah, Aswidinnor H, Moeljopawiro S. 2003. Identifikasi marka mikrosatelit yang terpaut dengan sifat toleransi terhadap keracunan aluminium pada padi persilangan Dupa x ITA131. J Bioteknologi Pertanian. No. 2 vol. 8:3545. Powell W et al.1996. The Comparison of RFLP, RAPD, AFLP, and SSR markers for germplasm analysis. Mol Breed. 2:225-238 Ryan PR, Reid RJ, Smith FA. 1997. Direct evaluation of the Ca2+ -dispalecent hypothesis for Al toxicity. J Plant Physiol 113:1351-1357. Rincon M, Gonzales RA. 1992. Aluminum partitioning in intact roots of aluminumtolerant and aluminum sensitive wheat cultivars. Plant Physiol. 99: 1021-1028. Suprihatno B et al. 2007. Deskripsi varietas padi. Subang : Balai Besar Penelitian Tanaman Padi. Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW. 1984. Ribosomal DNA spacerlength polymorfisme in barley: Mendelian inheritance, chromosomal location and population dynamics. Proc Nati Acad Sci USA 81:8014-8018. Subagyo H, Suharta N, Agus BS. 2000. Tanah-tanah pertanian di Indonesia. hlm. 2165. Dalam A. Adimihardja, L.I. Amien, F. Agus, dan D. Djaenuddin (Ed.). Sumberdaya Lahan Indonesia dan Pengelolaannya. Pusat Penelitian Tanah dan Agroklimat, Bogor.

Samac DA, Tesfaye M. 2003. Plant improvment for tolerance to aluminium in acid soils-a review. Plant Cell Tissue Organ Cult 75: 189-207 Shen YJ et al. 2004. Development of genome-wide DNA polymorphism database for map-based cloning of rice genes. Plant Physiol 135:1198-1205 Samuel TD, Kucukakyuz K, Rincon-Zachary M. 1997. Al partitioning patterns and root growth as related to Al sensitivity and Al tolerance in wheat. J Plant Physiol 113:527-534. Temnykh S et al. 2000. Mapping and genome organization of microsatellite sequences in rice (Oryza sativa L.). Theor Appl Genet. 100: 697-712. Tang Y, Sorrels ME, Kochian LV, Garvin DF. 2000. Identification of RFLP markers linked to barley aluminum tolerance gene Alp. Crop Sci 40:778-782 Vitorello VA, Capaldi FR, Stefanuto VA. 2005. Recent advances in aluminium toxicity and resintensi in hihigher plants. Braz. J Plant Physol. 17(1): 129-143. Van Wambake A. 1991. Soils of the tropics: properties an appraisal. McGraw-Hill, Inc. 343p. Wulansari SA. 2007. Peroksidasi lipid pada akar padi (Oryza sativa L) sebagai respon fisiologi terhadap cekaman aluminium. [skripsi]. Bogor : Fakultas Matematika dan Ilmu Pengetahuan Alam, Institut Pertanian Bogor Wu P et al. 1997. Genetic control of seedling tolerance to aluminum toxicity in rice. Euphytica 97 : 289 293 Wang S. 2003. Statistical Genetics. USA: North Carolina State University Wu P et al. 2000. QTLs and epistasis for aluminum tolerance in rice (Oryza sativa L) at different seedling stages. Theor Appl Genet 100:1295-1303

LAMPIRAN-LAMPIRAN

Lampiran 1 Deskripsi varietas padi IR64. Deskripsi varietas padi IR64 Nomor seleksi Asal persilangan Golongan Umur tanaman Bentuk tanaman Tinggi tanaman Anakan produktif Warna kaki Warna batang Warna telingan daun Warna lidah daun Warna daun Muka daun Posisi daun Daun Bendera Bentuk gabah Warna gabah Kerontokan Kerebahan Tekstur nasi Kadar amilosa Bobot 1000 butir Rata-rata hasil Potensi hasil Ketahanan terhadap Hama Penyakit Anjuran tanam Pemulia Dilepas tahun : IR18348-36-3-3 : IR5657/IR2061 : Cere : 110-120 hari : Tegak : 115-126 cm : 20-35 batang : Hijau : Hijau : Tidak berwarna : Tidak berwarna : Hijau : Kasar : Tegak : Tegak : Ramping, panjang : Kuning bersih : Tahan : Tahan : Pulen : 23% : 24.1 g : 5.0t/ha GKG : 6.0t/ha GKG : : - Tahan wereng cokelat biotipe 1.2 dan agak tahan wereng cokelat biotipe 3 : - Agak tahan hawar daun bakteri strain IV - Tahan virus kerdil rumput : - Baik ditanam di lahan sawah irigasi dataran rendah sampai sedang : Introduksi dari IRRI : 1986 ( Suprihatno B et al. 2007)

Lampiran 2 Deskripsi varietas padi Hawarabunar. Deskripsi varietas padi Hawarabunar Warna lamina daun Postur tanaman Ketahanan terhadap Jumlah anakan Tinggi tanaman Umur berbunga Berat kering : Hujau tua : Tegak : Aluminium (Jagau . 2000) :7 : 158.3 cm : 120 hari : 44.3 g (Dwinita et al. 2008)

Lampiran 3 Komposisi media minimum untuk kultur hara percobaan cekaman Al pada padi (Miftahudin et al. 2002).

Reagen (PA) CaCl2.2H2O KNO3 MgCl2.6H2O (NH4)2SO4 NH4NO3

Konsentrasi 0.4 mM 0.65 mM 0.25 mM 0.01 mM 0.04 mM

Lampiran 4 Sekuen 14 pasang primer SSR pada kromosom 2 yang dianalisis.

No.

Primer

Sekuen Chr II 5AATCTGGGCCTGCTCTTTTC3 5TCCTAGGGTGAAGAAAGGGG3 5TCATGTTGACGCACACATACACG3 5CTCTTCTTCCCTGGACCACACC3 5AGCGCAACAACCAATCCATCCG3 5AAGAAGCTGCCTTTGACGCTATGG3 5CCGATCTCATCAACCAACTG3 5CTTCACGAGGATCTCAAAGG3 5GCGGGAGAGGGATCTCCT3 5GGCTAGGAGTTAACCTCGCG3 5CAAGAAACCTCAATCCGAGC3 5CTCCTCCCGATCCCAATC3 5CCCAAGCAATACGTCCCTAG3 5ACCTGGTCATGACAAGGAGG3 5TTGGATCAGCCAAAGGAGAC3 5CAGCTTGTGGCATGGATAC3 5CTGATCGAGAGCGTTAAGGG3 5GGGATCAAACCACGTTTCTG3 5AGCGACGCCAAGACAAGTCGGG3 5TCCACGTCGATCGACACGACGG3 5CCTCACGATTTTCCTCCAAC3 5ACGGTGGGATTAGACTGTGC3 5GGGAGGAGAGGCAAGCGGAGAG3 5AGCCGGTGCAGTGGACGGTGAC3 5GGTTCAAACCAAGCTGATCA3 5GATGAAGGCCTTCCACGCAG3 5AAACCACAGTAGTACGCCGG3 5TCCATCCACATCTCCCTCTC3

Ukuran dan suhu annealing 213 pb 55C 170 pb 65C 233 pb 55C 161 pb 55C 174 pb 55C 172 pb 55C 240 pb 55C 223 pb 55C 209 pb 56C 208 pb 55C 235 pb 55C 128 pb 69C 153 pb 56C 143 pb 55C

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28

RM498 F RM498 R RM573 F RM573 R RM138 F RM138 R RM211 F RM211 R RM279 F RM279 R RM341 F RM341 R RM526 F RM526 R RM555 F RM555 R RM452 F RM452 R RM174 F RM174 R RM475 F RM475 R RM112 F RM112 R RM250 F RM250 R RM450 F RM450 R

Lampiran 5 Sekuen 7 pasang primer SSR pada kromosom 3 yang dianalisis.

No.

Primer

Sekuen Chr III 5CAATGGCAGAGACCCAAAAG3 5CTGGCATGTAACGACAGTGG3 5TGCTGCTTGCCTGCTTCCTTT3 5GAAACGAATCAATCCACGGC3 5GGCTTACTGGCTTCGATTTG3 5CGTCTCCTTTGGTTAGTGCC3 5CTTAAGCCGATGCATGAAGG3 5ATCCTATCGACGAATGCACC3 5GTTCTTCAACTCCCAGTGCG3 5TGACGATGTGGAAAGCAAG3 5ACTTGAGACGATCGGACACC3 5TCACCCATGGATGTTGTCAG3 5CCGGTATCCTTCGATATTGC3 5CCGACTTTTCCTCCTGACG3

Ukuran dan suhu annealing 226 pb 55C 116 pb 55C 266 pb 56C 257 pb 55C 208 pb 54C 271 pb 56C 158 pb 55C

1 2 3 4 5 6 7 8 9 10 11 12 13 14

RM545 F RM545 R RM168 F RM168 R RM517 F RM517 R RM442 F RM442 R RM570 F RM570 R RM489 F RM489 R RM232 F RM232 R

Lampiran 6 Hasil uji t-student (=5%) untuk karakter fisiologi tetua IR64 dan Hawarabunar pada tanah asam dan tanah biasa.Levene's Test for Equality of Variances t-test for Equality of Means

Sig. (2tailed) F Sig. t df

Mea Std. Error 95% n Difference Confiden Differ ce ence Interval of the Differenc e Lower 13,3 500

Upper

Equal variance s assume d Equal variance s not assume d PPAHB Equal variance s assume d Equal variance s not assume d

PPAIR

4,961

,032

11,874

38

,000

1,1243

11,0739 15,6261

11,874

27,701

,000

13,3 500

1,1243

11,0458 15,6542

3,694

,062

11,623

38

,000

24,0 000

2,0649

19,8198 28,1802

11,623

31,544

,000

24,0 000

2,0649

19,7915 28,2085

Lampiran 7 Penanaman padi secara gogo pada tanah Podsolid Merah Kuning di rumah kaca Cikabayan, IPB Bogor.

Populasi F2 di tanah asam

Individu F2, tetua IR64, tetua HB di tanah asam dan kontrol

Lampiran 8 Hasil analisis contoh tanah asam di Balai Penelitian Tanah.

Parameter Tekstur Tanah

Sub parameter Pasir Debu Liat H2O KCl C N

Sampel Tanah 1 8 26 66 4,8 4,1 1,19 0,14 8,6 17 2 12 26 62 4,8 4,1 1,15 0,12 6,2 19 1,51 0,61 0,03 0,08 2,85 0,41 3 8 25 67 4,9 4,1 1,11 0,13 6,8 32 1,91 0,64 0,06 0,12 2,56 0,33

Rerata 9,33 25,67 65,00 4,83 4,10 1,15 0,13 7,20 22,67 1,80 0,61 0,04 0,16 2,77 0,36

Satuan % % %

pH

Bahan Organik

% %

Bray 1 P2O5 Morgan K2O Nilai Tukar Kation (NH4-Acetat 1N, pH7 Ca Mg K Na Al3+ H+

ppm

ppm cmol(+)/kg cmol(+)/kg cmol(+)/kg cmol(+)/kg

1,97 0,59 0,03 0,28 2,89 0,34

KCl 1N

cmol(+)/kg cmol(+)/kg

Lampiran 9 Hasil uji t-student (=5%) untuk karakter agronomi tetua IR64 dan Hawarabunar pada tanah asam dan tanah biasa.Leven e's Test for Equali ty of Varia nces

t-test for Equality of Means

F

Sig.

t

df

Sig. (2tailed)

Mean Difference

Lower ttir Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances ,178

Upper ,680

Lower -,266

Upper 14

Lower ,794

Upper -,38095

Std. Erro r Diff ere nce Low er 1,43 446 1,38 812 3,96 691 4,02 696 3,39 304 3,10 820 9,53 713 9,64 039 4,46 500 4,27 763 18,5 556 6 18,6 999 9 1,12 636 1,13 400 2,37 859

95% Confidence Interval of the Difference

Upper -3,45755

Lower 2,69565

-,274 1,435 1,414 6,178 ,026 1,926

13,995

,788

-,38095

-3,35827

2,59636

tthb

,912

,355

15

,172

-5,69444

-14,14971

2,76082

13,268

,180

-5,69444

-14,37636

2,98747

bhir

14

,075

6,53365

-,74370

13,81100

2,102

11,720

,058

6,53365

-,25654

13,32384

bhhb

,317

,582

-,797

15

,438

-7,60097

-27,92888

12,72693

-,788 1,553 1,621 ,732 ,406 1,621 1,609 ,172 ,685 4,552 4,521 ,639 ,437 1,092

13,796

,444

-7,60097

-28,30621

13,10427

bnir

2,012

,178

14

,143

-6,93222

-16,50870

2,64426

13,947

,127

-6,93222

-16,11011

2,24567

bnhb

15

,126

-30,08589

-69,63634

9,46456

14,130

,130

-30,08589

-70,15883

9,98705

bbtir

14

,000

-5,12698

-7,54279

-2,71118

12,696 15

,001 ,292

-5,12698 -2,59722

-7,58283 -7,66707

-2,67113 2,47263

bbthb

assumed Equal variances not assumed

1,067

12,107

,307

-2,59722

2,43 477

-7,89692

2,70248